|
0
|
1 {
|
|
|
2 "a_galaxy_workflow": "true",
|
|
|
3 "annotation": "RNA Probing analysis workflow for single\n-end data. RNA Probing suite must be installed in the Galaxy instance you are using in order to run this workflow (https://testtoolshed.g2.bx.psu.edu/view/nikos/rna_probing).",
|
|
|
4 "format-version": "0.1",
|
|
|
5 "name": "HRF-Seq data analysis (Single-end)",
|
|
|
6 "steps": {
|
|
|
7 "0": {
|
|
|
8 "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
9 "id": 0,
|
|
|
10 "input_connections": {},
|
|
|
11 "inputs": [
|
|
|
12 {
|
|
|
13 "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
14 "name": "Reads (Treated)"
|
|
|
15 }
|
|
|
16 ],
|
|
|
17 "name": "Input dataset",
|
|
|
18 "outputs": [],
|
|
|
19 "position": {
|
|
|
20 "left": 277.3333411216736,
|
|
|
21 "top": 318.6875157356262
|
|
|
22 },
|
|
|
23 "tool_errors": null,
|
|
|
24 "tool_id": null,
|
|
|
25 "tool_state": "{\"name\": \"Reads (Treated)\"}",
|
|
|
26 "tool_version": null,
|
|
|
27 "type": "data_input",
|
|
|
28 "user_outputs": []
|
|
|
29 },
|
|
|
30 "1": {
|
|
|
31 "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
32 "id": 1,
|
|
|
33 "input_connections": {},
|
|
|
34 "inputs": [
|
|
|
35 {
|
|
|
36 "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
37 "name": "Reads (Control)"
|
|
|
38 }
|
|
|
39 ],
|
|
|
40 "name": "Input dataset",
|
|
|
41 "outputs": [],
|
|
|
42 "position": {
|
|
|
43 "left": 268.87847661972046,
|
|
|
44 "top": 785.2326512336731
|
|
|
45 },
|
|
|
46 "tool_errors": null,
|
|
|
47 "tool_id": null,
|
|
|
48 "tool_state": "{\"name\": \"Reads (Control)\"}",
|
|
|
49 "tool_version": null,
|
|
|
50 "type": "data_input",
|
|
|
51 "user_outputs": []
|
|
|
52 },
|
|
|
53 "2": {
|
|
|
54 "annotation": "FASTA format",
|
|
|
55 "id": 2,
|
|
|
56 "input_connections": {},
|
|
|
57 "inputs": [
|
|
|
58 {
|
|
|
59 "description": "FASTA format",
|
|
|
60 "name": "Reference sequence"
|
|
|
61 }
|
|
|
62 ],
|
|
|
63 "name": "Input dataset",
|
|
|
64 "outputs": [],
|
|
|
65 "position": {
|
|
|
66 "left": 874.2257361412048,
|
|
|
67 "top": 603.6007542610168
|
|
|
68 },
|
|
|
69 "tool_errors": null,
|
|
|
70 "tool_id": null,
|
|
|
71 "tool_state": "{\"name\": \"Reference sequence\"}",
|
|
|
72 "tool_version": null,
|
|
|
73 "type": "data_input",
|
|
|
74 "user_outputs": []
|
|
|
75 },
|
|
|
76 "3": {
|
|
|
77 "annotation": "",
|
|
|
78 "id": 3,
|
|
|
79 "input_connections": {
|
|
|
80 "input": {
|
|
|
81 "id": 0,
|
|
|
82 "output_name": "output"
|
|
|
83 }
|
|
|
84 },
|
|
|
85 "inputs": [],
|
|
|
86 "name": "Cutadapt",
|
|
|
87 "outputs": [
|
|
|
88 {
|
|
|
89 "name": "report",
|
|
|
90 "type": "txt"
|
|
|
91 },
|
|
|
92 {
|
|
|
93 "name": "output",
|
|
|
94 "type": "input"
|
|
|
95 },
|
|
|
96 {
|
|
|
97 "name": "rest_output",
|
|
|
98 "type": "input"
|
|
|
99 },
|
|
|
100 {
|
|
|
101 "name": "wild_output",
|
|
|
102 "type": "txt"
|
|
|
103 },
|
|
|
104 {
|
|
|
105 "name": "too_short_output",
|
|
|
106 "type": "input"
|
|
|
107 },
|
|
|
108 {
|
|
|
109 "name": "untrimmed_output",
|
|
|
110 "type": "input"
|
|
|
111 }
|
|
|
112 ],
|
|
|
113 "position": {
|
|
|
114 "left": 573.4270911216736,
|
|
|
115 "top": 264.7812657356262
|
|
|
116 },
|
|
|
117 "post_job_actions": {
|
|
|
118 "HideDatasetActionoutput": {
|
|
|
119 "action_arguments": {},
|
|
|
120 "action_type": "HideDatasetAction",
|
|
|
121 "output_name": "output"
|
|
|
122 },
|
|
|
123 "HideDatasetActionreport": {
|
|
|
124 "action_arguments": {},
|
|
|
125 "action_type": "HideDatasetAction",
|
|
|
126 "output_name": "report"
|
|
|
127 },
|
|
|
128 "HideDatasetActionrest_output": {
|
|
|
129 "action_arguments": {},
|
|
|
130 "action_type": "HideDatasetAction",
|
|
|
131 "output_name": "rest_output"
|
|
|
132 },
|
|
|
133 "HideDatasetActiontoo_short_output": {
|
|
|
134 "action_arguments": {},
|
|
|
135 "action_type": "HideDatasetAction",
|
|
|
136 "output_name": "too_short_output"
|
|
|
137 },
|
|
|
138 "HideDatasetActionuntrimmed_output": {
|
|
|
139 "action_arguments": {},
|
|
|
140 "action_type": "HideDatasetAction",
|
|
|
141 "output_name": "untrimmed_output"
|
|
|
142 },
|
|
|
143 "HideDatasetActionwild_output": {
|
|
|
144 "action_arguments": {},
|
|
|
145 "action_type": "HideDatasetAction",
|
|
|
146 "output_name": "wild_output"
|
|
|
147 }
|
|
|
148 },
|
|
|
149 "tool_errors": null,
|
|
|
150 "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a",
|
|
|
151 "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}",
|
|
|
152 "tool_version": "1.1.a",
|
|
|
153 "type": "tool",
|
|
|
154 "user_outputs": []
|
|
|
155 },
|
|
|
156 "4": {
|
|
|
157 "annotation": "",
|
|
|
158 "id": 4,
|
|
|
159 "input_connections": {
|
|
|
160 "input": {
|
|
|
161 "id": 1,
|
|
|
162 "output_name": "output"
|
|
|
163 }
|
|
|
164 },
|
|
|
165 "inputs": [],
|
|
|
166 "name": "Cutadapt",
|
|
|
167 "outputs": [
|
|
|
168 {
|
|
|
169 "name": "report",
|
|
|
170 "type": "txt"
|
|
|
171 },
|
|
|
172 {
|
|
|
173 "name": "output",
|
|
|
174 "type": "input"
|
|
|
175 },
|
|
|
176 {
|
|
|
177 "name": "rest_output",
|
|
|
178 "type": "input"
|
|
|
179 },
|
|
|
180 {
|
|
|
181 "name": "wild_output",
|
|
|
182 "type": "txt"
|
|
|
183 },
|
|
|
184 {
|
|
|
185 "name": "too_short_output",
|
|
|
186 "type": "input"
|
|
|
187 },
|
|
|
188 {
|
|
|
189 "name": "untrimmed_output",
|
|
|
190 "type": "input"
|
|
|
191 }
|
|
|
192 ],
|
|
|
193 "position": {
|
|
|
194 "left": 569.2257361412048,
|
|
|
195 "top": 777.6805882453918
|
|
|
196 },
|
|
|
197 "post_job_actions": {
|
|
|
198 "HideDatasetActionoutput": {
|
|
|
199 "action_arguments": {},
|
|
|
200 "action_type": "HideDatasetAction",
|
|
|
201 "output_name": "output"
|
|
|
202 },
|
|
|
203 "HideDatasetActionreport": {
|
|
|
204 "action_arguments": {},
|
|
|
205 "action_type": "HideDatasetAction",
|
|
|
206 "output_name": "report"
|
|
|
207 },
|
|
|
208 "HideDatasetActionrest_output": {
|
|
|
209 "action_arguments": {},
|
|
|
210 "action_type": "HideDatasetAction",
|
|
|
211 "output_name": "rest_output"
|
|
|
212 },
|
|
|
213 "HideDatasetActiontoo_short_output": {
|
|
|
214 "action_arguments": {},
|
|
|
215 "action_type": "HideDatasetAction",
|
|
|
216 "output_name": "too_short_output"
|
|
|
217 },
|
|
|
218 "HideDatasetActionuntrimmed_output": {
|
|
|
219 "action_arguments": {},
|
|
|
220 "action_type": "HideDatasetAction",
|
|
|
221 "output_name": "untrimmed_output"
|
|
|
222 },
|
|
|
223 "HideDatasetActionwild_output": {
|
|
|
224 "action_arguments": {},
|
|
|
225 "action_type": "HideDatasetAction",
|
|
|
226 "output_name": "wild_output"
|
|
|
227 }
|
|
|
228 },
|
|
|
229 "tool_errors": null,
|
|
|
230 "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a",
|
|
|
231 "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}",
|
|
|
232 "tool_version": "1.1.a",
|
|
|
233 "type": "tool",
|
|
|
234 "user_outputs": []
|
|
|
235 },
|
|
|
236 "5": {
|
|
|
237 "annotation": "",
|
|
|
238 "id": 5,
|
|
|
239 "input_connections": {
|
|
|
240 "library|input1": {
|
|
|
241 "id": 3,
|
|
|
242 "output_name": "output"
|
|
|
243 }
|
|
|
244 },
|
|
|
245 "inputs": [
|
|
|
246 {
|
|
|
247 "description": "runtime parameter for tool Preprocessing",
|
|
|
248 "name": "library"
|
|
|
249 }
|
|
|
250 ],
|
|
|
251 "name": "Preprocessing",
|
|
|
252 "outputs": [
|
|
|
253 {
|
|
|
254 "name": "output1",
|
|
|
255 "type": "fastqsanger"
|
|
|
256 },
|
|
|
257 {
|
|
|
258 "name": "output2",
|
|
|
259 "type": "fastqsanger"
|
|
|
260 },
|
|
|
261 {
|
|
|
262 "name": "barcodes",
|
|
|
263 "type": "tabular"
|
|
|
264 }
|
|
|
265 ],
|
|
|
266 "position": {
|
|
|
267 "left": 874.3472571372986,
|
|
|
268 "top": 318.63542222976685
|
|
|
269 },
|
|
|
270 "post_job_actions": {
|
|
|
271 "HideDatasetActionbarcodes": {
|
|
|
272 "action_arguments": {},
|
|
|
273 "action_type": "HideDatasetAction",
|
|
|
274 "output_name": "barcodes"
|
|
|
275 },
|
|
|
276 "HideDatasetActionoutput1": {
|
|
|
277 "action_arguments": {},
|
|
|
278 "action_type": "HideDatasetAction",
|
|
|
279 "output_name": "output1"
|
|
|
280 },
|
|
|
281 "HideDatasetActionoutput2": {
|
|
|
282 "action_arguments": {},
|
|
|
283 "action_type": "HideDatasetAction",
|
|
|
284 "output_name": "output2"
|
|
|
285 }
|
|
|
286 },
|
|
|
287 "tool_errors": null,
|
|
|
288 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0",
|
|
|
289 "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"input1\\\": null, \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0}\"}",
|
|
|
290 "tool_version": "1.0.0",
|
|
|
291 "type": "tool",
|
|
|
292 "user_outputs": []
|
|
|
293 },
|
|
|
294 "6": {
|
|
|
295 "annotation": "",
|
|
|
296 "id": 6,
|
|
|
297 "input_connections": {
|
|
|
298 "library|input1": {
|
|
|
299 "id": 4,
|
|
|
300 "output_name": "output"
|
|
|
301 }
|
|
|
302 },
|
|
|
303 "inputs": [
|
|
|
304 {
|
|
|
305 "description": "runtime parameter for tool Preprocessing",
|
|
|
306 "name": "library"
|
|
|
307 }
|
|
|
308 ],
|
|
|
309 "name": "Preprocessing",
|
|
|
310 "outputs": [
|
|
|
311 {
|
|
|
312 "name": "output1",
|
|
|
313 "type": "fastqsanger"
|
|
|
314 },
|
|
|
315 {
|
|
|
316 "name": "output2",
|
|
|
317 "type": "fastqsanger"
|
|
|
318 },
|
|
|
319 {
|
|
|
320 "name": "barcodes",
|
|
|
321 "type": "tabular"
|
|
|
322 }
|
|
|
323 ],
|
|
|
324 "position": {
|
|
|
325 "left": 875.4444856643677,
|
|
|
326 "top": 833.8298797607422
|
|
|
327 },
|
|
|
328 "post_job_actions": {
|
|
|
329 "HideDatasetActionbarcodes": {
|
|
|
330 "action_arguments": {},
|
|
|
331 "action_type": "HideDatasetAction",
|
|
|
332 "output_name": "barcodes"
|
|
|
333 },
|
|
|
334 "HideDatasetActionoutput1": {
|
|
|
335 "action_arguments": {},
|
|
|
336 "action_type": "HideDatasetAction",
|
|
|
337 "output_name": "output1"
|
|
|
338 },
|
|
|
339 "HideDatasetActionoutput2": {
|
|
|
340 "action_arguments": {},
|
|
|
341 "action_type": "HideDatasetAction",
|
|
|
342 "output_name": "output2"
|
|
|
343 }
|
|
|
344 },
|
|
|
345 "tool_errors": null,
|
|
|
346 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0",
|
|
|
347 "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"input1\\\": null, \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0}\"}",
|
|
|
348 "tool_version": "1.0.0",
|
|
|
349 "type": "tool",
|
|
|
350 "user_outputs": []
|
|
|
351 },
|
|
|
352 "7": {
|
|
|
353 "annotation": "",
|
|
|
354 "id": 7,
|
|
|
355 "input_connections": {
|
|
|
356 "library|input_1": {
|
|
|
357 "id": 5,
|
|
|
358 "output_name": "output1"
|
|
|
359 },
|
|
|
360 "reference_genome|own_file": {
|
|
|
361 "id": 2,
|
|
|
362 "output_name": "output"
|
|
|
363 }
|
|
|
364 },
|
|
|
365 "inputs": [],
|
|
|
366 "name": "Bowtie2",
|
|
|
367 "outputs": [
|
|
|
368 {
|
|
|
369 "name": "output_unaligned_reads_l",
|
|
|
370 "type": "fastqsanger"
|
|
|
371 },
|
|
|
372 {
|
|
|
373 "name": "output_unaligned_reads_r",
|
|
|
374 "type": "fastqsanger"
|
|
|
375 },
|
|
|
376 {
|
|
|
377 "name": "output",
|
|
|
378 "type": "bam"
|
|
|
379 }
|
|
|
380 ],
|
|
|
381 "position": {
|
|
|
382 "left": 1196.6216101646423,
|
|
|
383 "top": 329.9375157356262
|
|
|
384 },
|
|
|
385 "post_job_actions": {
|
|
|
386 "HideDatasetActionoutput": {
|
|
|
387 "action_arguments": {},
|
|
|
388 "action_type": "HideDatasetAction",
|
|
|
389 "output_name": "output"
|
|
|
390 },
|
|
|
391 "HideDatasetActionoutput_unaligned_reads_l": {
|
|
|
392 "action_arguments": {},
|
|
|
393 "action_type": "HideDatasetAction",
|
|
|
394 "output_name": "output_unaligned_reads_l"
|
|
|
395 },
|
|
|
396 "HideDatasetActionoutput_unaligned_reads_r": {
|
|
|
397 "action_arguments": {},
|
|
|
398 "action_type": "HideDatasetAction",
|
|
|
399 "output_name": "output_unaligned_reads_r"
|
|
|
400 }
|
|
|
401 },
|
|
|
402 "tool_errors": null,
|
|
|
403 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2",
|
|
|
404 "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}",
|
|
|
405 "tool_version": "0.2",
|
|
|
406 "type": "tool",
|
|
|
407 "user_outputs": []
|
|
|
408 },
|
|
|
409 "8": {
|
|
|
410 "annotation": "",
|
|
|
411 "id": 8,
|
|
|
412 "input_connections": {
|
|
|
413 "library|input_1": {
|
|
|
414 "id": 6,
|
|
|
415 "output_name": "output1"
|
|
|
416 },
|
|
|
417 "reference_genome|own_file": {
|
|
|
418 "id": 2,
|
|
|
419 "output_name": "output"
|
|
|
420 }
|
|
|
421 },
|
|
|
422 "inputs": [],
|
|
|
423 "name": "Bowtie2",
|
|
|
424 "outputs": [
|
|
|
425 {
|
|
|
426 "name": "output_unaligned_reads_l",
|
|
|
427 "type": "fastqsanger"
|
|
|
428 },
|
|
|
429 {
|
|
|
430 "name": "output_unaligned_reads_r",
|
|
|
431 "type": "fastqsanger"
|
|
|
432 },
|
|
|
433 {
|
|
|
434 "name": "output",
|
|
|
435 "type": "bam"
|
|
|
436 }
|
|
|
437 ],
|
|
|
438 "position": {
|
|
|
439 "left": 1201.5000281333923,
|
|
|
440 "top": 798.9305882453918
|
|
|
441 },
|
|
|
442 "post_job_actions": {
|
|
|
443 "HideDatasetActionoutput": {
|
|
|
444 "action_arguments": {},
|
|
|
445 "action_type": "HideDatasetAction",
|
|
|
446 "output_name": "output"
|
|
|
447 },
|
|
|
448 "HideDatasetActionoutput_unaligned_reads_l": {
|
|
|
449 "action_arguments": {},
|
|
|
450 "action_type": "HideDatasetAction",
|
|
|
451 "output_name": "output_unaligned_reads_l"
|
|
|
452 },
|
|
|
453 "HideDatasetActionoutput_unaligned_reads_r": {
|
|
|
454 "action_arguments": {},
|
|
|
455 "action_type": "HideDatasetAction",
|
|
|
456 "output_name": "output_unaligned_reads_r"
|
|
|
457 }
|
|
|
458 },
|
|
|
459 "tool_errors": null,
|
|
|
460 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2",
|
|
|
461 "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}",
|
|
|
462 "tool_version": "0.2",
|
|
|
463 "type": "tool",
|
|
|
464 "user_outputs": []
|
|
|
465 },
|
|
|
466 "9": {
|
|
|
467 "annotation": "",
|
|
|
468 "id": 9,
|
|
|
469 "input_connections": {
|
|
|
470 "input1": {
|
|
|
471 "id": 7,
|
|
|
472 "output_name": "output"
|
|
|
473 },
|
|
|
474 "input2": {
|
|
|
475 "id": 5,
|
|
|
476 "output_name": "barcodes"
|
|
|
477 }
|
|
|
478 },
|
|
|
479 "inputs": [],
|
|
|
480 "name": "Summarize Unique Barcodes",
|
|
|
481 "outputs": [
|
|
|
482 {
|
|
|
483 "name": "trimming_stats",
|
|
|
484 "type": "tabular"
|
|
|
485 },
|
|
|
486 {
|
|
|
487 "name": "unique_barcodes",
|
|
|
488 "type": "tabular"
|
|
|
489 },
|
|
|
490 {
|
|
|
491 "name": "read_counts",
|
|
|
492 "type": "tabular"
|
|
|
493 },
|
|
|
494 {
|
|
|
495 "name": "k2n_file",
|
|
|
496 "type": "txt"
|
|
|
497 }
|
|
|
498 ],
|
|
|
499 "position": {
|
|
|
500 "left": 1612.2639441490173,
|
|
|
501 "top": 342.5764012336731
|
|
|
502 },
|
|
|
503 "post_job_actions": {
|
|
|
504 "HideDatasetActionread_counts": {
|
|
|
505 "action_arguments": {},
|
|
|
506 "action_type": "HideDatasetAction",
|
|
|
507 "output_name": "read_counts"
|
|
|
508 },
|
|
|
509 "HideDatasetActiontrimming_stats": {
|
|
|
510 "action_arguments": {},
|
|
|
511 "action_type": "HideDatasetAction",
|
|
|
512 "output_name": "trimming_stats"
|
|
|
513 },
|
|
|
514 "RenameDatasetActionk2n_file": {
|
|
|
515 "action_arguments": {
|
|
|
516 "newname": "k2n file (Treated)"
|
|
|
517 },
|
|
|
518 "action_type": "RenameDatasetAction",
|
|
|
519 "output_name": "k2n_file"
|
|
|
520 },
|
|
|
521 "RenameDatasetActionunique_barcodes": {
|
|
|
522 "action_arguments": {
|
|
|
523 "newname": "Unique Barcodes (Treated)"
|
|
|
524 },
|
|
|
525 "action_type": "RenameDatasetAction",
|
|
|
526 "output_name": "unique_barcodes"
|
|
|
527 }
|
|
|
528 },
|
|
|
529 "tool_errors": null,
|
|
|
530 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0",
|
|
|
531 "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}",
|
|
|
532 "tool_version": "1.0.0",
|
|
|
533 "type": "tool",
|
|
|
534 "user_outputs": []
|
|
|
535 },
|
|
|
536 "10": {
|
|
|
537 "annotation": "",
|
|
|
538 "id": 10,
|
|
|
539 "input_connections": {
|
|
|
540 "input1": {
|
|
|
541 "id": 8,
|
|
|
542 "output_name": "output"
|
|
|
543 },
|
|
|
544 "input2": {
|
|
|
545 "id": 6,
|
|
|
546 "output_name": "barcodes"
|
|
|
547 }
|
|
|
548 },
|
|
|
549 "inputs": [],
|
|
|
550 "name": "Summarize Unique Barcodes",
|
|
|
551 "outputs": [
|
|
|
552 {
|
|
|
553 "name": "trimming_stats",
|
|
|
554 "type": "tabular"
|
|
|
555 },
|
|
|
556 {
|
|
|
557 "name": "unique_barcodes",
|
|
|
558 "type": "tabular"
|
|
|
559 },
|
|
|
560 {
|
|
|
561 "name": "read_counts",
|
|
|
562 "type": "tabular"
|
|
|
563 },
|
|
|
564 {
|
|
|
565 "name": "k2n_file",
|
|
|
566 "type": "txt"
|
|
|
567 }
|
|
|
568 ],
|
|
|
569 "position": {
|
|
|
570 "left": 1611.6389441490173,
|
|
|
571 "top": 805.0590672492981
|
|
|
572 },
|
|
|
573 "post_job_actions": {
|
|
|
574 "HideDatasetActionread_counts": {
|
|
|
575 "action_arguments": {},
|
|
|
576 "action_type": "HideDatasetAction",
|
|
|
577 "output_name": "read_counts"
|
|
|
578 },
|
|
|
579 "HideDatasetActiontrimming_stats": {
|
|
|
580 "action_arguments": {},
|
|
|
581 "action_type": "HideDatasetAction",
|
|
|
582 "output_name": "trimming_stats"
|
|
|
583 },
|
|
|
584 "RenameDatasetActionk2n_file": {
|
|
|
585 "action_arguments": {
|
|
|
586 "newname": "k2n file (Control)"
|
|
|
587 },
|
|
|
588 "action_type": "RenameDatasetAction",
|
|
|
589 "output_name": "k2n_file"
|
|
|
590 },
|
|
|
591 "RenameDatasetActionunique_barcodes": {
|
|
|
592 "action_arguments": {
|
|
|
593 "newname": "Unique Barcodes (Control)"
|
|
|
594 },
|
|
|
595 "action_type": "RenameDatasetAction",
|
|
|
596 "output_name": "unique_barcodes"
|
|
|
597 }
|
|
|
598 },
|
|
|
599 "tool_errors": null,
|
|
|
600 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0",
|
|
|
601 "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}",
|
|
|
602 "tool_version": "1.0.0",
|
|
|
603 "type": "tool",
|
|
|
604 "user_outputs": []
|
|
|
605 },
|
|
|
606 "11": {
|
|
|
607 "annotation": "",
|
|
|
608 "id": 11,
|
|
|
609 "input_connections": {
|
|
|
610 "control": {
|
|
|
611 "id": 10,
|
|
|
612 "output_name": "unique_barcodes"
|
|
|
613 },
|
|
|
614 "euc_method|k2n_control": {
|
|
|
615 "id": 10,
|
|
|
616 "output_name": "k2n_file"
|
|
|
617 },
|
|
|
618 "euc_method|k2n_treated": {
|
|
|
619 "id": 9,
|
|
|
620 "output_name": "k2n_file"
|
|
|
621 },
|
|
|
622 "fasta": {
|
|
|
623 "id": 2,
|
|
|
624 "output_name": "output"
|
|
|
625 },
|
|
|
626 "treated": {
|
|
|
627 "id": 9,
|
|
|
628 "output_name": "unique_barcodes"
|
|
|
629 }
|
|
|
630 },
|
|
|
631 "inputs": [],
|
|
|
632 "name": "Normalize",
|
|
|
633 "outputs": [
|
|
|
634 {
|
|
|
635 "name": "normalized",
|
|
|
636 "type": "tabular"
|
|
|
637 },
|
|
|
638 {
|
|
|
639 "name": "bedgraph_dtcr",
|
|
|
640 "type": "bedgraph"
|
|
|
641 },
|
|
|
642 {
|
|
|
643 "name": "bedgraph_slograt",
|
|
|
644 "type": "bedgraph"
|
|
|
645 },
|
|
|
646 {
|
|
|
647 "name": "bedgraph_swinsor",
|
|
|
648 "type": "bedgraph"
|
|
|
649 }
|
|
|
650 ],
|
|
|
651 "position": {
|
|
|
652 "left": 1994.1910681724548,
|
|
|
653 "top": 533.5139012336731
|
|
|
654 },
|
|
|
655 "post_job_actions": {
|
|
|
656 "HideDatasetActionbedgraph_dtcr": {
|
|
|
657 "action_arguments": {},
|
|
|
658 "action_type": "HideDatasetAction",
|
|
|
659 "output_name": "bedgraph_dtcr"
|
|
|
660 },
|
|
|
661 "HideDatasetActionbedgraph_slograt": {
|
|
|
662 "action_arguments": {},
|
|
|
663 "action_type": "HideDatasetAction",
|
|
|
664 "output_name": "bedgraph_slograt"
|
|
|
665 },
|
|
|
666 "HideDatasetActionbedgraph_swinsor": {
|
|
|
667 "action_arguments": {},
|
|
|
668 "action_type": "HideDatasetAction",
|
|
|
669 "output_name": "bedgraph_swinsor"
|
|
|
670 }
|
|
|
671 },
|
|
|
672 "tool_errors": null,
|
|
|
673 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_normalize/1.0.0",
|
|
|
674 "tool_state": "{\"control\": \"null\", \"cutoff\": \"\\\"101\\\"\", \"swinsor\": \"{\\\"wsize\\\": \\\"71\\\", \\\"only_top\\\": \\\"False\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"winsor_level\\\": \\\"0.9\\\"}\", \"nt_offset\": \"\\\"1\\\"\", \"__page__\": 0, \"euc_method\": \"{\\\"k2n_treated\\\": null, \\\"k2n_control\\\": null, \\\"euc\\\": \\\"HRF-Seq\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null, \"compdata\": \"\\\"True\\\"\", \"dtcr\": \"{\\\"wsize\\\": \\\"3\\\", \\\"zero\\\": \\\"True\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"fasta\": \"null\", \"slograt\": \"{\\\"wsize\\\": \\\"5\\\", \\\"depth_cor\\\": \\\"RNA\\\", \\\"pseudocount\\\": \\\"5\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"treated\": \"null\", \"bedgraph\": \"{\\\"check\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\"}",
|
|
|
675 "tool_version": "1.0.0",
|
|
|
676 "type": "tool",
|
|
|
677 "user_outputs": []
|
|
|
678 }
|
|
|
679 },
|
|
|
680 "uuid": "977f740a-c1f5-47c9-85f8-753fba9f2df6"
|
|
|
681 } |
