Mercurial > repos > nikos > rna_probing_workflows

comparison HRF-Seq_workflow_single-end.ga @ 0:608dbf6d6196 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author nikos
date Wed, 05 Nov 2014 10:57:10 -0500
parents
children 032515bba482
comparison
equal deleted inserted replaced
-1:000000000000 0:608dbf6d6196
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "RNA Probing analysis workflow for single\n-end data. RNA Probing suite must be installed in the Galaxy instance you are using in order to run this workflow (https://testtoolshed.g2.bx.psu.edu/view/nikos/rna_probing).",
4 "format-version": "0.1",
5 "name": "HRF-Seq data analysis (Single-end)",
6 "steps": {
7 "0": {
8 "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
9 "id": 0,
10 "input_connections": {},
11 "inputs": [
12 {
13 "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
14 "name": "Reads (Treated)"
15 }
16 ],
17 "name": "Input dataset",
18 "outputs": [],
19 "position": {
20 "left": 277.3333411216736,
21 "top": 318.6875157356262
22 },
23 "tool_errors": null,
24 "tool_id": null,
25 "tool_state": "{\"name\": \"Reads (Treated)\"}",
26 "tool_version": null,
27 "type": "data_input",
28 "user_outputs": []
29 },
30 "1": {
31 "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
32 "id": 1,
33 "input_connections": {},
34 "inputs": [
35 {
36 "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
37 "name": "Reads (Control)"
38 }
39 ],
40 "name": "Input dataset",
41 "outputs": [],
42 "position": {
43 "left": 268.87847661972046,
44 "top": 785.2326512336731
45 },
46 "tool_errors": null,
47 "tool_id": null,
48 "tool_state": "{\"name\": \"Reads (Control)\"}",
49 "tool_version": null,
50 "type": "data_input",
51 "user_outputs": []
52 },
53 "2": {
54 "annotation": "FASTA format",
55 "id": 2,
56 "input_connections": {},
57 "inputs": [
58 {
59 "description": "FASTA format",
60 "name": "Reference sequence"
61 }
62 ],
63 "name": "Input dataset",
64 "outputs": [],
65 "position": {
66 "left": 874.2257361412048,
67 "top": 603.6007542610168
68 },
69 "tool_errors": null,
70 "tool_id": null,
71 "tool_state": "{\"name\": \"Reference sequence\"}",
72 "tool_version": null,
73 "type": "data_input",
74 "user_outputs": []
75 },
76 "3": {
77 "annotation": "",
78 "id": 3,
79 "input_connections": {
80 "input": {
81 "id": 0,
82 "output_name": "output"
83 }
84 },
85 "inputs": [],
86 "name": "Cutadapt",
87 "outputs": [
88 {
89 "name": "report",
90 "type": "txt"
91 },
92 {
93 "name": "output",
94 "type": "input"
95 },
96 {
97 "name": "rest_output",
98 "type": "input"
99 },
100 {
101 "name": "wild_output",
102 "type": "txt"
103 },
104 {
105 "name": "too_short_output",
106 "type": "input"
107 },
108 {
109 "name": "untrimmed_output",
110 "type": "input"
111 }
112 ],
113 "position": {
114 "left": 573.4270911216736,
115 "top": 264.7812657356262
116 },
117 "post_job_actions": {
118 "HideDatasetActionoutput": {
119 "action_arguments": {},
120 "action_type": "HideDatasetAction",
121 "output_name": "output"
122 },
123 "HideDatasetActionreport": {
124 "action_arguments": {},
125 "action_type": "HideDatasetAction",
126 "output_name": "report"
127 },
128 "HideDatasetActionrest_output": {
129 "action_arguments": {},
130 "action_type": "HideDatasetAction",
131 "output_name": "rest_output"
132 },
133 "HideDatasetActiontoo_short_output": {
134 "action_arguments": {},
135 "action_type": "HideDatasetAction",
136 "output_name": "too_short_output"
137 },
138 "HideDatasetActionuntrimmed_output": {
139 "action_arguments": {},
140 "action_type": "HideDatasetAction",
141 "output_name": "untrimmed_output"
142 },
143 "HideDatasetActionwild_output": {
144 "action_arguments": {},
145 "action_type": "HideDatasetAction",
146 "output_name": "wild_output"
147 }
148 },
149 "tool_errors": null,
150 "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a",
151 "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}",
152 "tool_version": "1.1.a",
153 "type": "tool",
154 "user_outputs": []
155 },
156 "4": {
157 "annotation": "",
158 "id": 4,
159 "input_connections": {
160 "input": {
161 "id": 1,
162 "output_name": "output"
163 }
164 },
165 "inputs": [],
166 "name": "Cutadapt",
167 "outputs": [
168 {
169 "name": "report",
170 "type": "txt"
171 },
172 {
173 "name": "output",
174 "type": "input"
175 },
176 {
177 "name": "rest_output",
178 "type": "input"
179 },
180 {
181 "name": "wild_output",
182 "type": "txt"
183 },
184 {
185 "name": "too_short_output",
186 "type": "input"
187 },
188 {
189 "name": "untrimmed_output",
190 "type": "input"
191 }
192 ],
193 "position": {
194 "left": 569.2257361412048,
195 "top": 777.6805882453918
196 },
197 "post_job_actions": {
198 "HideDatasetActionoutput": {
199 "action_arguments": {},
200 "action_type": "HideDatasetAction",
201 "output_name": "output"
202 },
203 "HideDatasetActionreport": {
204 "action_arguments": {},
205 "action_type": "HideDatasetAction",
206 "output_name": "report"
207 },
208 "HideDatasetActionrest_output": {
209 "action_arguments": {},
210 "action_type": "HideDatasetAction",
211 "output_name": "rest_output"
212 },
213 "HideDatasetActiontoo_short_output": {
214 "action_arguments": {},
215 "action_type": "HideDatasetAction",
216 "output_name": "too_short_output"
217 },
218 "HideDatasetActionuntrimmed_output": {
219 "action_arguments": {},
220 "action_type": "HideDatasetAction",
221 "output_name": "untrimmed_output"
222 },
223 "HideDatasetActionwild_output": {
224 "action_arguments": {},
225 "action_type": "HideDatasetAction",
226 "output_name": "wild_output"
227 }
228 },
229 "tool_errors": null,
230 "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a",
231 "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}",
232 "tool_version": "1.1.a",
233 "type": "tool",
234 "user_outputs": []
235 },
236 "5": {
237 "annotation": "",
238 "id": 5,
239 "input_connections": {
240 "library|input1": {
241 "id": 3,
242 "output_name": "output"
243 }
244 },
245 "inputs": [
246 {
247 "description": "runtime parameter for tool Preprocessing",
248 "name": "library"
249 }
250 ],
251 "name": "Preprocessing",
252 "outputs": [
253 {
254 "name": "output1",
255 "type": "fastqsanger"
256 },
257 {
258 "name": "output2",
259 "type": "fastqsanger"
260 },
261 {
262 "name": "barcodes",
263 "type": "tabular"
264 }
265 ],
266 "position": {
267 "left": 874.3472571372986,
268 "top": 318.63542222976685
269 },
270 "post_job_actions": {
271 "HideDatasetActionbarcodes": {
272 "action_arguments": {},
273 "action_type": "HideDatasetAction",
274 "output_name": "barcodes"
275 },
276 "HideDatasetActionoutput1": {
277 "action_arguments": {},
278 "action_type": "HideDatasetAction",
279 "output_name": "output1"
280 },
281 "HideDatasetActionoutput2": {
282 "action_arguments": {},
283 "action_type": "HideDatasetAction",
284 "output_name": "output2"
285 }
286 },
287 "tool_errors": null,
288 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0",
289 "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"input1\\\": null, \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0}\"}",
290 "tool_version": "1.0.0",
291 "type": "tool",
292 "user_outputs": []
293 },
294 "6": {
295 "annotation": "",
296 "id": 6,
297 "input_connections": {
298 "library|input1": {
299 "id": 4,
300 "output_name": "output"
301 }
302 },
303 "inputs": [
304 {
305 "description": "runtime parameter for tool Preprocessing",
306 "name": "library"
307 }
308 ],
309 "name": "Preprocessing",
310 "outputs": [
311 {
312 "name": "output1",
313 "type": "fastqsanger"
314 },
315 {
316 "name": "output2",
317 "type": "fastqsanger"
318 },
319 {
320 "name": "barcodes",
321 "type": "tabular"
322 }
323 ],
324 "position": {
325 "left": 875.4444856643677,
326 "top": 833.8298797607422
327 },
328 "post_job_actions": {
329 "HideDatasetActionbarcodes": {
330 "action_arguments": {},
331 "action_type": "HideDatasetAction",
332 "output_name": "barcodes"
333 },
334 "HideDatasetActionoutput1": {
335 "action_arguments": {},
336 "action_type": "HideDatasetAction",
337 "output_name": "output1"
338 },
339 "HideDatasetActionoutput2": {
340 "action_arguments": {},
341 "action_type": "HideDatasetAction",
342 "output_name": "output2"
343 }
344 },
345 "tool_errors": null,
346 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0",
347 "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"input1\\\": null, \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0}\"}",
348 "tool_version": "1.0.0",
349 "type": "tool",
350 "user_outputs": []
351 },
352 "7": {
353 "annotation": "",
354 "id": 7,
355 "input_connections": {
356 "library|input_1": {
357 "id": 5,
358 "output_name": "output1"
359 },
360 "reference_genome|own_file": {
361 "id": 2,
362 "output_name": "output"
363 }
364 },
365 "inputs": [],
366 "name": "Bowtie2",
367 "outputs": [
368 {
369 "name": "output_unaligned_reads_l",
370 "type": "fastqsanger"
371 },
372 {
373 "name": "output_unaligned_reads_r",
374 "type": "fastqsanger"
375 },
376 {
377 "name": "output",
378 "type": "bam"
379 }
380 ],
381 "position": {
382 "left": 1196.6216101646423,
383 "top": 329.9375157356262
384 },
385 "post_job_actions": {
386 "HideDatasetActionoutput": {
387 "action_arguments": {},
388 "action_type": "HideDatasetAction",
389 "output_name": "output"
390 },
391 "HideDatasetActionoutput_unaligned_reads_l": {
392 "action_arguments": {},
393 "action_type": "HideDatasetAction",
394 "output_name": "output_unaligned_reads_l"
395 },
396 "HideDatasetActionoutput_unaligned_reads_r": {
397 "action_arguments": {},
398 "action_type": "HideDatasetAction",
399 "output_name": "output_unaligned_reads_r"
400 }
401 },
402 "tool_errors": null,
403 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2",
404 "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}",
405 "tool_version": "0.2",
406 "type": "tool",
407 "user_outputs": []
408 },
409 "8": {
410 "annotation": "",
411 "id": 8,
412 "input_connections": {
413 "library|input_1": {
414 "id": 6,
415 "output_name": "output1"
416 },
417 "reference_genome|own_file": {
418 "id": 2,
419 "output_name": "output"
420 }
421 },
422 "inputs": [],
423 "name": "Bowtie2",
424 "outputs": [
425 {
426 "name": "output_unaligned_reads_l",
427 "type": "fastqsanger"
428 },
429 {
430 "name": "output_unaligned_reads_r",
431 "type": "fastqsanger"
432 },
433 {
434 "name": "output",
435 "type": "bam"
436 }
437 ],
438 "position": {
439 "left": 1201.5000281333923,
440 "top": 798.9305882453918
441 },
442 "post_job_actions": {
443 "HideDatasetActionoutput": {
444 "action_arguments": {},
445 "action_type": "HideDatasetAction",
446 "output_name": "output"
447 },
448 "HideDatasetActionoutput_unaligned_reads_l": {
449 "action_arguments": {},
450 "action_type": "HideDatasetAction",
451 "output_name": "output_unaligned_reads_l"
452 },
453 "HideDatasetActionoutput_unaligned_reads_r": {
454 "action_arguments": {},
455 "action_type": "HideDatasetAction",
456 "output_name": "output_unaligned_reads_r"
457 }
458 },
459 "tool_errors": null,
460 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2",
461 "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}",
462 "tool_version": "0.2",
463 "type": "tool",
464 "user_outputs": []
465 },
466 "9": {
467 "annotation": "",
468 "id": 9,
469 "input_connections": {
470 "input1": {
471 "id": 7,
472 "output_name": "output"
473 },
474 "input2": {
475 "id": 5,
476 "output_name": "barcodes"
477 }
478 },
479 "inputs": [],
480 "name": "Summarize Unique Barcodes",
481 "outputs": [
482 {
483 "name": "trimming_stats",
484 "type": "tabular"
485 },
486 {
487 "name": "unique_barcodes",
488 "type": "tabular"
489 },
490 {
491 "name": "read_counts",
492 "type": "tabular"
493 },
494 {
495 "name": "k2n_file",
496 "type": "txt"
497 }
498 ],
499 "position": {
500 "left": 1612.2639441490173,
501 "top": 342.5764012336731
502 },
503 "post_job_actions": {
504 "HideDatasetActionread_counts": {
505 "action_arguments": {},
506 "action_type": "HideDatasetAction",
507 "output_name": "read_counts"
508 },
509 "HideDatasetActiontrimming_stats": {
510 "action_arguments": {},
511 "action_type": "HideDatasetAction",
512 "output_name": "trimming_stats"
513 },
514 "RenameDatasetActionk2n_file": {
515 "action_arguments": {
516 "newname": "k2n file (Treated)"
517 },
518 "action_type": "RenameDatasetAction",
519 "output_name": "k2n_file"
520 },
521 "RenameDatasetActionunique_barcodes": {
522 "action_arguments": {
523 "newname": "Unique Barcodes (Treated)"
524 },
525 "action_type": "RenameDatasetAction",
526 "output_name": "unique_barcodes"
527 }
528 },
529 "tool_errors": null,
530 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0",
531 "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}",
532 "tool_version": "1.0.0",
533 "type": "tool",
534 "user_outputs": []
535 },
536 "10": {
537 "annotation": "",
538 "id": 10,
539 "input_connections": {
540 "input1": {
541 "id": 8,
542 "output_name": "output"
543 },
544 "input2": {
545 "id": 6,
546 "output_name": "barcodes"
547 }
548 },
549 "inputs": [],
550 "name": "Summarize Unique Barcodes",
551 "outputs": [
552 {
553 "name": "trimming_stats",
554 "type": "tabular"
555 },
556 {
557 "name": "unique_barcodes",
558 "type": "tabular"
559 },
560 {
561 "name": "read_counts",
562 "type": "tabular"
563 },
564 {
565 "name": "k2n_file",
566 "type": "txt"
567 }
568 ],
569 "position": {
570 "left": 1611.6389441490173,
571 "top": 805.0590672492981
572 },
573 "post_job_actions": {
574 "HideDatasetActionread_counts": {
575 "action_arguments": {},
576 "action_type": "HideDatasetAction",
577 "output_name": "read_counts"
578 },
579 "HideDatasetActiontrimming_stats": {
580 "action_arguments": {},
581 "action_type": "HideDatasetAction",
582 "output_name": "trimming_stats"
583 },
584 "RenameDatasetActionk2n_file": {
585 "action_arguments": {
586 "newname": "k2n file (Control)"
587 },
588 "action_type": "RenameDatasetAction",
589 "output_name": "k2n_file"
590 },
591 "RenameDatasetActionunique_barcodes": {
592 "action_arguments": {
593 "newname": "Unique Barcodes (Control)"
594 },
595 "action_type": "RenameDatasetAction",
596 "output_name": "unique_barcodes"
597 }
598 },
599 "tool_errors": null,
600 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0",
601 "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}",
602 "tool_version": "1.0.0",
603 "type": "tool",
604 "user_outputs": []
605 },
606 "11": {
607 "annotation": "",
608 "id": 11,
609 "input_connections": {
610 "control": {
611 "id": 10,
612 "output_name": "unique_barcodes"
613 },
614 "euc_method|k2n_control": {
615 "id": 10,
616 "output_name": "k2n_file"
617 },
618 "euc_method|k2n_treated": {
619 "id": 9,
620 "output_name": "k2n_file"
621 },
622 "fasta": {
623 "id": 2,
624 "output_name": "output"
625 },
626 "treated": {
627 "id": 9,
628 "output_name": "unique_barcodes"
629 }
630 },
631 "inputs": [],
632 "name": "Normalize",
633 "outputs": [
634 {
635 "name": "normalized",
636 "type": "tabular"
637 },
638 {
639 "name": "bedgraph_dtcr",
640 "type": "bedgraph"
641 },
642 {
643 "name": "bedgraph_slograt",
644 "type": "bedgraph"
645 },
646 {
647 "name": "bedgraph_swinsor",
648 "type": "bedgraph"
649 }
650 ],
651 "position": {
652 "left": 1994.1910681724548,
653 "top": 533.5139012336731
654 },
655 "post_job_actions": {
656 "HideDatasetActionbedgraph_dtcr": {
657 "action_arguments": {},
658 "action_type": "HideDatasetAction",
659 "output_name": "bedgraph_dtcr"
660 },
661 "HideDatasetActionbedgraph_slograt": {
662 "action_arguments": {},
663 "action_type": "HideDatasetAction",
664 "output_name": "bedgraph_slograt"
665 },
666 "HideDatasetActionbedgraph_swinsor": {
667 "action_arguments": {},
668 "action_type": "HideDatasetAction",
669 "output_name": "bedgraph_swinsor"
670 }
671 },
672 "tool_errors": null,
673 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_normalize/1.0.0",
674 "tool_state": "{\"control\": \"null\", \"cutoff\": \"\\\"101\\\"\", \"swinsor\": \"{\\\"wsize\\\": \\\"71\\\", \\\"only_top\\\": \\\"False\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"winsor_level\\\": \\\"0.9\\\"}\", \"nt_offset\": \"\\\"1\\\"\", \"__page__\": 0, \"euc_method\": \"{\\\"k2n_treated\\\": null, \\\"k2n_control\\\": null, \\\"euc\\\": \\\"HRF-Seq\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null, \"compdata\": \"\\\"True\\\"\", \"dtcr\": \"{\\\"wsize\\\": \\\"3\\\", \\\"zero\\\": \\\"True\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"fasta\": \"null\", \"slograt\": \"{\\\"wsize\\\": \\\"5\\\", \\\"depth_cor\\\": \\\"RNA\\\", \\\"pseudocount\\\": \\\"5\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"treated\": \"null\", \"bedgraph\": \"{\\\"check\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\"}",
675 "tool_version": "1.0.0",
676 "type": "tool",
677 "user_outputs": []
678 }
679 },
680 "uuid": "977f740a-c1f5-47c9-85f8-753fba9f2df6"
681 }