Mercurial > repos > nikos > rna_probing_workflows
changeset 0:608dbf6d6196 draft
Uploaded
| author | nikos |
|---|---|
| date | Wed, 05 Nov 2014 10:57:10 -0500 |
| parents | |
| children | 1289f656c8de |
| files | HRF-Seq_workflow_paired-end.ga HRF-Seq_workflow_single-end.ga README.srt repository_dependencies.xml |
| diffstat | 4 files changed, 1628 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/HRF-Seq_workflow_paired-end.ga Wed Nov 05 10:57:10 2014 -0500 @@ -0,0 +1,903 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "RNA Probing analysis workflow for paired-end data. RNA Probing suite must be installed in the Galaxy instance you are using in order to run this workflow (https://testtoolshed.g2.bx.psu.edu/view/nikos/rna_probing).", + "format-version": "0.1", + "name": "HRF-Seq data analysis (Paired-end)", + "steps": { + "0": { + "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "name": "Read1 (Treated)" + } + ], + "name": "Input dataset", + "outputs": [], + "position": { + "left": 278.0104374885559, + "top": 252.38542222976685 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"Read1 (Treated)\"}", + "tool_version": null, + "type": "data_input", + "user_outputs": [] + }, + "1": { + "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "name": "Read2 (Treated)" + } + ], + "name": "Input dataset", + "outputs": [], + "position": { + "left": 284.93750047683716, + "top": 399.29516649246216 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"Read2 (Treated)\"}", + "tool_version": null, + "type": "data_input", + "user_outputs": [] + }, + "2": { + "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "name": "Read1 (Control)" + } + ], + "name": "Input dataset", + "outputs": [], + "position": { + "left": 302.57641649246216, + "top": 822.9409794807434 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"Read1 (Control)\"}", + "tool_version": null, + "type": "data_input", + "user_outputs": [] + }, + "3": { + "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "name": "Read2 (Control)" + } + ], + "name": "Input dataset", + "outputs": [], + "position": { + "left": 300.54516649246216, + "top": 980.8923954963684 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"Read2 (Control)\"}", + "tool_version": null, + "type": "data_input", + "user_outputs": [] + }, + "4": { + "annotation": "FASTA format", + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "FASTA format", + "name": "Reference sequence" + } + ], + "name": "Input dataset", + "outputs": [], + "position": { + "left": 863.9132237434387, + "top": 664.3125004768372 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"Reference sequence\"}", + "tool_version": null, + "type": "data_input", + "user_outputs": [] + }, + "5": { + "annotation": "", + "id": 5, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "name": "Cutadapt", + "outputs": [ + { + "name": "report", + "type": "txt" + }, + { + "name": "output", + "type": "input" + }, + { + "name": "rest_output", + "type": "input" + }, + { + "name": "wild_output", + "type": "txt" + }, + { + "name": "too_short_output", + "type": "input" + }, + { + "name": "untrimmed_output", + "type": "input" + } + ], + "position": { + "left": 574.1041874885559, + "top": 198.47916841506958 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "HideDatasetActionrest_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "rest_output" + }, + "HideDatasetActiontoo_short_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "too_short_output" + }, + "HideDatasetActionuntrimmed_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "untrimmed_output" + }, + "HideDatasetActionwild_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "wild_output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", + "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", + "tool_version": "1.1.a", + "type": "tool", + "user_outputs": [] + }, + "6": { + "annotation": "", + "id": 6, + "input_connections": { + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "name": "Cutadapt", + "outputs": [ + { + "name": "report", + "type": "txt" + }, + { + "name": "output", + "type": "input" + }, + { + "name": "rest_output", + "type": "input" + }, + { + "name": "wild_output", + "type": "txt" + }, + { + "name": "too_short_output", + "type": "input" + }, + { + "name": "untrimmed_output", + "type": "input" + } + ], + "position": { + "left": 569.1041874885559, + "top": 507.4722294807434 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "HideDatasetActionrest_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "rest_output" + }, + "HideDatasetActiontoo_short_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "too_short_output" + }, + "HideDatasetActionuntrimmed_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "untrimmed_output" + }, + "HideDatasetActionwild_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "wild_output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", + "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", + "tool_version": "1.1.a", + "type": "tool", + "user_outputs": [] + }, + "7": { + "annotation": "", + "id": 7, + "input_connections": { + "input": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "name": "Cutadapt", + "outputs": [ + { + "name": "report", + "type": "txt" + }, + { + "name": "output", + "type": "input" + }, + { + "name": "rest_output", + "type": "input" + }, + { + "name": "wild_output", + "type": "txt" + }, + { + "name": "too_short_output", + "type": "input" + }, + { + "name": "untrimmed_output", + "type": "input" + } + ], + "position": { + "left": 577.9236149787903, + "top": 798.3923954963684 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "HideDatasetActionrest_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "rest_output" + }, + "HideDatasetActiontoo_short_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "too_short_output" + }, + "HideDatasetActionuntrimmed_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "untrimmed_output" + }, + "HideDatasetActionwild_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "wild_output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", + "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", + "tool_version": "1.1.a", + "type": "tool", + "user_outputs": [] + }, + "8": { + "annotation": "", + "id": 8, + "input_connections": { + "input": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "name": "Cutadapt", + "outputs": [ + { + "name": "report", + "type": "txt" + }, + { + "name": "output", + "type": "input" + }, + { + "name": "rest_output", + "type": "input" + }, + { + "name": "wild_output", + "type": "txt" + }, + { + "name": "too_short_output", + "type": "input" + }, + { + "name": "untrimmed_output", + "type": "input" + } + ], + "position": { + "left": 581.934051990509, + "top": 1090.3889164924622 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "HideDatasetActionrest_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "rest_output" + }, + "HideDatasetActiontoo_short_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "too_short_output" + }, + "HideDatasetActionuntrimmed_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "untrimmed_output" + }, + "HideDatasetActionwild_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "wild_output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", + "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", + "tool_version": "1.1.a", + "type": "tool", + "user_outputs": [] + }, + "9": { + "annotation": "", + "id": 9, + "input_connections": { + "library|input1": { + "id": 5, + "output_name": "output" + }, + "library|input2": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Preprocessing", + "name": "library" + } + ], + "name": "Preprocessing", + "outputs": [ + { + "name": "output1", + "type": "fastqsanger" + }, + { + "name": "output2", + "type": "fastqsanger" + }, + { + "name": "barcodes", + "type": "tabular" + } + ], + "position": { + "left": 875.0243344306946, + "top": 252.333336353302 + }, + "post_job_actions": { + "HideDatasetActionbarcodes": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "barcodes" + }, + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + }, + "HideDatasetActionoutput2": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output2" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0", + "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"input2\\\": null, \\\"input1\\\": null, \\\"type\\\": \\\"paired\\\", \\\"__current_case__\\\": 1, \\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + }, + "10": { + "annotation": "", + "id": 10, + "input_connections": { + "library|input1": { + "id": 7, + "output_name": "output" + }, + "library|input2": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Preprocessing", + "name": "library" + } + ], + "name": "Preprocessing", + "outputs": [ + { + "name": "output1", + "type": "fastqsanger" + }, + { + "name": "output2", + "type": "fastqsanger" + }, + { + "name": "barcodes", + "type": "tabular" + } + ], + "position": { + "left": 897.159752368927, + "top": 945.5972905158997 + }, + "post_job_actions": { + "HideDatasetActionbarcodes": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "barcodes" + }, + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + }, + "HideDatasetActionoutput2": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output2" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0", + "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"input2\\\": null, \\\"input1\\\": null, \\\"type\\\": \\\"paired\\\", \\\"__current_case__\\\": 1, \\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + }, + "11": { + "annotation": "", + "id": 11, + "input_connections": { + "library|input_1": { + "id": 9, + "output_name": "output1" + }, + "library|input_2": { + "id": 9, + "output_name": "output2" + }, + "reference_genome|own_file": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "name": "Bowtie2", + "outputs": [ + { + "name": "output_unaligned_reads_l", + "type": "fastqsanger" + }, + { + "name": "output_unaligned_reads_r", + "type": "fastqsanger" + }, + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 1197.2986454963684, + "top": 263.63542222976685 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionoutput_unaligned_reads_l": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_unaligned_reads_l" + }, + "HideDatasetActionoutput_unaligned_reads_r": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_unaligned_reads_r" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2", + "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"min_insert\\\": \\\"0\\\", \\\"type\\\": \\\"paired\\\", \\\"input_2\\\": null, \\\"__current_case__\\\": 1, \\\"input_1\\\": null, \\\"max_insert\\\": \\\"700\\\"}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}", + "tool_version": "0.2", + "type": "tool", + "user_outputs": [] + }, + "12": { + "annotation": "", + "id": 12, + "input_connections": { + "library|input_1": { + "id": 10, + "output_name": "output1" + }, + "library|input_2": { + "id": 10, + "output_name": "output2" + }, + "reference_genome|own_file": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "name": "Bowtie2", + "outputs": [ + { + "name": "output_unaligned_reads_l", + "type": "fastqsanger" + }, + { + "name": "output_unaligned_reads_r", + "type": "fastqsanger" + }, + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 1201.2222599983215, + "top": 905.6666874885559 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionoutput_unaligned_reads_l": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_unaligned_reads_l" + }, + "HideDatasetActionoutput_unaligned_reads_r": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_unaligned_reads_r" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2", + "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"min_insert\\\": \\\"0\\\", \\\"type\\\": \\\"paired\\\", \\\"input_2\\\": null, \\\"__current_case__\\\": 1, \\\"input_1\\\": null, \\\"max_insert\\\": \\\"700\\\"}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}", + "tool_version": "0.2", + "type": "tool", + "user_outputs": [] + }, + "13": { + "annotation": "", + "id": 13, + "input_connections": { + "input1": { + "id": 11, + "output_name": "output" + }, + "input2": { + "id": 9, + "output_name": "barcodes" + } + }, + "inputs": [], + "name": "Summarize Unique Barcodes", + "outputs": [ + { + "name": "trimming_stats", + "type": "tabular" + }, + { + "name": "unique_barcodes", + "type": "tabular" + }, + { + "name": "read_counts", + "type": "tabular" + }, + { + "name": "k2n_file", + "type": "txt" + } + ], + "position": { + "left": 1550.9965825080872, + "top": 396.30905199050903 + }, + "post_job_actions": { + "HideDatasetActionread_counts": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "read_counts" + }, + "HideDatasetActiontrimming_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "trimming_stats" + }, + "RenameDatasetActionk2n_file": { + "action_arguments": { + "newname": "k2n file (Treated)" + }, + "action_type": "RenameDatasetAction", + "output_name": "k2n_file" + }, + "RenameDatasetActionunique_barcodes": { + "action_arguments": { + "newname": "Unique Barcodes (Treated)" + }, + "action_type": "RenameDatasetAction", + "output_name": "unique_barcodes" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0", + "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + }, + "14": { + "annotation": "", + "id": 14, + "input_connections": { + "input1": { + "id": 12, + "output_name": "output" + }, + "input2": { + "id": 10, + "output_name": "barcodes" + } + }, + "inputs": [], + "name": "Summarize Unique Barcodes", + "outputs": [ + { + "name": "trimming_stats", + "type": "tabular" + }, + { + "name": "unique_barcodes", + "type": "tabular" + }, + { + "name": "read_counts", + "type": "tabular" + }, + { + "name": "k2n_file", + "type": "txt" + } + ], + "position": { + "left": 1569.3646245002747, + "top": 835.7882084846497 + }, + "post_job_actions": { + "HideDatasetActionread_counts": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "read_counts" + }, + "HideDatasetActiontrimming_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "trimming_stats" + }, + "RenameDatasetActionk2n_file": { + "action_arguments": { + "newname": "k2n file (Control)" + }, + "action_type": "RenameDatasetAction", + "output_name": "k2n_file" + }, + "RenameDatasetActionunique_barcodes": { + "action_arguments": { + "newname": "Unique Barcodes (Control)" + }, + "action_type": "RenameDatasetAction", + "output_name": "unique_barcodes" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0", + "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + }, + "15": { + "annotation": "", + "id": 15, + "input_connections": { + "control": { + "id": 14, + "output_name": "unique_barcodes" + }, + "euc_method|k2n_control": { + "id": 14, + "output_name": "k2n_file" + }, + "euc_method|k2n_treated": { + "id": 13, + "output_name": "k2n_file" + }, + "fasta": { + "id": 4, + "output_name": "output" + }, + "treated": { + "id": 13, + "output_name": "unique_barcodes" + } + }, + "inputs": [], + "name": "Normalize", + "outputs": [ + { + "name": "normalized", + "type": "tabular" + }, + { + "name": "bedgraph_dtcr", + "type": "bedgraph" + }, + { + "name": "bedgraph_slograt", + "type": "bedgraph" + }, + { + "name": "bedgraph_swinsor", + "type": "bedgraph" + } + ], + "position": { + "left": 1942.9097900390625, + "top": 576.2430725097656 + }, + "post_job_actions": { + "HideDatasetActionbedgraph_dtcr": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bedgraph_dtcr" + }, + "HideDatasetActionbedgraph_slograt": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bedgraph_slograt" + }, + "HideDatasetActionbedgraph_swinsor": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bedgraph_swinsor" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_normalize/1.0.0", + "tool_state": "{\"control\": \"null\", \"cutoff\": \"\\\"101\\\"\", \"swinsor\": \"{\\\"wsize\\\": \\\"71\\\", \\\"only_top\\\": \\\"False\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"winsor_level\\\": \\\"0.9\\\"}\", \"nt_offset\": \"\\\"1\\\"\", \"__page__\": 0, \"euc_method\": \"{\\\"k2n_treated\\\": null, \\\"k2n_control\\\": null, \\\"euc\\\": \\\"HRF-Seq\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null, \"compdata\": \"\\\"True\\\"\", \"dtcr\": \"{\\\"wsize\\\": \\\"3\\\", \\\"zero\\\": \\\"True\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"fasta\": \"null\", \"slograt\": \"{\\\"wsize\\\": \\\"5\\\", \\\"depth_cor\\\": \\\"RNA\\\", \\\"pseudocount\\\": \\\"5\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"treated\": \"null\", \"bedgraph\": \"{\\\"check\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + } + }, + "uuid": "07942ce7-0206-47c6-a1e0-5848a1b5d96a" +} \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/HRF-Seq_workflow_single-end.ga Wed Nov 05 10:57:10 2014 -0500 @@ -0,0 +1,681 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "RNA Probing analysis workflow for single\n-end data. RNA Probing suite must be installed in the Galaxy instance you are using in order to run this workflow (https://testtoolshed.g2.bx.psu.edu/view/nikos/rna_probing).", + "format-version": "0.1", + "name": "HRF-Seq data analysis (Single-end)", + "steps": { + "0": { + "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "name": "Reads (Treated)" + } + ], + "name": "Input dataset", + "outputs": [], + "position": { + "left": 277.3333411216736, + "top": 318.6875157356262 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"Reads (Treated)\"}", + "tool_version": null, + "type": "data_input", + "user_outputs": [] + }, + "1": { + "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", + "name": "Reads (Control)" + } + ], + "name": "Input dataset", + "outputs": [], + "position": { + "left": 268.87847661972046, + "top": 785.2326512336731 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"Reads (Control)\"}", + "tool_version": null, + "type": "data_input", + "user_outputs": [] + }, + "2": { + "annotation": "FASTA format", + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "FASTA format", + "name": "Reference sequence" + } + ], + "name": "Input dataset", + "outputs": [], + "position": { + "left": 874.2257361412048, + "top": 603.6007542610168 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"Reference sequence\"}", + "tool_version": null, + "type": "data_input", + "user_outputs": [] + }, + "3": { + "annotation": "", + "id": 3, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "name": "Cutadapt", + "outputs": [ + { + "name": "report", + "type": "txt" + }, + { + "name": "output", + "type": "input" + }, + { + "name": "rest_output", + "type": "input" + }, + { + "name": "wild_output", + "type": "txt" + }, + { + "name": "too_short_output", + "type": "input" + }, + { + "name": "untrimmed_output", + "type": "input" + } + ], + "position": { + "left": 573.4270911216736, + "top": 264.7812657356262 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "HideDatasetActionrest_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "rest_output" + }, + "HideDatasetActiontoo_short_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "too_short_output" + }, + "HideDatasetActionuntrimmed_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "untrimmed_output" + }, + "HideDatasetActionwild_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "wild_output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", + "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", + "tool_version": "1.1.a", + "type": "tool", + "user_outputs": [] + }, + "4": { + "annotation": "", + "id": 4, + "input_connections": { + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "name": "Cutadapt", + "outputs": [ + { + "name": "report", + "type": "txt" + }, + { + "name": "output", + "type": "input" + }, + { + "name": "rest_output", + "type": "input" + }, + { + "name": "wild_output", + "type": "txt" + }, + { + "name": "too_short_output", + "type": "input" + }, + { + "name": "untrimmed_output", + "type": "input" + } + ], + "position": { + "left": 569.2257361412048, + "top": 777.6805882453918 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "HideDatasetActionrest_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "rest_output" + }, + "HideDatasetActiontoo_short_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "too_short_output" + }, + "HideDatasetActionuntrimmed_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "untrimmed_output" + }, + "HideDatasetActionwild_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "wild_output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", + "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", + "tool_version": "1.1.a", + "type": "tool", + "user_outputs": [] + }, + "5": { + "annotation": "", + "id": 5, + "input_connections": { + "library|input1": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Preprocessing", + "name": "library" + } + ], + "name": "Preprocessing", + "outputs": [ + { + "name": "output1", + "type": "fastqsanger" + }, + { + "name": "output2", + "type": "fastqsanger" + }, + { + "name": "barcodes", + "type": "tabular" + } + ], + "position": { + "left": 874.3472571372986, + "top": 318.63542222976685 + }, + "post_job_actions": { + "HideDatasetActionbarcodes": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "barcodes" + }, + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + }, + "HideDatasetActionoutput2": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output2" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0", + "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"input1\\\": null, \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0}\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + }, + "6": { + "annotation": "", + "id": 6, + "input_connections": { + "library|input1": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Preprocessing", + "name": "library" + } + ], + "name": "Preprocessing", + "outputs": [ + { + "name": "output1", + "type": "fastqsanger" + }, + { + "name": "output2", + "type": "fastqsanger" + }, + { + "name": "barcodes", + "type": "tabular" + } + ], + "position": { + "left": 875.4444856643677, + "top": 833.8298797607422 + }, + "post_job_actions": { + "HideDatasetActionbarcodes": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "barcodes" + }, + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + }, + "HideDatasetActionoutput2": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output2" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0", + "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"input1\\\": null, \\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0}\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + }, + "7": { + "annotation": "", + "id": 7, + "input_connections": { + "library|input_1": { + "id": 5, + "output_name": "output1" + }, + "reference_genome|own_file": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "name": "Bowtie2", + "outputs": [ + { + "name": "output_unaligned_reads_l", + "type": "fastqsanger" + }, + { + "name": "output_unaligned_reads_r", + "type": "fastqsanger" + }, + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 1196.6216101646423, + "top": 329.9375157356262 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionoutput_unaligned_reads_l": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_unaligned_reads_l" + }, + "HideDatasetActionoutput_unaligned_reads_r": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_unaligned_reads_r" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2", + "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}", + "tool_version": "0.2", + "type": "tool", + "user_outputs": [] + }, + "8": { + "annotation": "", + "id": 8, + "input_connections": { + "library|input_1": { + "id": 6, + "output_name": "output1" + }, + "reference_genome|own_file": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "name": "Bowtie2", + "outputs": [ + { + "name": "output_unaligned_reads_l", + "type": "fastqsanger" + }, + { + "name": "output_unaligned_reads_r", + "type": "fastqsanger" + }, + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 1201.5000281333923, + "top": 798.9305882453918 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionoutput_unaligned_reads_l": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_unaligned_reads_l" + }, + "HideDatasetActionoutput_unaligned_reads_r": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_unaligned_reads_r" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2", + "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"type\\\": \\\"single\\\", \\\"__current_case__\\\": 0, \\\"input_1\\\": null}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}", + "tool_version": "0.2", + "type": "tool", + "user_outputs": [] + }, + "9": { + "annotation": "", + "id": 9, + "input_connections": { + "input1": { + "id": 7, + "output_name": "output" + }, + "input2": { + "id": 5, + "output_name": "barcodes" + } + }, + "inputs": [], + "name": "Summarize Unique Barcodes", + "outputs": [ + { + "name": "trimming_stats", + "type": "tabular" + }, + { + "name": "unique_barcodes", + "type": "tabular" + }, + { + "name": "read_counts", + "type": "tabular" + }, + { + "name": "k2n_file", + "type": "txt" + } + ], + "position": { + "left": 1612.2639441490173, + "top": 342.5764012336731 + }, + "post_job_actions": { + "HideDatasetActionread_counts": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "read_counts" + }, + "HideDatasetActiontrimming_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "trimming_stats" + }, + "RenameDatasetActionk2n_file": { + "action_arguments": { + "newname": "k2n file (Treated)" + }, + "action_type": "RenameDatasetAction", + "output_name": "k2n_file" + }, + "RenameDatasetActionunique_barcodes": { + "action_arguments": { + "newname": "Unique Barcodes (Treated)" + }, + "action_type": "RenameDatasetAction", + "output_name": "unique_barcodes" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0", + "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + }, + "10": { + "annotation": "", + "id": 10, + "input_connections": { + "input1": { + "id": 8, + "output_name": "output" + }, + "input2": { + "id": 6, + "output_name": "barcodes" + } + }, + "inputs": [], + "name": "Summarize Unique Barcodes", + "outputs": [ + { + "name": "trimming_stats", + "type": "tabular" + }, + { + "name": "unique_barcodes", + "type": "tabular" + }, + { + "name": "read_counts", + "type": "tabular" + }, + { + "name": "k2n_file", + "type": "txt" + } + ], + "position": { + "left": 1611.6389441490173, + "top": 805.0590672492981 + }, + "post_job_actions": { + "HideDatasetActionread_counts": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "read_counts" + }, + "HideDatasetActiontrimming_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "trimming_stats" + }, + "RenameDatasetActionk2n_file": { + "action_arguments": { + "newname": "k2n file (Control)" + }, + "action_type": "RenameDatasetAction", + "output_name": "k2n_file" + }, + "RenameDatasetActionunique_barcodes": { + "action_arguments": { + "newname": "Unique Barcodes (Control)" + }, + "action_type": "RenameDatasetAction", + "output_name": "unique_barcodes" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0", + "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + }, + "11": { + "annotation": "", + "id": 11, + "input_connections": { + "control": { + "id": 10, + "output_name": "unique_barcodes" + }, + "euc_method|k2n_control": { + "id": 10, + "output_name": "k2n_file" + }, + "euc_method|k2n_treated": { + "id": 9, + "output_name": "k2n_file" + }, + "fasta": { + "id": 2, + "output_name": "output" + }, + "treated": { + "id": 9, + "output_name": "unique_barcodes" + } + }, + "inputs": [], + "name": "Normalize", + "outputs": [ + { + "name": "normalized", + "type": "tabular" + }, + { + "name": "bedgraph_dtcr", + "type": "bedgraph" + }, + { + "name": "bedgraph_slograt", + "type": "bedgraph" + }, + { + "name": "bedgraph_swinsor", + "type": "bedgraph" + } + ], + "position": { + "left": 1994.1910681724548, + "top": 533.5139012336731 + }, + "post_job_actions": { + "HideDatasetActionbedgraph_dtcr": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bedgraph_dtcr" + }, + "HideDatasetActionbedgraph_slograt": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bedgraph_slograt" + }, + "HideDatasetActionbedgraph_swinsor": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bedgraph_swinsor" + } + }, + "tool_errors": null, + "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_normalize/1.0.0", + "tool_state": "{\"control\": \"null\", \"cutoff\": \"\\\"101\\\"\", \"swinsor\": \"{\\\"wsize\\\": \\\"71\\\", \\\"only_top\\\": \\\"False\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"winsor_level\\\": \\\"0.9\\\"}\", \"nt_offset\": \"\\\"1\\\"\", \"__page__\": 0, \"euc_method\": \"{\\\"k2n_treated\\\": null, \\\"k2n_control\\\": null, \\\"euc\\\": \\\"HRF-Seq\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null, \"compdata\": \"\\\"True\\\"\", \"dtcr\": \"{\\\"wsize\\\": \\\"3\\\", \\\"zero\\\": \\\"True\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"fasta\": \"null\", \"slograt\": \"{\\\"wsize\\\": \\\"5\\\", \\\"depth_cor\\\": \\\"RNA\\\", \\\"pseudocount\\\": \\\"5\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"treated\": \"null\", \"bedgraph\": \"{\\\"check\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\"}", + "tool_version": "1.0.0", + "type": "tool", + "user_outputs": [] + } + }, + "uuid": "977f740a-c1f5-47c9-85f8-753fba9f2df6" +} \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/README.srt Wed Nov 05 10:57:10 2014 -0500 @@ -0,0 +1,39 @@ +This package contains Galaxy workflows that perform RNA probing data analysis using the HRF-Seq method (Kielpinski and Vinther, 2014). + +See http://www.galaxyproject.org for information about the Galaxy Project. + + +Availability +============ + +These workflows are available to download and/or install from the Test Galaxy Tool Shed: + +http://toolshed.g2.bx.psu.edu/view/nikos/rna_probing_workflows + + +Reference Data +============== + +The workflows have been tested using RNase_P data (Treated and Control samples) from: + +* http://people.binf.ku.dk/jvinther/data/HRF-Seq/ + +Dependencies +============ + +These dependencies should be resolved automatically via the Galaxy Tool Shed: + +* http://testtoolshed.g2.bx.psu.edu/view/nikos/rna_probing +* http://testtoolshed.g2.bx.psu.edu/view/devteam/bowtie2 + + +History +======= + +======= ====================================================================== +Version Changes +------- ---------------------------------------------------------------------- +v0.0.1 - Initial release to Test Tool Shed (November, 2014) +======= ====================================================================== + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repository_dependencies.xml Wed Nov 05 10:57:10 2014 -0500 @@ -0,0 +1,5 @@ +<?xml version="1.0"?> +<repositories description="This requires the Bowtie2 wrapper, as well as the RNA Probing suite."> + <repository name="bowtie2" changeset_revision="a03a7ee6cdff" owner="devteam" toolshed="http://testtoolshed.g2.bx.psu.edu"/> + <repository name="rna_probing" changeset_revision="f6265e05c55c" owner="nikos" toolshed="http://testtoolshed.g2.bx.psu.edu"/> +</repositories>