bowtie2: bowtie2_wrapper.xml annotate

annotate bowtie2_wrapper.xml @ 13:55dcd6aad1ab draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit b22fc2e7243522b264f3d5d00706df8d18366405

author	devteam
date	Mon, 09 Jan 2017 04:30:45 -0500
parents	ed052d843da7
children	85f0e9edb32d

rev	line source
12 ed052d843da7 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a326a3469adfd33babe792cf58544438582a56a1 devteam parents: 11 diff changeset	1 <tool id="bowtie2" name="Bowtie2" version="2.3.0">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	2 <description>- map reads against reference genome</description>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	3 <macros>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	4 <import>read_group_macros.xml</import>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	5 </macros>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	6 <requirements>
12 ed052d843da7 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit a326a3469adfd33babe792cf58544438582a56a1 devteam parents: 11 diff changeset	7 <requirement type="package" version="2.3.0">bowtie2</requirement>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	8 <requirement type="package" version="1.3.1">samtools</requirement>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	9 </requirements>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	10 <version_command>bowtie2 --version</version_command>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	11 <command detect_errors="exit_code"><![CDATA[
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	12 ## prepare bowtie2 index
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	13 #set index_path = ''
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	14 #if str($reference_genome.source) == "history":
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	15 bowtie2-build --threads \${GALAXY_SLOTS:-4} '$reference_genome.own_file' genome &&
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	16 ln -s -f '$reference_genome.own_file' genome.fa &&
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	17 #set index_path = 'genome'
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	18 #else:
13 55dcd6aad1ab planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit b22fc2e7243522b264f3d5d00706df8d18366405 devteam parents: 12 diff changeset	19 #set index_path = $reference_genome.index.fields.path
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	20 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	21
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	22 ## execute bowtie2
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	23
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	24 bowtie2
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	25
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	26 ## number of threads
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	27 -p \${GALAXY_SLOTS:-4}
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	28
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	29 ## index file path
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	30 -x '$index_path'
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	31
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	32 ## Fastq inputs
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	33 #if str( $library.type ) == "single":
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	34 -U '${library.input_1}'
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	35 #if str( $library.unaligned_file ) == "true":
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	36 --un '$output_unaligned_reads_l'
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	37 #end if
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	38 #if str( $library.aligned_file ) == "true":
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	39 --al '$output_aligned_reads_l'
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	40 #end if
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	41 #elif str( $library.type ) == "paired":
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	42 -1 '${library.input_1}'
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	43 -2 '${library.input_2}'
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	44 #if str( $library.paired_options.paired_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	45 -I "${library.paired_options.I}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	46 -X "${library.paired_options.X}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	47 ${library.paired_options.fr_rf_ff}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	48 ${library.paired_options.no_mixed}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	49 ${library.paired_options.no_discordant}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	50 ${library.paired_options.dovetail}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	51 ${library.paired_options.no_contain}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	52 ${library.paired_options.no_overlap}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	53 #end if
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	54 #if str( $library.unaligned_file ) == "true":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	55 --un-conc $output_unaligned_reads_l
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	56 #end if
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	57 #if str( $library.aligned_file ) == "true":
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	58 --al-conc $output_aligned_reads_l
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	59 #end if
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	60 #else
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	61 ## prepare collection
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	62 -1 $library.input_1.forward
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	63 -2 $library.input_1.reverse
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	64 #if str( $library.paired_options.paired_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	65 -I "${library.paired_options.I}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	66 -X "${library.paired_options.X}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	67 ${library.paired_options.fr_rf_ff}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	68 ${library.paired_options.no_mixed}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	69 ${library.paired_options.no_discordant}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	70 ${library.paired_options.dovetail}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	71 ${library.paired_options.no_contain}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	72 ${library.paired_options.no_overlap}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	73 #end if
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	74 #if str( $library.unaligned_file ) == "true":
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	75 --un-conc '$output_unaligned_reads_l'
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	76 #end if
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	77 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	78
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	79 ## Read group information.
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	80 @define_read_group_helpers@
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	81 #if str( $library.type ) == "single":
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	82 #set $rg_auto_name = $read_group_name_default($library.input_1)
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	83 #elif str( $library.type ) == "paired":
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	84 #set $rg_auto_name = $read_group_name_default($library.input_1, $library.input_2)
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	85 #else
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	86 #set $rg_auto_name = $read_group_name_default($library.input_1)
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	87 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	88 @set_use_rg_var@
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	89 @set_read_group_vars@
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	90 #if $use_rg
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	91 $format_read_group("", $rg_id, '"', arg='--rg-id ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	92 $format_read_group("SM:", $rg_sm, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	93 $format_read_group("PL:", $rg_pl, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	94 $format_read_group("LB:", $rg_lb, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	95 $format_read_group("CN:", $rg_cn, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	96 $format_read_group("DS:", $rg_ds, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	97 $format_read_group("DT:", $rg_dt, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	98 $format_read_group("FO:", $rg_fo, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	99 $format_read_group("KS:", $rg_ks, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	100 $format_read_group("PG:", $rg_pg, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	101 $format_read_group("PI:", $rg_pi, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	102 $format_read_group("PU:", $rg_pu, '"', arg='--rg ')
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	103 #end if
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	104
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	105 ## Analysis type
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	106 #if ( str( $analysis_type.analysis_type_selector ) == "simple" and str( $analysis_type.presets ) != "no_presets" ):
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	107 $analysis_type.presets
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	108 #elif str( $analysis_type.analysis_type_selector ) == "full":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	109 #if str( $analysis_type.input_options.input_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	110 --skip "${analysis_type.input_options.skip}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	111 --qupto "${analysis_type.input_options.qupto}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	112 --trim5 "${analysis_type.input_options.trim5}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	113 --trim3 "${analysis_type.input_options.trim3}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	114 ${analysis_type.input_options.qv_encoding}
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	115 ${analysis_type.input_options.solexa_quals}
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	116 ${analysis_type.input_options.int_quals}
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	117 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	118
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	119 #if str( $analysis_type.alignment_options.alignment_options_selector ) == "yes":
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	120 -N "${analysis_type.alignment_options.N}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	121 -L "${analysis_type.alignment_options.L}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	122 -i "${analysis_type.alignment_options.i}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	123 --n-ceil "${analysis_type.alignment_options.n_ceil}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	124 --dpad "${analysis_type.alignment_options.dpad}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	125 --gbar "${analysis_type.alignment_options.gbar}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	126 ${analysis_type.alignment_options.ignore_quals}
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	127 ${analysis_type.alignment_options.nofw}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	128 ${analysis_type.alignment_options.norc}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	129 ${analysis_type.alignment_options.no_1mm_upfront}
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	130 #if str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "end-to-end":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	131 --end-to-end
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	132 --score-min "${analysis_type.alignment_options.align_mode.score_min_ete}"
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	133 #elif str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	134 --local
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	135 --score-min "${analysis_type.alignment_options.align_mode.score_min_loc}"
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	136 #end if
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	137 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	138
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	139 #if str( $analysis_type.scoring_options.scoring_options_selector ) == "yes":
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	140 #if ( str( $analysis_type.alignment_options.alignment_options_selector ) == "yes" and str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local" ):
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	141 --ma "${analysis_type.scoring_options.ma}"
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	142 #end if
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	143 --mp "${analysis_type.scoring_options.mp}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	144 --np "${analysis_type.scoring_options.np}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	145 --rdg "${analysis_type.scoring_options.rdg_read_open},${analysis_type.scoring_options.rdg_read_extend}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	146 --rfg "${analysis_type.scoring_options.rfg_ref_open},${analysis_type.scoring_options.rfg_ref_extend}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	147 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	148
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	149 #if str( $analysis_type.reporting_options.reporting_options_selector ) == "k":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	150 -k "${analysis_type.reporting_options.k}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	151 #elif str( $analysis_type.reporting_options.reporting_options_selector ) == "a":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	152 -a
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	153 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	154
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	155 #if str( $analysis_type.effort_options.effort_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	156 -D "${analysis_type.effort_options.D}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	157 -R "${analysis_type.effort_options.R}"
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	158 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	159
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	160 #if str( $analysis_type.sam_options.sam_options_selector ) == "yes":
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	161 ${analysis_type.sam_options.no_unal}
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	162 ${analysis_type.sam_options.omit_sec_seq}
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	163 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	164
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	165 #if str( $analysis_type.other_options.other_options_selector ) == "yes":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	166 ${analysis_type.other_options.reorder}
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	167 ${analysis_type.other_options.non_deterministic}
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	168 --seed "${analysis_type.other_options.seed}"
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	169 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	170
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	171 #elif str( $analysis_type.analysis_type_selector ) == "cline":
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	172 ${analysis_type.cline}
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	173 #end if
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	174
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	175 ## mapping stats (i.e. stderr from bowtie2)
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	176 #if $save_mapping_stats
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	177 2> '$mapping_stats'
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	178 #end if
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	179
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	180 ## output file
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	181 #if ( str( $analysis_type.analysis_type_selector ) != "full" or str( $analysis_type.sam_opt ) != "true" ):
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	182 \| samtools sort -O bam -o '$output'
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	183 #else
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	184 > '$output_sam'
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	185 #end if
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	186
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	187 ## rename unaligned sequence files
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	188 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r:
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	189 #from os.path import splitext
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	190 #set _unaligned_root, _unaligned_ext = splitext( str( $output_unaligned_reads_l ) )
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	191 && mv "${ _unaligned_root }.1${_unaligned_ext}" '$output_unaligned_reads_l'
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	192 && mv "${ _unaligned_root }.2${_unaligned_ext}" '$output_unaligned_reads_r'
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	193 #end if
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	194 #if $library.type == "paired" and $output_aligned_reads_l and $output_aligned_reads_r:
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	195 #from os.path import splitext
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	196 #set _aligned_root, _aligned_ext = splitext( str( $output_aligned_reads_l ) )
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	197 && mv "${ _aligned_root }.1${_aligned_ext}" '$output_aligned_reads_l'
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	198 && mv "${ _aligned_root }.2${_aligned_ext}" '$output_aligned_reads_r'
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	199 #end if
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	200
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	201 ]]></command>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	202 <inputs>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	203 <!-- single/paired -->
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	204 <conditional name="library">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	205 <param name="type" type="select" label="Is this single or paired library">
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	206 <option value="single">Single-end</option>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	207 <option value="paired">Paired-end</option>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	208 <option value="paired_collection">Paired-end Dataset Collection</option>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	209 </param>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	210
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	211 <when value="single">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	212 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Must be of datatype "fastqsanger"" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	213 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	214 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	215 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	216 <when value="paired">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	217 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file #1" help="Must be of datatype "fastqsanger"" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	218 <param name="input_2" format="fastqsanger" type="data" label="FASTQ file #2" help="Must be of datatype "fastqsanger"" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	219 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	220 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	221 <conditional name="paired_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	222 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	223 <option value="no" selected="True">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	224 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	225 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	226 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	227 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	228 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	229 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	230 <option value="--fr" selected="True">--fr</option>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	231 <option value="--rf">--rf</option>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	232 <option value="--ff">--ff</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	233 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	234 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	235 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	236 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
6 76231961d33b planemo upload commit 9c258b584b130e537e6a21c4f66d1a00ecb91e55 devteam parents: 5 diff changeset	237 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
76231961d33b planemo upload commit 9c258b584b130e537e6a21c4f66d1a00ecb91e55 devteam parents: 5 diff changeset	238 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	239 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	240 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	241 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	242 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	243 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	244 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	245 <when value="paired_collection">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	246 <param name="input_1" format="fastqsanger" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype "fastqsanger"" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	247 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	248 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc; This triggers --al parameter for single reads and --al-conc for paired reads" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	249 <conditional name="paired_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	250 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	251 <option value="no" selected="True">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	252 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	253 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	254 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	255 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	256 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	257 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	258 <option value="--fr" selected="True">--fr</option>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	259 <option value="--rf">--rf</option>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	260 <option value="--ff">--ff</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	261 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	262 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	263 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	264 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
6 76231961d33b planemo upload commit 9c258b584b130e537e6a21c4f66d1a00ecb91e55 devteam parents: 5 diff changeset	265 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
76231961d33b planemo upload commit 9c258b584b130e537e6a21c4f66d1a00ecb91e55 devteam parents: 5 diff changeset	266 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	267 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	268 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	269 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	270 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	271 </conditional>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	272 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	273 </conditional>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	274
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	275 <!-- reference genome -->
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	276 <conditional name="reference_genome">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	277 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	278 <option value="indexed">Use a built-in genome index</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	279 <option value="history">Use a genome from the history and build index</option>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	280 </param>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	281 <when value="indexed">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	282 <param name="index" type="select" label="Select reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	283 <options from_data_table="bowtie2_indexes">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	284 <filter type="sort_by" column="2"/>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	285 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	286 </options>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	287 </param>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	288 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	289 <when value="history">
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	290 <param name="own_file" type="data" format="fasta" label="Select reference genome" />
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	291 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	292 </conditional>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	293
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	294 <!-- read group settings -->
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	295 <expand macro="read_group_conditional" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	296 <conditional name="analysis_type">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	297 <param name="analysis_type_selector" type="select" label="Select analysis mode">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	298 <option value="simple">1: Default setting only</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	299 <option value="full">2: Full parameter list</option>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	300 </param>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	301 <when value="simple">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	302 <param name="presets" type="select" display="radio" label="Do you want to use presets?" help="Allow selecting among several preset parameter settings. Choosing between these will result in dramatic changes in runtime. See help below to understand effects of these presets.">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	303 <option value="no_presets" selected="True">No, just use defaults</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	304 <option value="--very-fast">Very fast end-to-end (--very-fast)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	305 <option value="--fast">Fast end-to-end (--fast)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	306 <option value="--sensitive">Sensitive end-to-end (--sensitive)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	307 <option value="--very-sensitive">Very sensitive end-to-end (--very-sensitive)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	308 <option value="--very-fast-local">Very fast local (--very-fast-local)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	309 <option value="--fast-local">Fast local (--fast-local)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	310 <option value="--sensitive-local">Sensitive local (--sensitive-local)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	311 <option value="--very-sensitive-local">Very sensitive local (--very-sensitive-local)</option>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	312 </param>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	313 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	314 <when value="full">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	315 <conditional name="input_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	316 <param name="input_options_selector" type="select" label="Do you want to tweak input options?" help="See "Input Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	317 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	318 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	319 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	320 <when value="yes">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	321 <param name="skip" type="integer" min="0" value="0" label="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	322 <param name="qupto" type="integer" min="1" value="100000000" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; for default behavior (no limit) leave this value very large"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	323 <param name="trim5" type="integer" min="0" value="0" label="Trim that many bases from 5' (left) end of each read before alignment" help="-5/--trim5; default=0"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	324 <param name="trim3" type="integer" min="0" value="0" label="Trim that many bases from 3' (right) end of each read before alignment" help="-3/--trim3; default=0"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	325 <param name="qv_encoding" type="select" display="radio" label="Select quality score encoding" help="See help below for more details">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	326 <option value="--phred33" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	327 <option value="--phred64">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	328 </param>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	329 <param name="solexa_quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	330 <param name="int_quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	331 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	332 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	333 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	334 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	335 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	336 <conditional name="alignment_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	337 <param name="alignment_options_selector" type="select" label="Do you want to tweak alignment options?" help="See "Alignment Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	338 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	339 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	340 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	341 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	342 <param name="N" type="integer" min="0" max="1" value="0" label="Set the number of mismatches to be allowed in a seed alignment during multiseed alignment (see `Multiseed alignment` section of help below)" help="-N; Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity; default=0"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	343 <param name="L" type="integer" min="0" max="32" value="22" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more sensitive. Default=22"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	344 <param name="i" type="text" value="S,1,1.15" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. If the function returns a result less than 1, it is rounded up to 1. Default=`S,1,1.15`"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	345 <param name="n_ceil" type="text" value="L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. Reads exceeding this ceiling are filtered out. Default=`L,0,0.15`"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	346 <param name="dpad" type="integer" min="0" value="15" label="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	347 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	348 <param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	349 <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	350 <param name="norc" type="boolean" truevalue="--norc" falsevalue="" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	351 <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read before trying the multiseed heuristic. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	352 <conditional name="align_mode">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	353 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	354 <option value="end-to-end" selected="True">End to End (--end-to-end)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	355 <option value="local">Local (--local)</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	356 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	357 <when value="end-to-end">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	358 <param name="score_min_ete" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	359 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	360 <when value="local">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	361 <param name="score_min_loc" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	362 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	363 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	364 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	365 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	366 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	367 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	368 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	369 <conditional name="scoring_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	370 <param name="scoring_options_selector" type="select" label="Do you want to tweak scoring options?" help="See "Scoring Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	371 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	372 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	373 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	374 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	375 <param name="ma" type="integer" value="2" label="Set the match bonus" help="--ma; In `--local` mode match bonus is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in `--end-to-end` mode; Default=2"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	376 <param name="mp" type="text" value="6,2" label="Set the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers" help="--mp; A number less than or equal to `MX` and greater than or equal to `MN` is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`. Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` where Q is the Phred quality value; Default=6,2"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	377 <param name="np" type="integer" value="1" label="Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as `N`" help="--np; Default=1"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	378 <param name="rdg_read_open" type="integer" value="5" label="Set the read gap opening penalty" help="--rdg; this is the first component of --rdg flag - opening penalty; Default=5"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	379 <param name="rdg_read_extend" type="integer" value="3" label="Set the read gap extension penalty" help="--rdg; this is the second component of --rdg flag - extension penalty; Default=3"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	380 <param name="rfg_ref_open" type="integer" value="5" label="Set the reference gap opening penalty" help="--rfg; this is the first component of --rfg flag - opening penalty; Default=5"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	381 <param name="rfg_ref_extend" type="integer" value="3" label="Set the reference gap extension penalty" help="--rfg; this is the second component of --rfg flag - extension penalty; Default=3"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	382 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	383 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	384 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	385 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	386 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	387 <conditional name="reporting_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	388 <param name="reporting_options_selector" type="select" label="Do you want to use -a or -k options" help="Make sure you understand implications of setting -k and -a. See "Reporting Options" section of Help below for information on -k and -a options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	389 <option value="no" selected="true">No, do not set</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	390 <option value="k">Set -k option and enter -k value</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	391 <option value="a">Set -a option</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	392 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	393 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	394 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	395 </when>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	396 <when value="k">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	397 <param name="k" type="integer" min="1" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detailed description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	398 </when>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	399 <when value="a">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	400 <!-- do nothing here; set -a flag on the command line-->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	401 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	402 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	403 <conditional name="effort_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	404 <param name="effort_options_selector" type="select" label="Do you want to tweak effort options?" help="See "Effort Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	405 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	406 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	407 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	408 <when value="yes">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	409 <param name="D" type="integer" value="15" min="0" label="Attempt that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default=15"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	410 <param name="R" type="integer" value="2" min="0" label="Set the maximum number of times Bowtie 2 will `re-seed` reads with repetitive seeds" help="When `re-seeding`, Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default=2"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	411 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	412 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	413 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	414 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	415 </conditional>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	416
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	417 <conditional name="sam_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	418 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See "Output Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	419 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	420 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	421 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	422 <when value="yes">
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	423 <param name="no_unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	424 <param name="omit_sec_seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	425 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	426 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	427 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	428 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	429 </conditional>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	430 <conditional name="other_options">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	431 <param name="other_options_selector" type="select" label="Do you want to tweak Other Options?" help="See "Other Options" section of Help below for information">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	432 <option value="yes">Yes</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	433 <option value="no" selected="true">No</option>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	434 </param>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	435 <when value="yes">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	436 <param name="reorder" type="boolean" truevalue="--reorder" falsevalue="" label="Guarantee that output SAM records are printed in an order corresponding to the order of the reads in the original input file" help="--reorder; Default=False"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	437 <param name="seed" type="integer" value="0" min="0" label="Use this number as the seed for pseudo-random number generator" help="--seed; Default=0"/>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	438 <param name="non_deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	439 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	440 <when value="no">
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	441 <!-- do nothing -->
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	442 </when>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	443 </conditional>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	444 <param name="sam_opt" type="boolean" truevalue="true" falsevalue="false" label="Would you like the output to be a SAM file" help="By default, the output from this Bowtie2 wrapper is a sorted BAM file."/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	445 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	446 </conditional>
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	447 <param name="save_mapping_stats" type="boolean" checked="False" label="Save the bowtie2 mapping statistics to the history" />
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	448 </inputs>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	449
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	450 <!-- define outputs -->
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	451
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	452 <outputs>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	453
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	454 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" >
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	455 <filter>library['unaligned_file'] is True</filter>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	456 <actions>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	457 <conditional name="library.type">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	458 <when value="single">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	459 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	460 <option type="from_param" name="library.input_1" param_attribute="ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	461 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	462 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	463 <when value="paired">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	464 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	465 <option type="from_param" name="library.input_1" param_attribute="ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	466 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	467 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	468 <when value="paired_collection">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	469 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	470 <option type="from_param" name="library.input_1" param_attribute="forward.ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	471 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	472 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	473 </conditional>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	474 </actions>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	475 </data>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	476 <data format="fastqsanger" name="output_aligned_reads_l" label="${tool.name} on ${on_string}: aligned reads (L)" >
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	477 <filter>library['aligned_file'] is True</filter>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	478 <actions>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	479 <conditional name="library.type">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	480 <when value="single">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	481 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	482 <option type="from_param" name="library.input_1" param_attribute="ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	483 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	484 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	485 <when value="paired">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	486 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	487 <option type="from_param" name="library.input_1" param_attribute="ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	488 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	489 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	490 <when value="paired_collection">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	491 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	492 <option type="from_param" name="library.input_1" param_attribute="forward.ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	493 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	494 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	495 </conditional>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	496 </actions>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	497 </data>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	498 <data format="fastqsanger" name="output_aligned_reads_r" label="${tool.name} on ${on_string}: aligned reads (R)">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	499 <filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['aligned_file'] is True</filter>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	500 <actions>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	501 <conditional name="library.type">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	502 <when value="paired">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	503 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	504 <option type="from_param" name="library.input_2" param_attribute="ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	505 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	506 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	507 <when value="paired_collection">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	508 <action type="format">
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	509 <option type="from_param" name="library.input_1" param_attribute="reverse.ext" />
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	510 </action>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	511 </when>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	512 </conditional>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	513 </actions>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	514 </data>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	515 <data format="fastqsanger" name="output_unaligned_reads_r" label="${tool.name} on ${on_string}: unaligned reads (R)">
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	516 <filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['unaligned_file'] is True</filter>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	517 <actions>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	518 <conditional name="library.type">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	519 <when value="paired">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	520 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	521 <option type="from_param" name="library.input_2" param_attribute="ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	522 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	523 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	524 <when value="paired_collection">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	525 <action type="format">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	526 <option type="from_param" name="library.input_1" param_attribute="reverse.ext" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	527 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	528 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	529 </conditional>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	530 </actions>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	531 </data>
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	532
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	533 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads (sorted BAM)">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	534 <filter>analysis_type['analysis_type_selector'] == "simple" or analysis_type['sam_opt'] is False</filter>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	535 <actions>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	536 <conditional name="reference_genome.source">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	537 <when value="indexed">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	538 <action type="metadata" name="dbkey">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	539 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	540 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	541 <filter type="param_value" ref="reference_genome.index" column="0"/>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	542 </option>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	543 </action>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	544 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	545 <when value="history">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	546 <action type="metadata" name="dbkey">
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	547 <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" />
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	548 </action>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	549 </when>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	550 </conditional>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	551 </actions>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	552 </data>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	553
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	554 <data format="sam" name="output_sam" label="${tool.name} on ${on_string}: aligned reads (SAM)">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	555 <filter>analysis_type['analysis_type_selector'] == "full" and analysis_type['sam_opt'] is True</filter>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	556 <actions>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	557 <conditional name="reference_genome.source">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	558 <when value="indexed">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	559 <action type="metadata" name="dbkey">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	560 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	561 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	562 <filter type="param_value" ref="reference_genome.index" column="0"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	563 </option>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	564 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	565 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	566 <when value="history">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	567 <action type="metadata" name="dbkey">
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	568 <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	569 </action>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	570 </when>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	571 </conditional>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	572 </actions>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	573 </data>
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	574 <data format="txt" name="mapping_stats" label="${tool.name} on ${on_string}: mapping stats">
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	575 <filter>save_mapping_stats is True</filter>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	576 </data>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	577
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	578 </outputs>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	579
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	580 <tests>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	581 <test>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	582 <!-- basic test on single paired default run -->
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	583 <param name="type" value="paired"/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	584 <param name="selection" value="no"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	585 <param name="paired_options_selector" value="no"/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	586 <param name="unaligned_file" value="false"/>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	587 <param name="analysis_type_selector" value="simple"/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	588 <param name="source" value="history" />
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	589 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	590 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	591 <param name="own_file" value="bowtie2-ref.fasta" />
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	592 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	593 </test>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	594 <test>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	595 <!-- basic test on single paired default run -->
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	596 <param name="type" value="paired"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	597 <param name="selection" value="no"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	598 <param name="paired_options_selector" value="no"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	599 <param name="unaligned_file" value="false"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	600 <param name="analysis_type_selector" value="simple"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	601 <param name="rg_selector" value="set"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	602 <param name="ID" value="rg1"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	603 <param name="PL" value="CAPILLARY"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	604 <param name="source" value="history" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	605 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	606 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	607 <param name="own_file" value="bowtie2-ref.fasta" />
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	608 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/>
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	609 </test>
10 fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	610 <test>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	611 <!-- basic test on single paired default run with stats-->
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	612 <param name="type" value="paired"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	613 <param name="selection" value="no"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	614 <param name="paired_options_selector" value="no"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	615 <param name="unaligned_file" value="false"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	616 <param name="analysis_type_selector" value="simple"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	617 <param name="source" value="history" />
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	618 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	619 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	620 <param name="own_file" value="bowtie2-ref.fasta" />
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	621 <param name="save_mapping_stats" value="true" />
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	622 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	623 <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/>
fed480fea9f0 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit de7140295cce07e1bc1697e51dab4271c8d7a8a6 devteam parents: 8 diff changeset	624 </test>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	625 </tests>
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	626
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	627 <help><![CDATA[
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	628
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	629 Bowtie2 Overview
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	630
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	631 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	632 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	633
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	634 .. _Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	635 .. _`Bowtie2 manual`: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	636 .. _`BAM format`: http://samtools.github.io/hts-specs/SAMv1.pdf
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	637
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	638 -----
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	639
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	640 Selecting reference genomes for Bowtie2
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	641
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	642 Galaxy wrapper for Bowtie2 allows you select between precomputed and user-defined indices for reference genomes using Will you select a reference genome from your history or use a built-in index? flag. This flag has two options:
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	643
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	644 1. Use a built-in genome index - when selected (this is default), Galaxy provides the user with Select reference genome index dropdown. Genomes listed in this dropdown have been pre-indexed with bowtie2-build utility and are ready to be mapped against.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	645 2. Use a genome from the history and build index - when selected, Galaxy provides the user with Select reference genome sequence dropdown. This dropdown is populated by all FASTA formatted files listed in your current history. If your genome of interest is uploaded into history it will be shown there. Selecting a genome from this dropdown will cause Galaxy to first transparently index it using bowtie2-build command, and then run mapping with bowtie2.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	646
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	647 If your genome of interest is not listed here you have two choices:
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	648
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	649 1. Contact galaxy team using Help->Support link at the top of the interface and let us know that an index needs to be added
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	650 2. Upload your genome of interest as a FASTA file to Galaxy history and selected Use a genome from the history and build index option.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	651
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	652 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	653
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	654 .. class:: infomark
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	655
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	656 Bowtie2 options
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	657
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	658 Galaxy wrapper for Bowtie2 implements most but not all options available through the command line. Supported options are described below.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	659
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	660 -----
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	661
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	662 Inputs
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	663
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	664 Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files.
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	665
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	666 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	667
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	668 Input options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	669
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	670 -s/--skip <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	671 Skip (i.e. do not align) the first `<int>` reads or pairs in the input.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	672
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	673 -u/--qupto <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	674 Align the first `<int>` reads or read pairs from the input (after the
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	675 `-s`/`--skip` reads or pairs have been skipped), then stop. Default: no limit.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	676
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	677 -5/--trim5 <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	678 Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0).
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	679
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	680 -3/--trim3 <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	681 Trim `<int>` bases from 3' (right) end of each read before alignment (default: 0).
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	682
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	683 --phred33
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	684 Input qualities are ASCII chars equal to the Phred quality plus 33. This is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	685 also called the "Phred+33" encoding, which is used by the very latest Illumina
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	686 pipelines.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	687
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	688 --phred64
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	689 Input qualities are ASCII chars equal to the Phred quality plus 64. This is
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	690 also called the "Phred+64" encoding.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	691
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	692 --solexa-quals
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	693 Convert input qualities from Solexa Phred quality (which can be negative) to
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	694 Phred Phred quality (which can't). This scheme was used in older Illumina GA
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	695 Pipeline versions (prior to 1.3). Default: off.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	696
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	697 --int-quals
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	698 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	699 Integers are treated as being on the Phred quality scale unless
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	700 `--solexa-quals` is also specified. Default: off.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	701
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	702 ------
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	703
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	704 Presets in `--end-to-end` mode::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	705
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	706 --very-fast
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	707 Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	708
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	709 --fast
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	710 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50`
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	711
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	712 --sensitive
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	713 Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode)
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	714
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	715 --very-sensitive
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	716 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	717
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	718 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	719
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	720 Presets options in `--local` mode::
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	721
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	722 --very-fast-local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	723 Same as: `-D 5 -R 1 -N 0 -L 25 -i S,1,2.00`
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	724
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	725 --fast-local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	726 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,1,1.75`
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	727
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	728 --sensitive-local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	729 Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode)
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	730
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	731 --very-sensitive-local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	732 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	733
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	734 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	735
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	736 Alignment options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	737
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	738 -N <int>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	739 Sets the number of mismatches to allowed in a seed alignment during multiseed
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	740 alignment. Can be set to 0 or 1. Setting this higher makes alignment slower
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	741 (often much slower) but increases sensitivity. Default: 0.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	742
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	743 -L <int>
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	744 Sets the length of the seed substrings to align during multiseed alignment.
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	745 Smaller values make alignment slower but more sensitive. Default: the
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	746 `--sensitive` preset is used by default, which sets `-L` to 22 in
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	747 `--end-to-end` mode and to 20 in `--local` mode.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	748
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	749 -i <func>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	750 Sets a function governing the interval between seed substrings to use during
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	751 multiseed alignment. For instance, if the read has 30 characers, and seed
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	752 length is 10, and the seed interval is 6, the seeds extracted will be:
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	753
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	754 Read: TAGCTACGCTCTACGCTATCATGCATAAAC
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	755 Seed 1 fw: TAGCTACGCT
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	756 Seed 1 rc: AGCGTAGCTA
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	757 Seed 2 fw: CGCTCTACGC
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	758 Seed 2 rc: GCGTAGAGCG
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	759 Seed 3 fw: ACGCTATCAT
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	760 Seed 3 rc: ATGATAGCGT
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	761 Seed 4 fw: TCATGCATAA
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	762 Seed 4 rc: TTATGCATGA
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	763
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	764 Since it's best to use longer intervals for longer reads, this parameter sets
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	765 the interval as a function of the read length, rather than a single
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	766 one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	767 interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length.
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	768 If the function returns a result less than
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	769 1, it is rounded up to 1. Default: the `--sensitive` preset is used by
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	770 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	771 in `--local` mode.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	772
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	773 --n-ceil <func>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	774 Sets a function governing the maximum number of ambiguous characters (usually
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	775 `N`s and/or `.`s) allowed in a read as a function of read length. For instance,
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	776 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	777 where x is the read length. Reads exceeding this ceiling are filtered out.
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	778 Default: `L,0,0.15`.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	779
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	780 --dpad <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	781 "Pads" dynamic programming problems by `<int>` columns on either side to allow
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	782 gaps. Default: 15.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	783
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	784 --gbar <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	785 Disallow gaps within `<int>` positions of the beginning or end of the read.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	786 Default: 4.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	787
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	788 --ignore-quals
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	789 When calculating a mismatch penalty, always consider the quality value at the
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	790 mismatched position to be the highest possible, regardless of the actual value.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	791 I.e. input is treated as though all quality values are high. This is also the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	792 default behavior when the input doesn't specify quality values (e.g. in `-f`,
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	793 `-r`, or `-c` modes).
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	794
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	795 --nofw/--norc
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	796 If `--nofw` is specified, `bowtie2` will not attempt to align unpaired reads to
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	797 the forward (Watson) reference strand. If `--norc` is specified, `bowtie2` will
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	798 not attempt to align unpaired reads against the reverse-complement (Crick)
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	799 reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	800 fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	801 paired-end configurations corresponding to fragments from the reverse-complement
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	802 (Crick) strand. Default: both strands enabled.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	803
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	804 --no-1mm-upfront
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	805 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	806 end-to-end alignment for the read before trying the multiseed heuristic. Such
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	807 alignments can be found very quickly, and many short read alignments have exact or
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	808 near-exact end-to-end alignments. However, this can lead to unexpected
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	809 alignments when the user also sets options governing the multiseed heuristic,
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	810 like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	811 to the length of the read, the user will be surprised to find 1-mismatch alignments
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	812 reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	813 alignments before using the multiseed heuristic, which leads to the expected
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	814 behavior when combined with options such as `-L` and `-N`. This comes at the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	815 expense of speed.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	816
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	817 --end-to-end
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	818 In this mode, Bowtie 2 requires that the entire read align from one end to the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	819 other, without any trimming (or "soft clipping") of characters from either end.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	820 The match bonus `--ma` always equals 0 in this mode, so all alignment scores
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	821 are less than or equal to 0, and the greatest possible alignment score is 0.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	822 This is mutually exclusive with `--local`. `--end-to-end` is the default mode.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	823
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	824 --local
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	825 In this mode, Bowtie 2 does not require that the entire read align from one end
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	826 to the other. Rather, some characters may be omitted ("soft clipped") from the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	827 ends in order to achieve the greatest possible alignment score. The match bonus
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	828 `--ma` is used in this mode, and the best possible alignment score is equal to
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	829 the match bonus (`--ma`) times the length of the read. Specifying `--local`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	830 and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	831 the local version of the preset (`--very-fast-local`). This is mutually
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	832 exclusive with `--end-to-end`. `--end-to-end` is the default mode.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	833
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	834 -----
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	835
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	836 Scoring options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	837
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	838 --ma <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	839 Sets the match bonus. In `--local` mode `<int>` is added to the alignment
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	840 score for each position where a read character aligns to a reference character
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	841 and the characters match. Not used in `--end-to-end` mode. Default: 2.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	842
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	843 --mp MX,MN
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	844 Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	845 number less than or equal to `MX` and greater than or equal to `MN` is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	846 subtracted from the alignment score for each position where a read character
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	847 aligns to a reference character, the characters do not match, and neither is an
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	848 `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	849 Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	850 where Q is the Phred quality value. Default: `MX` = 6, `MN` = 2.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	851
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	852 --np <int>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	853 Sets penalty for positions where the read, reference, or both, contain an
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	854 ambiguous character such as `N`. Default: 1.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	855
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	856 --rdg <int1>,<int2>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	857 Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties. A read gap of
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	858 length N gets a penalty of `<int1>` + N * `<int2>`. Default: 5, 3.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	859
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	860 --rfg <int1>,<int2>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	861 Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties. A
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	862 reference gap of length N gets a penalty of `<int1>` + N * `<int2>`. Default:
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	863 5, 3.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	864
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	865 --score-min <func>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	866 Sets a function governing the minimum alignment score needed for an alignment to
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	867 be considered "valid" (i.e. good enough to report). This is a function of read
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	868 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	869 to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	870 the default in `--local` mode is `G,20,8`.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	871
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	872 -----
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	873
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	874 Reporting options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	875
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	876 -k <int>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	877 By default, `bowtie2` searches for distinct, valid alignments for each read.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	878 When it finds a valid alignment, it continues looking for alignments that are
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	879 nearly as good or better. The best alignment found is reported (randomly
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	880 selected from among best if tied). Information about the best alignments is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	881 used to estimate mapping quality and to set SAM optional fields, such as
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	882 `AS:i` and `XS:i`.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	883
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	884 When `-k` is specified, however, `bowtie2` behaves differently. Instead, it
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	885 searches for at most `<int>` distinct, valid alignments for each read. The
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	886 search terminates when it can't find more distinct valid alignments, or when it
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	887 finds `<int>`, whichever happens first. All alignments found are reported in
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	888 descending order by alignment score. The alignment score for a paired-end
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	889 alignment equals the sum of the alignment scores of the individual mates. Each
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	890 reported read or pair alignment beyond the first has the SAM 'secondary' bit
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	891 (which equals 256) set in its FLAGS field. For reads that have more than
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	892 `<int>` distinct, valid alignments, `bowtie2` does not guarantee that the
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	893 `<int>` alignments reported are the best possible in terms of alignment score.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	894 `-k` is mutually exclusive with `-a`.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	895
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	896 Note: Bowtie 2 is not designed with large values for `-k` in mind, and when
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	897 aligning reads to long, repetitive genomes large `-k` can be very, very slow.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	898
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	899 -a
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	900 Like `-k` but with no upper limit on number of alignments to search for. `-a`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	901 is mutually exclusive with `-k`.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	902
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	903 Note: Bowtie 2 is not designed with `-a` mode in mind, and when
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	904 aligning reads to long, repetitive genomes this mode can be very, very slow.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	905
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	906 -----
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	907
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	908 Effort options::
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	909
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	910 -D <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	911 Up to `<int>` consecutive seed extension attempts can "fail" before Bowtie 2
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	912 moves on, using the alignments found so far. A seed extension "fails" if it
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	913 does not yield a new best or a new second-best alignment. This limit is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	914 automatically adjusted up when -k or -a are specified. Default: 15.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	915
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	916 -R <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	917 `<int>` is the maximum number of times Bowtie 2 will "re-seed" reads with
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	918 repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	919 (same length, same number of mismatches allowed) at different offsets and
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	920 searches for more alignments. A read is considered to have repetitive seeds if
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	921 the total number of seed hits divided by the number of seeds that aligned at
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	922 least once is greater than 300. Default: 2.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	923
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	924 -----
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	925
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	926 Paired-end options::
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	927
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	928 -I/--minins <int>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	929 The minimum fragment length for valid paired-end alignments. E.g. if `-I 60` is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	930 specified and a paired-end alignment consists of two 20-bp alignments in the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	931 appropriate orientation with a 20-bp gap between them, that alignment is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	932 considered valid (as long as `-X` is also satisfied). A 19-bp gap would not
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	933 be valid in that case. If trimming options `-3` or `-5` are also used, the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	934 `-I` constraint is applied with respect to the untrimmed mates.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	935
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	936 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	937 run. This is because larger differences bewteen `-I` and `-X` require that
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	938 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	939 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	940 efficient.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	941
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	942 Default: 0 (essentially imposing no minimum)
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	943
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	944 -X/--maxins <int>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	945 The maximum fragment length for valid paired-end alignments. E.g. if `-X 100`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	946 is specified and a paired-end alignment consists of two 20-bp alignments in the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	947 proper orientation with a 60-bp gap between them, that alignment is considered
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	948 valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	949 that case. If trimming options `-3` or `-5` are also used, the `-X`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	950 constraint is applied with respect to the untrimmed mates, not the trimmed
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	951 mates.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	952
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	953 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	954 run. This is because larger differences bewteen `-I` and `-X` require that
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	955 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	956 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	957 efficient.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	958
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	959 Default: 500.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	960
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	961 --fr/--rf/--ff
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	962 The upstream/downstream mate orientations for a valid paired-end alignment
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	963 against the forward reference strand. E.g., if `--fr` is specified and there is
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	964 a candidate paired-end alignment where mate 1 appears upstream of the reverse
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	965 complement of mate 2 and the fragment length constraints (`-I` and `-X`) are
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	966 met, that alignment is valid. Also, if mate 2 appears upstream of the reverse
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	967 complement of mate 1 and all other constraints are met, that too is valid.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	968 `--rf` likewise requires that an upstream mate1 be reverse-complemented and a
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	969 downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	970 and a downstream mate 2 to be forward-oriented. Default: `--fr` (appropriate
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	971 for Illumina's Paired-end Sequencing Assay).
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	972
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	973 --no-mixed
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	974 By default, when `bowtie2` cannot find a concordant or discordant alignment for
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	975 a pair, it then tries to find alignments for the individual mates. This option
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	976 disables that behavior.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	977
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	978 --no-discordant
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	979 By default, `bowtie2` looks for discordant alignments if it cannot find any
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	980 concordant alignments. A discordant alignment is an alignment where both mates
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	981 align uniquely, but that does not satisfy the paired-end constraints
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	982 (`--fr`/`--rf`/`--ff`, `-I`, `-X`). This option disables that behavior.
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	983
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	984 --dovetail
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	985 If the mates "dovetail", that is if one mate alignment extends past the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	986 beginning of the other such that the wrong mate begins upstream, consider that
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	987 to be concordant. Default: mates cannot dovetail in a concordant alignment.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	988
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	989 --no-contain
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	990 If one mate alignment contains the other, consider that to be non-concordant.
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	991 Default: a mate can contain the other in a concordant alignment.
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	992
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	993 --no-overlap
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	994 If one mate alignment overlaps the other at all, consider that to be
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	995 non-concordant. Default: mates can overlap in a concordant alignment.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	996
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	997 ------
a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	998
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	999 SAM options::
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1000
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1001 --rg-id <text>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1002 Set the read group ID to `<text>`. This causes the SAM `@RG` header line to be
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1003 printed, with `<text>` as the value associated with the `ID:` tag. It also
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1004 causes the `RG:Z:` extra field to be attached to each SAM output record, with
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1005 value set to `<text>`.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1006
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1007 --rg <text>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1008 Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1009 `@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id`
5 5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1010 must also be specified. This is because the `ID` tag is required by the SAM
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1011 Specification. Specify `--rg` multiple times to set multiple fields. See the
5cfa4b6db588 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 devteam parents: 2 diff changeset	1012 SAM Specification for details about what fields are legal.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1013
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1014 --omit-sec-seq
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1015 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1016 and `QUAL` strings. Specifying this option causes Bowtie 2 to print an asterix
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1017 in those fields instead.
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1018
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1019 -----
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1020
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1021 Other options::
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1022
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1023 --reorder
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1024 Guarantees that output SAM records are printed in an order corresponding to the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1025 order of the reads in the original input file, even when `-p` is set greater
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1026 than 1. Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1027 2 to run somewhat slower and use somewhat more memory then if `--reorder` were
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1028 not specified. Has no effect if `-p` is set to 1, since output order will
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1029 naturally correspond to input order in that case.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1030
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1031 --seed <int>
fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1032 Use `<int>` as the seed for pseudo-random number generator. Default: 0.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1033
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1034 --non-deterministic
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1035 Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1036 seeds the generator with a number derived from (a) the read name, (b) the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1037 nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed`
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1038 option. This means that if two reads are identical (same name, same
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1039 nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s)
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1040 for both, even if there was ambiguity. When `--non-deterministic` is specified,
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1041 Bowtie 2 re-initializes its pseudo-random generator for each read using the
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1042 current time. This means that Bowtie 2 will not necessarily report the same
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1043 alignment for two identical reads. This is counter-intuitive for some users,
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1044 but might be more appropriate in situations where the input consists of many
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1045 identical reads.
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1046
11 fa69d5a7b8c8 planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd devteam parents: 10 diff changeset	1047 ]]></help>
2 2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1048 <citations>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1049 <citation type="doi">10.1186/gb-2009-10-3-r25</citation>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1050 <citation type="doi">10.1038/nmeth.1923</citation>
2a6cfe8997aa Uploaded from GH devteam parents: 1 diff changeset	1051 </citations>
0 a03a7ee6cdff Imported from capsule None devteam parents: diff changeset	1052 </tool>

Mercurial > repos > devteam > bowtie2

annotate bowtie2_wrapper.xml @ 13:55dcd6aad1ab draft