bowtie2: bowtie2_wrapper.xml annotate

annotate bowtie2_wrapper.xml @ 14:85f0e9edb32d draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f

author	devteam
date	Wed, 12 Apr 2017 17:09:24 -0400
parents	55dcd6aad1ab
children	7e0b333f39e1

rev	line source
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	1 <tool id="bowtie2" name="Bowtie2" version="2.3.0.1" profile="17.01">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	2 <description>- map reads against reference genome</description>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	3 <macros>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	4 <import>read_group_macros.xml</import>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	5 </macros>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	6 <requirements>
12 ed052d843da7 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a326a3469adfd33babe792cf58544438582a56a1 devteam parents: 11 diff changeset	7 <requirement type="package" version="2.3.0">bowtie2</requirement>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	8 <requirement type="package" version="1.3.1">samtools</requirement>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	9 </requirements>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	10 <version_command>bowtie2 --version</version_command>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	11 <command detect_errors="exit_code"><![CDATA[
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	12 ## prepare bowtie2 index
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	13 #set index_path = ''
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	14 #if str($reference_genome.source) == "history":
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	15 bowtie2-build --threads \${GALAXY_SLOTS:-4} '$reference_genome.own_file' genome &&
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	16 ln -s -f '$reference_genome.own_file' genome.fa &&
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	17 #set index_path = 'genome'
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	18 #else:
13 55dcd6aad1ab planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit b22fc2e7243522b264f3d5d00706df8d18366405 devteam parents: 12 diff changeset	19 #set index_path = $reference_genome.index.fields.path
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	20 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	21
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	22 ## Link in the input files, so bowtie2 can tell their type
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	23
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	24 #set compressed="False"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	25 #if str($library.type) == 'paired':
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	26 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	27 #set read1 = "input_f.fastq.gz"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	28 #set compressed = "GZ"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	29 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	30 #set read1 = "input_f.fastq.bz2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	31 #set compressed = "BZ2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	32 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	33 #set read1 = "input_f.fastq"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	34 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	35 ln -f -s '${library.input_1}' ${read1} &&
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	36
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	37 #if $library.input_2.is_of_type("fastq.gz", "fastqsanger.gz"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	38 #set read2 = "input_r.fastq.gz"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	39 #set compressed = "GZ"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	40 #else if $library.input_2.is_of_type("fastq.bz2", "fastqsanger.bz2"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	41 #set read2 = "input_r.fastq.bz2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	42 #set compressed = "BZ2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	43 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	44 #set read2 = "input_r.fastq"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	45 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	46 ln -f -s '${library.input_2}' ${read2} &&
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	47 #else if str($library.type) == 'paired_collection':
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	48 #if $library.input_1.forward.is_of_type("fastq.gz", "fastqsanger.gz"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	49 #set read1 = "input_f.fastq.gz"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	50 #set compressed = "GZ"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	51 #else if $library.input_1.forward.is_of_type("fastq.bz2", "fastqsanger.bz2"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	52 #set read1 = "input_f.fastq.bz2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	53 #set compressed = "BZ2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	54 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	55 #set read1 = "input_f.fastq"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	56 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	57 ln -s '${library.input_1.forward}' ${read1} &&
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	58
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	59 #if $library.input_1.reverse.is_of_type("fastq.gz", "fastqsanger.gz"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	60 #set read2 = "input_r.fastq.gz"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	61 #set compressed = "GZ"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	62 #else if $library.input_1.reverse.is_of_type("fastq.bz2", "fastqsanger.bz2"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	63 #set read2 = "input_r.fastq.bz2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	64 #set compressed = "BZ2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	65 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	66 #set read2 = "input_r.fastq"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	67 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	68 ln -s '${library.input_1.reverse}' ${read2} &&
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	69 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	70 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	71 #set read1 = "input_f.fastq.gz"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	72 #set compressed = "GZ"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	73 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	74 #set read1 = "input_f.fastq.bz2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	75 #set compressed = "BZ2"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	76 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	77 #set read1 = "input_f.fastq"
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	78 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	79 ln -s '${library.input_1}' ${read1} &&
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	80 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	81
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	82 ## execute bowtie2
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	83
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	84 bowtie2
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	85
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	86 ## number of threads
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	87 -p \${GALAXY_SLOTS:-4}
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	88
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	89 ## index file path
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	90 -x '$index_path'
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	91
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	92 ## Fastq inputs
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	93 #if str( $library.type ) == "single":
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	94 -U '${read1}'
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	95 #if str( $library.unaligned_file ) == "true":
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	96 #if $compressed == "GZ":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	97 --un-gz '${output_unaligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	98 #else if $compressed == "BZ2":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	99 --un-bz2 '${output_unaligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	100 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	101 --un '${output_unaligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	102 #end if
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	103 #end if
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	104 #if str( $library.aligned_file ) == "true":
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	105 #if $compressed == "GZ":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	106 --al-gz '${output_aligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	107 #else if $compressed == "BZ2":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	108 --al-bz2 '${output_aligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	109 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	110 --al '${output_aligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	111 #end if
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	112 #end if
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	113 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	114 -1 '${read1}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	115 -2 '${read2}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	116 #if str( $library.unaligned_file ) == "true":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	117 #if $compressed == "GZ":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	118 --un-conc-gz '${output_unaligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	119 #else if $compressed == "BZ2":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	120 --un-conc-bz2 '${output_unaligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	121 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	122 --un-conc '${output_unaligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	123 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	124 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	125 #if str( $library.aligned_file ) == "true":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	126 #if $compressed == "GZ":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	127 --al-conc-gz '${output_aligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	128 #else if $compressed == "BZ2":
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	129 --al-conc-bz2 '${output_aligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	130 #else:
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	131 --al-conc '${output_aligned_reads_l}'
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	132 #end if
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	133 #end if
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	134 #if str( $library.paired_options.paired_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	135 -I "${library.paired_options.I}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	136 -X "${library.paired_options.X}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	137 ${library.paired_options.fr_rf_ff}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	138 ${library.paired_options.no_mixed}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	139 ${library.paired_options.no_discordant}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	140 ${library.paired_options.dovetail}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	141 ${library.paired_options.no_contain}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	142 ${library.paired_options.no_overlap}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	143 #end if
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	144 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	145
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	146 ## Read group information.
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	147 @define_read_group_helpers@
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	148 #if str( $library.type ) == "single":
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	149 #set $rg_auto_name = $read_group_name_default($library.input_1)
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	150 #elif str( $library.type ) == "paired":
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	151 #set $rg_auto_name = $read_group_name_default($library.input_1, $library.input_2)
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	152 #else
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	153 #set $rg_auto_name = $read_group_name_default($library.input_1)
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	154 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	155 @set_use_rg_var@
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	156 @set_read_group_vars@
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	157 #if $use_rg
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	158 $format_read_group("", $rg_id, '"', arg='--rg-id ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	159 $format_read_group("SM:", $rg_sm, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	160 $format_read_group("PL:", $rg_pl, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	161 $format_read_group("LB:", $rg_lb, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	162 $format_read_group("CN:", $rg_cn, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	163 $format_read_group("DS:", $rg_ds, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	164 $format_read_group("DT:", $rg_dt, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	165 $format_read_group("FO:", $rg_fo, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	166 $format_read_group("KS:", $rg_ks, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	167 $format_read_group("PG:", $rg_pg, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	168 $format_read_group("PI:", $rg_pi, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	169 $format_read_group("PU:", $rg_pu, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	170 #end if
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	171
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	172 ## Analysis type
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	173 #if ( str( $analysis_type.analysis_type_selector ) == "simple" and str( $analysis_type.presets ) != "no_presets" ):
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	174 $analysis_type.presets
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	175 #elif str( $analysis_type.analysis_type_selector ) == "full":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	176 #if str( $analysis_type.input_options.input_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	177 --skip "${analysis_type.input_options.skip}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	178 --qupto "${analysis_type.input_options.qupto}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	179 --trim5 "${analysis_type.input_options.trim5}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	180 --trim3 "${analysis_type.input_options.trim3}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	181 ${analysis_type.input_options.qv_encoding}
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	182 ${analysis_type.input_options.solexa_quals}
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	183 ${analysis_type.input_options.int_quals}
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	184 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	185
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	186 #if str( $analysis_type.alignment_options.alignment_options_selector ) == "yes":
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	187 -N "${analysis_type.alignment_options.N}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	188 -L "${analysis_type.alignment_options.L}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	189 -i "${analysis_type.alignment_options.i}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	190 --n-ceil "${analysis_type.alignment_options.n_ceil}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	191 --dpad "${analysis_type.alignment_options.dpad}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	192 --gbar "${analysis_type.alignment_options.gbar}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	193 ${analysis_type.alignment_options.ignore_quals}
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	194 ${analysis_type.alignment_options.nofw}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	195 ${analysis_type.alignment_options.norc}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	196 ${analysis_type.alignment_options.no_1mm_upfront}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	197 #if str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "end-to-end":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	198 --end-to-end
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	199 --score-min "${analysis_type.alignment_options.align_mode.score_min_ete}"
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	200 #elif str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	201 --local
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	202 --score-min "${analysis_type.alignment_options.align_mode.score_min_loc}"
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	203 #end if
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	204 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	205
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	206 #if str( $analysis_type.scoring_options.scoring_options_selector ) == "yes":
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	207 #if ( str( $analysis_type.alignment_options.alignment_options_selector ) == "yes" and str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local" ):
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	208 --ma "${analysis_type.scoring_options.ma}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	209 #end if
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	210 --mp "${analysis_type.scoring_options.mp}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	211 --np "${analysis_type.scoring_options.np}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	212 --rdg "${analysis_type.scoring_options.rdg_read_open},${analysis_type.scoring_options.rdg_read_extend}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	213 --rfg "${analysis_type.scoring_options.rfg_ref_open},${analysis_type.scoring_options.rfg_ref_extend}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	214 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	215
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	216 #if str( $analysis_type.reporting_options.reporting_options_selector ) == "k":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	217 -k "${analysis_type.reporting_options.k}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	218 #elif str( $analysis_type.reporting_options.reporting_options_selector ) == "a":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	219 -a
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	220 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	221
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	222 #if str( $analysis_type.effort_options.effort_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	223 -D "${analysis_type.effort_options.D}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	224 -R "${analysis_type.effort_options.R}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	225 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	226
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	227 #if str( $analysis_type.sam_options.sam_options_selector ) == "yes":
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	228 ${analysis_type.sam_options.no_unal}
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	229 ${analysis_type.sam_options.omit_sec_seq}
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	230 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	231
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	232 #if str( $analysis_type.other_options.other_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	233 ${analysis_type.other_options.reorder}
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	234 ${analysis_type.other_options.non_deterministic}
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	235 --seed "${analysis_type.other_options.seed}"
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	236 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	237
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	238 #elif str( $analysis_type.analysis_type_selector ) == "cline":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	239 ${analysis_type.cline}
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	240 #end if
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	241
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	242 ## mapping stats (i.e. stderr from bowtie2)
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	243 #if $save_mapping_stats
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	244 2> '$mapping_stats'
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	245 #end if
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	246
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	247 ## output file
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	248 #if ( str( $analysis_type.analysis_type_selector ) != "full" or str( $analysis_type.sam_opt ) != "true" ):
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	249 \| samtools sort -O bam -o '$output'
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	250 #else
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	251 > '$output_sam'
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	252 #end if
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	253
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	254 ## rename unaligned sequence files
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	255 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r:
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	256 #from os.path import splitext
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	257 #set _unaligned_root, _unaligned_ext = splitext( str( $output_unaligned_reads_l ) )
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	258 && mv "${ _unaligned_root }.1${_unaligned_ext}" '$output_unaligned_reads_l'
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	259 && mv "${ _unaligned_root }.2${_unaligned_ext}" '$output_unaligned_reads_r'
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	260 #end if
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	261 #if $library.type == "paired" and $output_aligned_reads_l and $output_aligned_reads_r:
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	262 #from os.path import splitext
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	263 #set _aligned_root, _aligned_ext = splitext( str( $output_aligned_reads_l ) )
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	264 && mv "${ _aligned_root }.1${_aligned_ext}" '$output_aligned_reads_l'
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	265 && mv "${ _aligned_root }.2${_aligned_ext}" '$output_aligned_reads_r'
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	266 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	267
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	268 ]]></command>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	269 <inputs>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	270 <!-- single/paired -->
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	271 <conditional name="library">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	272 <param name="type" type="select" label="Is this single or paired library">
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	273 <option value="single">Single-end</option>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	274 <option value="paired">Paired-end</option>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	275 <option value="paired_collection">Paired-end Dataset Collection</option>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	276 </param>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	277
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	278 <when value="single">
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	279 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file" help="Must be of datatype "fastqsanger"" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	280 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	281 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" />
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	282 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	283 <when value="paired">
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	284 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #1" help="Must be of datatype "fastqsanger"" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	285 <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #2" help="Must be of datatype "fastqsanger"" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	286 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	287 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	288 <conditional name="paired_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	289 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	290 <option value="no" selected="True">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	291 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	292 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	293 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	294 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	295 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	296 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	297 <option value="--fr" selected="True">--fr</option>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	298 <option value="--rf">--rf</option>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	299 <option value="--ff">--ff</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	300 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	301 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	302 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	303 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
6 76231961d33b planemo upload commit 9c258b584b130e537e6a21c4f66d1a00ecb91e55 devteam parents: 5 diff changeset	304 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
76231961d33b planemo upload commit 9c258b584b130e537e6a21c4f66d1a00ecb91e55 devteam parents: 5 diff changeset	305 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	306 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	307 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	308 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	309 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	310 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	311 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	312 <when value="paired_collection">
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	313 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype "fastqsanger"" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	314 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	315 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	316 <conditional name="paired_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	317 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	318 <option value="no" selected="True">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	319 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	320 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	321 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	322 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	323 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	324 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	325 <option value="--fr" selected="True">--fr</option>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	326 <option value="--rf">--rf</option>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	327 <option value="--ff">--ff</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	328 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	329 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	330 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	331 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
6 76231961d33b planemo upload commit 9c258b584b130e537e6a21c4f66d1a00ecb91e55 devteam parents: 5 diff changeset	332 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
76231961d33b planemo upload commit 9c258b584b130e537e6a21c4f66d1a00ecb91e55 devteam parents: 5 diff changeset	333 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	334 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	335 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	336 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	337 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	338 </conditional>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	339 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	340 </conditional>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	341
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	342 <!-- reference genome -->
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	343 <conditional name="reference_genome">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	344 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	345 <option value="indexed">Use a built-in genome index</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	346 <option value="history">Use a genome from the history and build index</option>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	347 </param>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	348 <when value="indexed">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	349 <param name="index" type="select" label="Select reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	350 <options from_data_table="bowtie2_indexes">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	351 <filter type="sort_by" column="2"/>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	352 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	353 </options>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	354 </param>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	355 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	356 <when value="history">
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	357 <param name="own_file" type="data" format="fasta" label="Select reference genome" />
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	358 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	359 </conditional>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	360
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	361 <!-- read group settings -->
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	362 <expand macro="read_group_conditional" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	363 <conditional name="analysis_type">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	364 <param name="analysis_type_selector" type="select" label="Select analysis mode">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	365 <option value="simple">1: Default setting only</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	366 <option value="full">2: Full parameter list</option>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	367 </param>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	368 <when value="simple">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	369 <param name="presets" type="select" display="radio" label="Do you want to use presets?" help="Allow selecting among several preset parameter settings. Choosing between these will result in dramatic changes in runtime. See help below to understand effects of these presets.">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	370 <option value="no_presets" selected="True">No, just use defaults</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	371 <option value="--very-fast">Very fast end-to-end (--very-fast)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	372 <option value="--fast">Fast end-to-end (--fast)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	373 <option value="--sensitive">Sensitive end-to-end (--sensitive)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	374 <option value="--very-sensitive">Very sensitive end-to-end (--very-sensitive)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	375 <option value="--very-fast-local">Very fast local (--very-fast-local)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	376 <option value="--fast-local">Fast local (--fast-local)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	377 <option value="--sensitive-local">Sensitive local (--sensitive-local)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	378 <option value="--very-sensitive-local">Very sensitive local (--very-sensitive-local)</option>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	379 </param>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	380 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	381 <when value="full">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	382 <conditional name="input_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	383 <param name="input_options_selector" type="select" label="Do you want to tweak input options?" help="See "Input Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	384 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	385 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	386 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	387 <when value="yes">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	388 <param name="skip" type="integer" min="0" value="0" label="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	389 <param name="qupto" type="integer" min="1" value="100000000" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; for default behavior (no limit) leave this value very large"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	390 <param name="trim5" type="integer" min="0" value="0" label="Trim that many bases from 5' (left) end of each read before alignment" help="-5/--trim5; default=0"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	391 <param name="trim3" type="integer" min="0" value="0" label="Trim that many bases from 3' (right) end of each read before alignment" help="-3/--trim3; default=0"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	392 <param name="qv_encoding" type="select" display="radio" label="Select quality score encoding" help="See help below for more details">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	393 <option value="--phred33" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	394 <option value="--phred64">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	395 </param>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	396 <param name="solexa_quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	397 <param name="int_quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	398 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	399 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	400 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	401 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	402 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	403 <conditional name="alignment_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	404 <param name="alignment_options_selector" type="select" label="Do you want to tweak alignment options?" help="See "Alignment Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	405 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	406 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	407 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	408 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	409 <param name="N" type="integer" min="0" max="1" value="0" label="Set the number of mismatches to be allowed in a seed alignment during multiseed alignment (see `Multiseed alignment` section of help below)" help="-N; Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity; default=0"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	410 <param name="L" type="integer" min="0" max="32" value="22" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more sensitive. Default=22"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	411 <param name="i" type="text" value="S,1,1.15" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. If the function returns a result less than 1, it is rounded up to 1. Default=`S,1,1.15`"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	412 <param name="n_ceil" type="text" value="L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. Reads exceeding this ceiling are filtered out. Default=`L,0,0.15`"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	413 <param name="dpad" type="integer" min="0" value="15" label="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	414 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	415 <param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	416 <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	417 <param name="norc" type="boolean" truevalue="--norc" falsevalue="" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	418 <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read before trying the multiseed heuristic. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	419 <conditional name="align_mode">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	420 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	421 <option value="end-to-end" selected="True">End to End (--end-to-end)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	422 <option value="local">Local (--local)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	423 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	424 <when value="end-to-end">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	425 <param name="score_min_ete" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	426 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	427 <when value="local">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	428 <param name="score_min_loc" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	429 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	430 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	431 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	432 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	433 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	434 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	435 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	436 <conditional name="scoring_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	437 <param name="scoring_options_selector" type="select" label="Do you want to tweak scoring options?" help="See "Scoring Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	438 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	439 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	440 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	441 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	442 <param name="ma" type="integer" value="2" label="Set the match bonus" help="--ma; In `--local` mode match bonus is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in `--end-to-end` mode; Default=2"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	443 <param name="mp" type="text" value="6,2" label="Set the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers" help="--mp; A number less than or equal to `MX` and greater than or equal to `MN` is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`. Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` where Q is the Phred quality value; Default=6,2"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	444 <param name="np" type="integer" value="1" label="Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as `N`" help="--np; Default=1"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	445 <param name="rdg_read_open" type="integer" value="5" label="Set the read gap opening penalty" help="--rdg; this is the first component of --rdg flag - opening penalty; Default=5"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	446 <param name="rdg_read_extend" type="integer" value="3" label="Set the read gap extension penalty" help="--rdg; this is the second component of --rdg flag - extension penalty; Default=3"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	447 <param name="rfg_ref_open" type="integer" value="5" label="Set the reference gap opening penalty" help="--rfg; this is the first component of --rfg flag - opening penalty; Default=5"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	448 <param name="rfg_ref_extend" type="integer" value="3" label="Set the reference gap extension penalty" help="--rfg; this is the second component of --rfg flag - extension penalty; Default=3"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	449 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	450 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	451 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	452 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	453 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	454 <conditional name="reporting_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	455 <param name="reporting_options_selector" type="select" label="Do you want to use -a or -k options" help="Make sure you understand implications of setting -k and -a. See "Reporting Options" section of Help below for information on -k and -a options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	456 <option value="no" selected="true">No, do not set</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	457 <option value="k">Set -k option and enter -k value</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	458 <option value="a">Set -a option</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	459 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	460 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	461 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	462 </when>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	463 <when value="k">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	464 <param name="k" type="integer" min="1" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detailed description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	465 </when>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	466 <when value="a">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	467 <!-- do nothing here; set -a flag on the command line-->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	468 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	469 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	470 <conditional name="effort_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	471 <param name="effort_options_selector" type="select" label="Do you want to tweak effort options?" help="See "Effort Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	472 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	473 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	474 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	475 <when value="yes">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	476 <param name="D" type="integer" value="15" min="0" label="Attempt that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default=15"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	477 <param name="R" type="integer" value="2" min="0" label="Set the maximum number of times Bowtie 2 will `re-seed` reads with repetitive seeds" help="When `re-seeding`, Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default=2"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	478 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	479 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	480 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	481 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	482 </conditional>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	483
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	484 <conditional name="sam_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	485 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See "Output Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	486 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	487 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	488 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	489 <when value="yes">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	490 <param name="no_unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	491 <param name="omit_sec_seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	492 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	493 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	494 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	495 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	496 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	497 <conditional name="other_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	498 <param name="other_options_selector" type="select" label="Do you want to tweak Other Options?" help="See "Other Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	499 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	500 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	501 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	502 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	503 <param name="reorder" type="boolean" truevalue="--reorder" falsevalue="" label="Guarantee that output SAM records are printed in an order corresponding to the order of the reads in the original input file" help="--reorder; Default=False"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	504 <param name="seed" type="integer" value="0" min="0" label="Use this number as the seed for pseudo-random number generator" help="--seed; Default=0"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	505 <param name="non_deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	506 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	507 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	508 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	509 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	510 </conditional>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	511 <param name="sam_opt" type="boolean" truevalue="true" falsevalue="false" label="Would you like the output to be a SAM file" help="By default, the output from this Bowtie2 wrapper is a sorted BAM file."/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	512 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	513 </conditional>
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	514 <param name="save_mapping_stats" type="boolean" checked="False" label="Save the bowtie2 mapping statistics to the history" />
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	515 </inputs>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	516
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	517 <!-- define outputs -->
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	518
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	519 <outputs>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	520
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	521 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" >
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	522 <filter>library['unaligned_file'] is True</filter>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	523 <actions>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	524 <conditional name="library.type">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	525 <when value="single">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	526 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	527 <option type="from_param" name="library.input_1" param_attribute="ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	528 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	529 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	530 <when value="paired">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	531 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	532 <option type="from_param" name="library.input_1" param_attribute="ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	533 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	534 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	535 <when value="paired_collection">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	536 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	537 <option type="from_param" name="library.input_1" param_attribute="forward.ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	538 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	539 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	540 </conditional>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	541 </actions>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	542 </data>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	543 <data format="fastqsanger" name="output_aligned_reads_l" label="${tool.name} on ${on_string}: aligned reads (L)" >
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	544 <filter>library['aligned_file'] is True</filter>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	545 <actions>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	546 <conditional name="library.type">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	547 <when value="single">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	548 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	549 <option type="from_param" name="library.input_1" param_attribute="ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	550 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	551 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	552 <when value="paired">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	553 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	554 <option type="from_param" name="library.input_1" param_attribute="ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	555 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	556 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	557 <when value="paired_collection">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	558 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	559 <option type="from_param" name="library.input_1" param_attribute="forward.ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	560 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	561 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	562 </conditional>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	563 </actions>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	564 </data>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	565 <data format="fastqsanger" name="output_aligned_reads_r" label="${tool.name} on ${on_string}: aligned reads (R)">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	566 <filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['aligned_file'] is True</filter>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	567 <actions>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	568 <conditional name="library.type">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	569 <when value="paired">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	570 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	571 <option type="from_param" name="library.input_2" param_attribute="ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	572 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	573 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	574 <when value="paired_collection">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	575 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	576 <option type="from_param" name="library.input_1" param_attribute="reverse.ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	577 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	578 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	579 </conditional>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	580 </actions>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	581 </data>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	582 <data format="fastqsanger" name="output_unaligned_reads_r" label="${tool.name} on ${on_string}: unaligned reads (R)">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	583 <filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['unaligned_file'] is True</filter>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	584 <actions>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	585 <conditional name="library.type">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	586 <when value="paired">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	587 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	588 <option type="from_param" name="library.input_2" param_attribute="ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	589 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	590 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	591 <when value="paired_collection">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	592 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	593 <option type="from_param" name="library.input_1" param_attribute="reverse.ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	594 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	595 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	596 </conditional>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	597 </actions>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	598 </data>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	599
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	600 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads (sorted BAM)">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	601 <filter>analysis_type['analysis_type_selector'] == "simple" or analysis_type['sam_opt'] is False</filter>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	602 <actions>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	603 <conditional name="reference_genome.source">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	604 <when value="indexed">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	605 <action type="metadata" name="dbkey">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	606 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	607 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	608 <filter type="param_value" ref="reference_genome.index" column="0"/>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	609 </option>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	610 </action>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	611 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	612 <when value="history">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	613 <action type="metadata" name="dbkey">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	614 <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" />
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	615 </action>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	616 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	617 </conditional>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	618 </actions>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	619 </data>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	620
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	621 <data format="sam" name="output_sam" label="${tool.name} on ${on_string}: aligned reads (SAM)">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	622 <filter>analysis_type['analysis_type_selector'] == "full" and analysis_type['sam_opt'] is True</filter>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	623 <actions>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	624 <conditional name="reference_genome.source">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	625 <when value="indexed">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	626 <action type="metadata" name="dbkey">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	627 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	628 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	629 <filter type="param_value" ref="reference_genome.index" column="0"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	630 </option>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	631 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	632 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	633 <when value="history">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	634 <action type="metadata" name="dbkey">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	635 <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	636 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	637 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	638 </conditional>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	639 </actions>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	640 </data>
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	641 <data format="txt" name="mapping_stats" label="${tool.name} on ${on_string}: mapping stats">
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	642 <filter>save_mapping_stats is True</filter>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	643 </data>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	644
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	645 </outputs>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	646
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	647 <tests>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	648 <test>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	649 <!-- basic test on single paired default run -->
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	650 <param name="type" value="paired"/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	651 <param name="selection" value="no"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	652 <param name="paired_options_selector" value="no"/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	653 <param name="unaligned_file" value="false"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	654 <param name="analysis_type_selector" value="simple"/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	655 <param name="source" value="history" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	656 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	657 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	658 <param name="own_file" value="bowtie2-ref.fasta" />
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	659 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	660 </test>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	661 <test>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	662 <!-- basic test on single paired default run -->
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	663 <param name="type" value="paired"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	664 <param name="selection" value="no"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	665 <param name="paired_options_selector" value="no"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	666 <param name="unaligned_file" value="false"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	667 <param name="analysis_type_selector" value="simple"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	668 <param name="rg_selector" value="set"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	669 <param name="ID" value="rg1"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	670 <param name="PL" value="CAPILLARY"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	671 <param name="source" value="history" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	672 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	673 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	674 <param name="own_file" value="bowtie2-ref.fasta" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	675 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	676 </test>
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	677 <test>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	678 <!-- basic test on single paired default run with stats-->
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	679 <param name="type" value="paired"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	680 <param name="selection" value="no"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	681 <param name="paired_options_selector" value="no"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	682 <param name="unaligned_file" value="false"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	683 <param name="analysis_type_selector" value="simple"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	684 <param name="source" value="history" />
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	685 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	686 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	687 <param name="own_file" value="bowtie2-ref.fasta" />
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	688 <param name="save_mapping_stats" value="true" />
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	689 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	690 <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	691 </test>
14 85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	692 <test>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	693 <!-- test fastqsanger.gz input -->
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	694 <param name="type" value="paired"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	695 <param name="selection" value="no"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	696 <param name="paired_options_selector" value="no"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	697 <param name="unaligned_file" value="false"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	698 <param name="analysis_type_selector" value="simple"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	699 <param name="source" value="history" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	700 <param name="input_1" value="bowtie2-fq1.fq.gz" ftype="fastqsanger.gz"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	701 <param name="input_2" value="bowtie2-fq2.fq.gz" ftype="fastqsanger.gz"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	702 <param name="own_file" value="bowtie2-ref.fasta" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	703 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	704 </test>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	705 <test>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	706 <!-- test fastqsanger.bz2 input -->
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	707 <param name="type" value="paired"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	708 <param name="selection" value="no"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	709 <param name="paired_options_selector" value="no"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	710 <param name="unaligned_file" value="false"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	711 <param name="analysis_type_selector" value="simple"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	712 <param name="source" value="history" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	713 <param name="input_1" value="bowtie2-fq1.fq.bz2" ftype="fastqsanger.bz2"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	714 <param name="input_2" value="bowtie2-fq2.fq.bz2" ftype="fastqsanger.bz2"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	715 <param name="own_file" value="bowtie2-ref.fasta" />
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	716 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
85f0e9edb32d planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit 954b2052cb74a0bc88f65df37f429ff27c45ea8f devteam parents: 13 diff changeset	717 </test>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	718 </tests>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	719
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	720 <help><![CDATA[
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	721
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	722 Bowtie2 Overview
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	723
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	724 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	725 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	726
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	727 .. _Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	728 .. _`Bowtie2 manual`: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	729 .. _`BAM format`: http://samtools.github.io/hts-specs/SAMv1.pdf
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	730
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	731 -----
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	732
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	733 Selecting reference genomes for Bowtie2
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	734
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	735 Galaxy wrapper for Bowtie2 allows you select between precomputed and user-defined indices for reference genomes using Will you select a reference genome from your history or use a built-in index? flag. This flag has two options:
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	736
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	737 1. Use a built-in genome index - when selected (this is default), Galaxy provides the user with Select reference genome index dropdown. Genomes listed in this dropdown have been pre-indexed with bowtie2-build utility and are ready to be mapped against.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	738 2. Use a genome from the history and build index - when selected, Galaxy provides the user with Select reference genome sequence dropdown. This dropdown is populated by all FASTA formatted files listed in your current history. If your genome of interest is uploaded into history it will be shown there. Selecting a genome from this dropdown will cause Galaxy to first transparently index it using bowtie2-build command, and then run mapping with bowtie2.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	739
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	740 If your genome of interest is not listed here you have two choices:
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	741
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	742 1. Contact galaxy team using Help->Support link at the top of the interface and let us know that an index needs to be added
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	743 2. Upload your genome of interest as a FASTA file to Galaxy history and selected Use a genome from the history and build index option.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	744
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	745 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	746
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	747 .. class:: infomark
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	748
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	749 Bowtie2 options
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	750
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	751 Galaxy wrapper for Bowtie2 implements most but not all options available through the command line. Supported options are described below.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	752
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	753 -----
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	754
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	755 Inputs
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	756
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	757 Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files.
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	758
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	759 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	760
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	761 Input options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	762
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	763 -s/--skip <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	764 Skip (i.e. do not align) the first `<int>` reads or pairs in the input.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	765
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	766 -u/--qupto <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	767 Align the first `<int>` reads or read pairs from the input (after the
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	768 `-s`/`--skip` reads or pairs have been skipped), then stop. Default: no limit.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	769
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	770 -5/--trim5 <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	771 Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0).
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	772
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	773 -3/--trim3 <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	774 Trim `<int>` bases from 3' (right) end of each read before alignment (default: 0).
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	775
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	776 --phred33
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	777 Input qualities are ASCII chars equal to the Phred quality plus 33. This is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	778 also called the "Phred+33" encoding, which is used by the very latest Illumina
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	779 pipelines.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	780
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	781 --phred64
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	782 Input qualities are ASCII chars equal to the Phred quality plus 64. This is
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	783 also called the "Phred+64" encoding.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	784
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	785 --solexa-quals
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	786 Convert input qualities from Solexa Phred quality (which can be negative) to
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	787 Phred Phred quality (which can't). This scheme was used in older Illumina GA
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	788 Pipeline versions (prior to 1.3). Default: off.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	789
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	790 --int-quals
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	791 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	792 Integers are treated as being on the Phred quality scale unless
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	793 `--solexa-quals` is also specified. Default: off.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	794
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	795 ------
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	796
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	797 Presets in `--end-to-end` mode::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	798
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	799 --very-fast
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	800 Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	801
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	802 --fast
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	803 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50`
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	804
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	805 --sensitive
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	806 Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode)
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	807
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	808 --very-sensitive
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	809 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	810
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	811 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	812
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	813 Presets options in `--local` mode::
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	814
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	815 --very-fast-local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	816 Same as: `-D 5 -R 1 -N 0 -L 25 -i S,1,2.00`
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	817
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	818 --fast-local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	819 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,1,1.75`
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	820
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	821 --sensitive-local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	822 Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode)
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	823
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	824 --very-sensitive-local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	825 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	826
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	827 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	828
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	829 Alignment options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	830
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	831 -N <int>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	832 Sets the number of mismatches to allowed in a seed alignment during multiseed
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	833 alignment. Can be set to 0 or 1. Setting this higher makes alignment slower
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	834 (often much slower) but increases sensitivity. Default: 0.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	835
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	836 -L <int>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	837 Sets the length of the seed substrings to align during multiseed alignment.
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	838 Smaller values make alignment slower but more sensitive. Default: the
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	839 `--sensitive` preset is used by default, which sets `-L` to 22 in
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	840 `--end-to-end` mode and to 20 in `--local` mode.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	841
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	842 -i <func>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	843 Sets a function governing the interval between seed substrings to use during
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	844 multiseed alignment. For instance, if the read has 30 characers, and seed
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	845 length is 10, and the seed interval is 6, the seeds extracted will be:
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	846
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	847 Read: TAGCTACGCTCTACGCTATCATGCATAAAC
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	848 Seed 1 fw: TAGCTACGCT
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	849 Seed 1 rc: AGCGTAGCTA
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	850 Seed 2 fw: CGCTCTACGC
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	851 Seed 2 rc: GCGTAGAGCG
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	852 Seed 3 fw: ACGCTATCAT
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	853 Seed 3 rc: ATGATAGCGT
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	854 Seed 4 fw: TCATGCATAA
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	855 Seed 4 rc: TTATGCATGA
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	856
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	857 Since it's best to use longer intervals for longer reads, this parameter sets
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	858 the interval as a function of the read length, rather than a single
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	859 one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	860 interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length.
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	861 If the function returns a result less than
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	862 1, it is rounded up to 1. Default: the `--sensitive` preset is used by
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	863 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	864 in `--local` mode.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	865
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	866 --n-ceil <func>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	867 Sets a function governing the maximum number of ambiguous characters (usually
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	868 `N`s and/or `.`s) allowed in a read as a function of read length. For instance,
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	869 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	870 where x is the read length. Reads exceeding this ceiling are filtered out.
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	871 Default: `L,0,0.15`.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	872
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	873 --dpad <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	874 "Pads" dynamic programming problems by `<int>` columns on either side to allow
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	875 gaps. Default: 15.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	876
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	877 --gbar <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	878 Disallow gaps within `<int>` positions of the beginning or end of the read.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	879 Default: 4.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	880
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	881 --ignore-quals
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	882 When calculating a mismatch penalty, always consider the quality value at the
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	883 mismatched position to be the highest possible, regardless of the actual value.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	884 I.e. input is treated as though all quality values are high. This is also the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	885 default behavior when the input doesn't specify quality values (e.g. in `-f`,
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	886 `-r`, or `-c` modes).
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	887
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	888 --nofw/--norc
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	889 If `--nofw` is specified, `bowtie2` will not attempt to align unpaired reads to
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	890 the forward (Watson) reference strand. If `--norc` is specified, `bowtie2` will
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	891 not attempt to align unpaired reads against the reverse-complement (Crick)
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	892 reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	893 fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	894 paired-end configurations corresponding to fragments from the reverse-complement
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	895 (Crick) strand. Default: both strands enabled.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	896
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	897 --no-1mm-upfront
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	898 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	899 end-to-end alignment for the read before trying the multiseed heuristic. Such
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	900 alignments can be found very quickly, and many short read alignments have exact or
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	901 near-exact end-to-end alignments. However, this can lead to unexpected
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	902 alignments when the user also sets options governing the multiseed heuristic,
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	903 like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	904 to the length of the read, the user will be surprised to find 1-mismatch alignments
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	905 reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	906 alignments before using the multiseed heuristic, which leads to the expected
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	907 behavior when combined with options such as `-L` and `-N`. This comes at the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	908 expense of speed.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	909
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	910 --end-to-end
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	911 In this mode, Bowtie 2 requires that the entire read align from one end to the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	912 other, without any trimming (or "soft clipping") of characters from either end.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	913 The match bonus `--ma` always equals 0 in this mode, so all alignment scores
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	914 are less than or equal to 0, and the greatest possible alignment score is 0.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	915 This is mutually exclusive with `--local`. `--end-to-end` is the default mode.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	916
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	917 --local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	918 In this mode, Bowtie 2 does not require that the entire read align from one end
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	919 to the other. Rather, some characters may be omitted ("soft clipped") from the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	920 ends in order to achieve the greatest possible alignment score. The match bonus
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	921 `--ma` is used in this mode, and the best possible alignment score is equal to
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	922 the match bonus (`--ma`) times the length of the read. Specifying `--local`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	923 and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	924 the local version of the preset (`--very-fast-local`). This is mutually
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	925 exclusive with `--end-to-end`. `--end-to-end` is the default mode.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	926
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	927 -----
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	928
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	929 Scoring options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	930
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	931 --ma <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	932 Sets the match bonus. In `--local` mode `<int>` is added to the alignment
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	933 score for each position where a read character aligns to a reference character
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	934 and the characters match. Not used in `--end-to-end` mode. Default: 2.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	935
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	936 --mp MX,MN
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	937 Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	938 number less than or equal to `MX` and greater than or equal to `MN` is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	939 subtracted from the alignment score for each position where a read character
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	940 aligns to a reference character, the characters do not match, and neither is an
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	941 `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	942 Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	943 where Q is the Phred quality value. Default: `MX` = 6, `MN` = 2.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	944
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	945 --np <int>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	946 Sets penalty for positions where the read, reference, or both, contain an
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	947 ambiguous character such as `N`. Default: 1.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	948
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	949 --rdg <int1>,<int2>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	950 Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties. A read gap of
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	951 length N gets a penalty of `<int1>` + N * `<int2>`. Default: 5, 3.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	952
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	953 --rfg <int1>,<int2>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	954 Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties. A
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	955 reference gap of length N gets a penalty of `<int1>` + N * `<int2>`. Default:
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	956 5, 3.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	957
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	958 --score-min <func>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	959 Sets a function governing the minimum alignment score needed for an alignment to
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	960 be considered "valid" (i.e. good enough to report). This is a function of read
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	961 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	962 to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	963 the default in `--local` mode is `G,20,8`.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	964
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	965 -----
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	966
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	967 Reporting options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	968
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	969 -k <int>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	970 By default, `bowtie2` searches for distinct, valid alignments for each read.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	971 When it finds a valid alignment, it continues looking for alignments that are
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	972 nearly as good or better. The best alignment found is reported (randomly
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	973 selected from among best if tied). Information about the best alignments is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	974 used to estimate mapping quality and to set SAM optional fields, such as
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	975 `AS:i` and `XS:i`.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	976
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	977 When `-k` is specified, however, `bowtie2` behaves differently. Instead, it
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	978 searches for at most `<int>` distinct, valid alignments for each read. The
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	979 search terminates when it can't find more distinct valid alignments, or when it
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	980 finds `<int>`, whichever happens first. All alignments found are reported in
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	981 descending order by alignment score. The alignment score for a paired-end
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	982 alignment equals the sum of the alignment scores of the individual mates. Each
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	983 reported read or pair alignment beyond the first has the SAM 'secondary' bit
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	984 (which equals 256) set in its FLAGS field. For reads that have more than
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	985 `<int>` distinct, valid alignments, `bowtie2` does not guarantee that the
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	986 `<int>` alignments reported are the best possible in terms of alignment score.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	987 `-k` is mutually exclusive with `-a`.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	988
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	989 Note: Bowtie 2 is not designed with large values for `-k` in mind, and when
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	990 aligning reads to long, repetitive genomes large `-k` can be very, very slow.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	991
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	992 -a
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	993 Like `-k` but with no upper limit on number of alignments to search for. `-a`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	994 is mutually exclusive with `-k`.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	995
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	996 Note: Bowtie 2 is not designed with `-a` mode in mind, and when
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	997 aligning reads to long, repetitive genomes this mode can be very, very slow.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	998
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	999 -----
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1000
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1001 Effort options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1002
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1003 -D <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1004 Up to `<int>` consecutive seed extension attempts can "fail" before Bowtie 2
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1005 moves on, using the alignments found so far. A seed extension "fails" if it
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1006 does not yield a new best or a new second-best alignment. This limit is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1007 automatically adjusted up when -k or -a are specified. Default: 15.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1008
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1009 -R <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1010 `<int>` is the maximum number of times Bowtie 2 will "re-seed" reads with
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1011 repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1012 (same length, same number of mismatches allowed) at different offsets and
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1013 searches for more alignments. A read is considered to have repetitive seeds if
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1014 the total number of seed hits divided by the number of seeds that aligned at
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1015 least once is greater than 300. Default: 2.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1016
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1017 -----
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1018
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1019 Paired-end options::
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1020
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1021 -I/--minins <int>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1022 The minimum fragment length for valid paired-end alignments. E.g. if `-I 60` is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1023 specified and a paired-end alignment consists of two 20-bp alignments in the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1024 appropriate orientation with a 20-bp gap between them, that alignment is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1025 considered valid (as long as `-X` is also satisfied). A 19-bp gap would not
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1026 be valid in that case. If trimming options `-3` or `-5` are also used, the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1027 `-I` constraint is applied with respect to the untrimmed mates.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1028
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1029 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1030 run. This is because larger differences bewteen `-I` and `-X` require that
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1031 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1032 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1033 efficient.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1034
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1035 Default: 0 (essentially imposing no minimum)
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1036
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1037 -X/--maxins <int>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1038 The maximum fragment length for valid paired-end alignments. E.g. if `-X 100`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1039 is specified and a paired-end alignment consists of two 20-bp alignments in the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1040 proper orientation with a 60-bp gap between them, that alignment is considered
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1041 valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1042 that case. If trimming options `-3` or `-5` are also used, the `-X`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1043 constraint is applied with respect to the untrimmed mates, not the trimmed
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1044 mates.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1045
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1046 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1047 run. This is because larger differences bewteen `-I` and `-X` require that
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1048 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1049 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1050 efficient.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1051
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1052 Default: 500.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1053
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1054 --fr/--rf/--ff
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1055 The upstream/downstream mate orientations for a valid paired-end alignment
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1056 against the forward reference strand. E.g., if `--fr` is specified and there is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1057 a candidate paired-end alignment where mate 1 appears upstream of the reverse
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1058 complement of mate 2 and the fragment length constraints (`-I` and `-X`) are
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1059 met, that alignment is valid. Also, if mate 2 appears upstream of the reverse
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1060 complement of mate 1 and all other constraints are met, that too is valid.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1061 `--rf` likewise requires that an upstream mate1 be reverse-complemented and a
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1062 downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1063 and a downstream mate 2 to be forward-oriented. Default: `--fr` (appropriate
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1064 for Illumina's Paired-end Sequencing Assay).
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1065
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1066 --no-mixed
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1067 By default, when `bowtie2` cannot find a concordant or discordant alignment for
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1068 a pair, it then tries to find alignments for the individual mates. This option
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1069 disables that behavior.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1070
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1071 --no-discordant
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1072 By default, `bowtie2` looks for discordant alignments if it cannot find any
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1073 concordant alignments. A discordant alignment is an alignment where both mates
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1074 align uniquely, but that does not satisfy the paired-end constraints
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1075 (`--fr`/`--rf`/`--ff`, `-I`, `-X`). This option disables that behavior.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1076
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1077 --dovetail
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1078 If the mates "dovetail", that is if one mate alignment extends past the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1079 beginning of the other such that the wrong mate begins upstream, consider that
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1080 to be concordant. Default: mates cannot dovetail in a concordant alignment.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1081
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1082 --no-contain
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1083 If one mate alignment contains the other, consider that to be non-concordant.
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1084 Default: a mate can contain the other in a concordant alignment.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1085
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1086 --no-overlap
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1087 If one mate alignment overlaps the other at all, consider that to be
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1088 non-concordant. Default: mates can overlap in a concordant alignment.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1089
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1090 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1091
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1092 SAM options::
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1093
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1094 --rg-id <text>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1095 Set the read group ID to `<text>`. This causes the SAM `@RG` header line to be
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1096 printed, with `<text>` as the value associated with the `ID:` tag. It also
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1097 causes the `RG:Z:` extra field to be attached to each SAM output record, with
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1098 value set to `<text>`.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1099
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1100 --rg <text>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1101 Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1102 `@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id`
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1103 must also be specified. This is because the `ID` tag is required by the SAM
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1104 Specification. Specify `--rg` multiple times to set multiple fields. See the
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1105 SAM Specification for details about what fields are legal.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1106
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1107 --omit-sec-seq
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1108 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1109 and `QUAL` strings. Specifying this option causes Bowtie 2 to print an asterix
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1110 in those fields instead.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1111
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1112 -----
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1113
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1114 Other options::
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1115
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1116 --reorder
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1117 Guarantees that output SAM records are printed in an order corresponding to the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1118 order of the reads in the original input file, even when `-p` is set greater
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1119 than 1. Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1120 2 to run somewhat slower and use somewhat more memory then if `--reorder` were
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1121 not specified. Has no effect if `-p` is set to 1, since output order will
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1122 naturally correspond to input order in that case.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1123
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1124 --seed <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1125 Use `<int>` as the seed for pseudo-random number generator. Default: 0.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1126
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1127 --non-deterministic
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1128 Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1129 seeds the generator with a number derived from (a) the read name, (b) the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1130 nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1131 option. This means that if two reads are identical (same name, same
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1132 nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s)
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1133 for both, even if there was ambiguity. When `--non-deterministic` is specified,
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1134 Bowtie 2 re-initializes its pseudo-random generator for each read using the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1135 current time. This means that Bowtie 2 will not necessarily report the same
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1136 alignment for two identical reads. This is counter-intuitive for some users,
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1137 but might be more appropriate in situations where the input consists of many
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1138 identical reads.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1139
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1140 ]]></help>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1141 <citations>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1142 <citation type="doi">10.1186/gb-2009-10-3-r25</citation>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1143 <citation type="doi">10.1038/nmeth.1923</citation>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1144 </citations>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1145 </tool>

Mercurial > repos > devteam > bowtie2

annotate bowtie2_wrapper.xml @ 14:85f0e9edb32d draft