|
0
|
1
|
|
|
2 Primer name 18
|
|
|
3 Amplimer 1
|
|
|
4 Sequence: CP000967
|
|
|
5
|
|
|
6 GATGGACCGGGTAAAAACCT hits forward strand at 117992 with 0 mismatches
|
|
|
7 TCGAAGTTGTCGTAGCTCCA hits reverse strand at [5121883] with 0 mismatches
|
|
|
8 Amplimer length: 202 bp
|
|
|
9
|
|
|
10 Primer name 19
|
|
|
11 Amplimer 1
|
|
|
12 Sequence: CP000967
|
|
|
13
|
|
|
14 AGATGGACCGGGTAAAAACC hits forward strand at 117991 with 0 mismatches
|
|
|
15 TCGAAGTTGTCGTAGCTCCA hits reverse strand at [5121883] with 0 mismatches
|
|
|
16 Amplimer length: 203 bp
|
|
|
17
|
|
|
18 Primer name 20
|
|
|
19 Amplimer 1
|
|
|
20 Sequence: CP000967
|
|
|
21
|
|
|
22 TCAATCAAGTGCGCTGCTAT hits forward strand at 3269992 with 0 mismatches
|
|
|
23 CGGCTACTACATTGGCAGGT hits reverse strand at [1969885] with 0 mismatches
|
|
|
24 Amplimer length: 200 bp
|
|
|
25
|
|
|
26 Primer name 21
|
|
|
27 Amplimer 1
|
|
|
28 Sequence: CP000967
|
|
|
29
|
|
|
30 ATCAATCAAGTGCGCTGCTA hits forward strand at 3269991 with 0 mismatches
|
|
|
31 CGGCTACTACATTGGCAGGT hits reverse strand at [1969885] with 0 mismatches
|
|
|
32 Amplimer length: 201 bp
|
|
|
33
|
|
|
34 Primer name 22
|
|
|
35 Amplimer 1
|
|
|
36 Sequence: CP000967
|
|
|
37
|
|
|
38 GTACAGATCGCCGAGCACTT hits forward strand at 1180498 with 0 mismatches
|
|
|
39 CCAATCCAGACTTGCGCTAT hits reverse strand at [4059377] with 0 mismatches
|
|
|
40 Amplimer length: 202 bp
|
|
|
41
|
|
|
42 Primer name 23
|
|
|
43 Amplimer 1
|
|
|
44 Sequence: CP000967
|
|
|
45
|
|
|
46 GTACAGATCGCCGAGCACTT hits forward strand at 1180498 with 0 mismatches
|
|
|
47 CAATCCAGACTTGCGCTATG hits reverse strand at [4059378] with 0 mismatches
|
|
|
48 Amplimer length: 201 bp
|
|
|
49
|
|
|
50 Primer name 30
|
|
|
51 Amplimer 1
|
|
|
52 Sequence: CP000967
|
|
|
53
|
|
|
54 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
55 GCTGGATTTTTGTTGCAGTC hits reverse strand at [5100760] with 0 mismatches
|
|
|
56 Amplimer length: 206 bp
|
|
|
57 Amplimer 2
|
|
|
58 Sequence: CP000967
|
|
|
59
|
|
|
60 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
61 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3850284] with 0 mismatches
|
|
|
62 Amplimer length: 1250682 bp
|
|
|
63 Amplimer 3
|
|
|
64 Sequence: CP000967
|
|
|
65
|
|
|
66 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
67 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3679829] with 0 mismatches
|
|
|
68 Amplimer length: 1421137 bp
|
|
|
69 Amplimer 4
|
|
|
70 Sequence: CP000967
|
|
|
71
|
|
|
72 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
73 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3511484] with 0 mismatches
|
|
|
74 Amplimer length: 1589482 bp
|
|
|
75 Amplimer 5
|
|
|
76 Sequence: CP000967
|
|
|
77
|
|
|
78 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
79 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3143025] with 0 mismatches
|
|
|
80 Amplimer length: 1957941 bp
|
|
|
81 Amplimer 6
|
|
|
82 Sequence: CP000967
|
|
|
83
|
|
|
84 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
85 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3141976] with 0 mismatches
|
|
|
86 Amplimer length: 1958990 bp
|
|
|
87 Amplimer 7
|
|
|
88 Sequence: CP000967
|
|
|
89
|
|
|
90 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
91 GCTGGATTTTTGTTGCAGTC hits reverse strand at [2814761] with 0 mismatches
|
|
|
92 Amplimer length: 2286205 bp
|
|
|
93 Amplimer 8
|
|
|
94 Sequence: CP000967
|
|
|
95
|
|
|
96 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
97 GCTGGATTTTTGTTGCAGTC hits reverse strand at [2529194] with 0 mismatches
|
|
|
98 Amplimer length: 2571772 bp
|
|
|
99 Amplimer 9
|
|
|
100 Sequence: CP000967
|
|
|
101
|
|
|
102 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
103 GCTGGATTTTTGTTGCAGTC hits reverse strand at [2317107] with 0 mismatches
|
|
|
104 Amplimer length: 2783859 bp
|
|
|
105 Amplimer 10
|
|
|
106 Sequence: CP000967
|
|
|
107
|
|
|
108 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
109 GCTGGATTTTTGTTGCAGTC hits reverse strand at [1973706] with 0 mismatches
|
|
|
110 Amplimer length: 3127260 bp
|
|
|
111 Amplimer 11
|
|
|
112 Sequence: CP000967
|
|
|
113
|
|
|
114 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
115 GCTGGATTTTTGTTGCAGTC hits reverse strand at [1742289] with 0 mismatches
|
|
|
116 Amplimer length: 3358677 bp
|
|
|
117 Amplimer 12
|
|
|
118 Sequence: CP000967
|
|
|
119
|
|
|
120 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
121 GCTGGATTTTTGTTGCAGTC hits reverse strand at [1702515] with 0 mismatches
|
|
|
122 Amplimer length: 3398451 bp
|
|
|
123 Amplimer 13
|
|
|
124 Sequence: CP000967
|
|
|
125
|
|
|
126 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
127 GCTGGATTTTTGTTGCAGTC hits reverse strand at [164617] with 0 mismatches
|
|
|
128 Amplimer length: 4936349 bp
|
|
|
129 Amplimer 14
|
|
|
130 Sequence: CP000967
|
|
|
131
|
|
|
132 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
133 GCTGGATTTTTGTTGCAGTC hits reverse strand at [76745] with 0 mismatches
|
|
|
134 Amplimer length: 5024221 bp
|
|
|
135
|
|
|
136 Primer name 31
|
|
|
137 Amplimer 1
|
|
|
138 Sequence: CP000967
|
|
|
139
|
|
|
140 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
141 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [5100759] with 0 mismatches
|
|
|
142 Amplimer length: 207 bp
|
|
|
143 Amplimer 2
|
|
|
144 Sequence: CP000967
|
|
|
145
|
|
|
146 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
147 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3850283] with 0 mismatches
|
|
|
148 Amplimer length: 1250683 bp
|
|
|
149 Amplimer 3
|
|
|
150 Sequence: CP000967
|
|
|
151
|
|
|
152 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
153 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3679828] with 0 mismatches
|
|
|
154 Amplimer length: 1421138 bp
|
|
|
155 Amplimer 4
|
|
|
156 Sequence: CP000967
|
|
|
157
|
|
|
158 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
159 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3511483] with 0 mismatches
|
|
|
160 Amplimer length: 1589483 bp
|
|
|
161 Amplimer 5
|
|
|
162 Sequence: CP000967
|
|
|
163
|
|
|
164 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
165 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3143024] with 0 mismatches
|
|
|
166 Amplimer length: 1957942 bp
|
|
|
167 Amplimer 6
|
|
|
168 Sequence: CP000967
|
|
|
169
|
|
|
170 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
171 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3141975] with 0 mismatches
|
|
|
172 Amplimer length: 1958991 bp
|
|
|
173 Amplimer 7
|
|
|
174 Sequence: CP000967
|
|
|
175
|
|
|
176 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
177 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2814760] with 0 mismatches
|
|
|
178 Amplimer length: 2286206 bp
|
|
|
179 Amplimer 8
|
|
|
180 Sequence: CP000967
|
|
|
181
|
|
|
182 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
183 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2529193] with 0 mismatches
|
|
|
184 Amplimer length: 2571773 bp
|
|
|
185 Amplimer 9
|
|
|
186 Sequence: CP000967
|
|
|
187
|
|
|
188 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
189 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2317106] with 0 mismatches
|
|
|
190 Amplimer length: 2783860 bp
|
|
|
191 Amplimer 10
|
|
|
192 Sequence: CP000967
|
|
|
193
|
|
|
194 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
195 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1973705] with 0 mismatches
|
|
|
196 Amplimer length: 3127261 bp
|
|
|
197 Amplimer 11
|
|
|
198 Sequence: CP000967
|
|
|
199
|
|
|
200 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
201 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1742288] with 0 mismatches
|
|
|
202 Amplimer length: 3358678 bp
|
|
|
203 Amplimer 12
|
|
|
204 Sequence: CP000967
|
|
|
205
|
|
|
206 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
207 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1702514] with 0 mismatches
|
|
|
208 Amplimer length: 3398452 bp
|
|
|
209 Amplimer 13
|
|
|
210 Sequence: CP000967
|
|
|
211
|
|
|
212 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
213 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [164616] with 0 mismatches
|
|
|
214 Amplimer length: 4936350 bp
|
|
|
215 Amplimer 14
|
|
|
216 Sequence: CP000967
|
|
|
217
|
|
|
218 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
|
|
|
219 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [76744] with 0 mismatches
|
|
|
220 Amplimer length: 5024222 bp
|
|
|
221
|
|
|
222 Primer name 32
|
|
|
223 Amplimer 1
|
|
|
224 Sequence: CP000967
|
|
|
225
|
|
|
226 ATCTGTCCGGGTTGGACTC hits forward strand at 1212161 with 0 mismatches
|
|
|
227 GGTCTTGAGCACTTCCGAAC hits reverse strand at [4027716] with 0 mismatches
|
|
|
228 Amplimer length: 200 bp
|
|
|
229
|
|
|
230 Primer name 33
|
|
|
231 Amplimer 1
|
|
|
232 Sequence: CP000967
|
|
|
233
|
|
|
234 CAGATCATGTACCCGGTGCT hits forward strand at 1212445 with 0 mismatches
|
|
|
235 GCATCGCTGATGAAGTCGTA hits reverse strand at [4027423] with 0 mismatches
|
|
|
236 Amplimer length: 209 bp
|
|
|
237
|
|
|
238 Primer name 34
|
|
|
239 Amplimer 1
|
|
|
240 Sequence: CP000967
|
|
|
241
|
|
|
242 CAGTAGCAACCCCTTCAGGT hits forward strand at 178116 with 0 mismatches
|
|
|
243 CGTTCGGGTTCTTAGTTCCA hits reverse strand at [5061759] with 0 mismatches
|
|
|
244 Amplimer length: 202 bp
|
|
|
245 Amplimer 2
|
|
|
246 Sequence: CP000967
|
|
|
247
|
|
|
248 CAGTAGCAACCCCTTCAGGT hits forward strand at 115447 with 0 mismatches
|
|
|
249 CGTTCGGGTTCTTAGTTCCA hits reverse strand at [5061759] with 0 mismatches
|
|
|
250 Amplimer length: 62871 bp
|
|
|
251
|
|
|
252 Primer name 36
|
|
|
253 Amplimer 1
|
|
|
254 Sequence: CP000967
|
|
|
255
|
|
|
256 GGACAGCCCTGTATGGAAAA hits forward strand at 2282909 with 0 mismatches
|
|
|
257 TGGAAGAAGCAGTTGCCAGT hits reverse strand at [2956968] with 0 mismatches
|
|
|
258 Amplimer length: 200 bp
|
|
|
259
|
|
|
260 Primer name 37
|
|
|
261 Amplimer 1
|
|
|
262 Sequence: CP000967
|
|
|
263
|
|
|
264 GGACAGCCCTGTATGGAAAA hits forward strand at 2282909 with 0 mismatches
|
|
|
265 GGAGCTGACTGGAAGAAGCA hits reverse strand at [2956959] with 0 mismatches
|
|
|
266 Amplimer length: 209 bp
|
|
|
267
|
|
|
268 Primer name 38
|
|
|
269 Amplimer 1
|
|
|
270 Sequence: CP000967
|
|
|
271
|
|
|
272 AAGCAGGTCTGGAACACCAC hits forward strand at 2284341 with 0 mismatches
|
|
|
273 GGAGTGCGTTAAAGCAGGTG hits reverse strand at [2955531] with 0 mismatches
|
|
|
274 Amplimer length: 205 bp
|
|
|
275
|
|
|
276 Primer name 40
|
|
|
277 Amplimer 1
|
|
|
278 Sequence: CP000967
|
|
|
279
|
|
|
280 GCTTTGACCTTGTGGTCCAT hits forward strand at 2287923 with 0 mismatches
|
|
|
281 CCAGATCAGCGTCAGTGGTA hits reverse strand at [2951941] with 0 mismatches
|
|
|
282 Amplimer length: 213 bp
|
|
|
283
|
|
|
284 Primer name 41
|
|
|
285 Amplimer 1
|
|
|
286 Sequence: CP000967
|
|
|
287
|
|
|
288 CAAATGAGACGTCTGCGGTA hits forward strand at 2288283 with 0 mismatches
|
|
|
289 TGCCTTTGTAGCACTGTGGA hits reverse strand at [2951589] with 0 mismatches
|
|
|
290 Amplimer length: 205 bp
|
|
|
291
|
|
|
292 Primer name 42
|
|
|
293 Amplimer 1
|
|
|
294 Sequence: CP000967
|
|
|
295
|
|
|
296 CGTCATCAAACCAGACCTGA hits forward strand at 2289726 with 0 mismatches
|
|
|
297 TGGACTAGAAGCGCCTTGAT hits reverse strand at [2950147] with 0 mismatches
|
|
|
298 Amplimer length: 204 bp
|
|
|
299
|
|
|
300 Primer name 43
|
|
|
301 Amplimer 1
|
|
|
302 Sequence: CP000967
|
|
|
303
|
|
|
304 AAACGCTAAGCCGGTACTGA hits forward strand at 2289795 with 0 mismatches
|
|
|
305 GTGATGATGTCGAGCGTGTC hits reverse strand at [2950069] with 0 mismatches
|
|
|
306 Amplimer length: 213 bp
|
|
|
307
|
|
|
308 Primer name 44
|
|
|
309 Amplimer 1
|
|
|
310 Sequence: CP000967
|
|
|
311
|
|
|
312 CTGAAGGCAACGTTCTGCTA hits forward strand at 2290117 with 0 mismatches
|
|
|
313 GTCTCCCATTTGCCCTGAT hits reverse strand at [2949757] with 0 mismatches
|
|
|
314 Amplimer length: 203 bp
|
|
|
315
|
|
|
316 Primer name 45
|
|
|
317 Amplimer 1
|
|
|
318 Sequence: CP000967
|
|
|
319
|
|
|
320 GAAGGCAACGTTCTGCTACG hits forward strand at 2290119 with 0 mismatches
|
|
|
321 GTCTCCCATTTGCCCTGAT hits reverse strand at [2949757] with 0 mismatches
|
|
|
322 Amplimer length: 201 bp
|
|
|
323
|
|
|
324 Primer name 46
|
|
|
325 Amplimer 1
|
|
|
326 Sequence: CP000967
|
|
|
327
|
|
|
328 CGCAAGGTATCCAGTTCCTG hits forward strand at 2293873 with 0 mismatches
|
|
|
329 GGACCTCAGTGAAGGAGCAG hits reverse strand at [2945969] with 0 mismatches
|
|
|
330 Amplimer length: 235 bp
|
|
|
331
|
|
|
332 Primer name 47
|
|
|
333 Amplimer 1
|
|
|
334 Sequence: CP000967
|
|
|
335
|
|
|
336 GGTATCCAGTTCCTGCTGCT hits forward strand at 2293878 with 0 mismatches
|
|
|
337 AGCACTACCGGACCTCAGTG hits reverse strand at [2945960] with 0 mismatches
|
|
|
338 Amplimer length: 239 bp
|
|
|
339
|
|
|
340 Primer name 48
|
|
|
341 Amplimer 1
|
|
|
342 Sequence: CP000967
|
|
|
343
|
|
|
344 CGCAGCTGGTATGGATTTCT hits forward strand at 2296700 with 0 mismatches
|
|
|
345 ATCACAGCGCACAGCATAAG hits reverse strand at [2943175] with 0 mismatches
|
|
|
346 Amplimer length: 202 bp
|
|
|
347
|
|
|
348 Primer name 49
|
|
|
349 Amplimer 1
|
|
|
350 Sequence: CP000967
|
|
|
351
|
|
|
352 CGGACATGTACGACGAGTTG hits forward strand at 2296936 with 0 mismatches
|
|
|
353 GACTCCCAAACCTGGAACAA hits reverse strand at [2942936] with 0 mismatches
|
|
|
354 Amplimer length: 205 bp
|
|
|
355
|
|
|
356 Primer name 50
|
|
|
357 Amplimer 1
|
|
|
358 Sequence: CP000967
|
|
|
359
|
|
|
360 GTCACGATCCCGAATCAATC hits forward strand at 2299531 with 0 mismatches
|
|
|
361 GACAGTTCTTCGGCGTTCTC hits reverse strand at [2940346] with 0 mismatches
|
|
|
362 Amplimer length: 200 bp
|
|
|
363
|
|
|
364 Primer name 51
|
|
|
365 Amplimer 1
|
|
|
366 Sequence: CP000967
|
|
|
367
|
|
|
368 TGGCGACTATGTCGGATGTA hits forward strand at 2303661 with 0 mismatches
|
|
|
369 GATGGTAGCGCGATGACTTT hits reverse strand at [2936216] with 0 mismatches
|
|
|
370 Amplimer length: 200 bp
|
|
|
371
|
|
|
372 Primer name 59
|
|
|
373 Amplimer 1
|
|
|
374 Sequence: CP000967
|
|
|
375
|
|
|
376 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
|
|
|
377 CATGCTCTGCGACGTAAAGA hits reverse strand at [1858272] with 0 mismatches
|
|
|
378 Amplimer length: 201 bp
|
|
|
379 Amplimer 2
|
|
|
380 Sequence: CP000967
|
|
|
381
|
|
|
382 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
|
|
|
383 CATGCTCTGCGACGTAAAGA hits reverse strand at [1532947] with 0 mismatches
|
|
|
384 Amplimer length: 325526 bp
|
|
|
385 Amplimer 3
|
|
|
386 Sequence: CP000967
|
|
|
387
|
|
|
388 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
|
|
|
389 CATGCTCTGCGACGTAAAGA hits reverse strand at [1523620] with 0 mismatches
|
|
|
390 Amplimer length: 334853 bp
|
|
|
391 Amplimer 4
|
|
|
392 Sequence: CP000967
|
|
|
393
|
|
|
394 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
|
|
|
395 CATGCTCTGCGACGTAAAGA hits reverse strand at [851396] with 0 mismatches
|
|
|
396 Amplimer length: 1007077 bp
|
|
|
397 Amplimer 5
|
|
|
398 Sequence: CP000967
|
|
|
399
|
|
|
400 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
|
|
|
401 CATGCTCTGCGACGTAAAGA hits reverse strand at [817783] with 0 mismatches
|
|
|
402 Amplimer length: 1040690 bp
|
|
|
403 Amplimer 6
|
|
|
404 Sequence: CP000967
|
|
|
405
|
|
|
406 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
|
|
|
407 CATGCTCTGCGACGTAAAGA hits reverse strand at [219270] with 0 mismatches
|
|
|
408 Amplimer length: 1639203 bp
|
|
|
409
|
|
|
410 Primer name 60
|
|
|
411 Amplimer 1
|
|
|
412 Sequence: CP000967
|
|
|
413
|
|
|
414 GGATTGGTTGATCGATACGC hits forward strand at 3390600 with 0 mismatches
|
|
|
415 TCCCTAGCCGAAGAGCACTA hits reverse strand at [1849272] with 0 mismatches
|
|
|
416 Amplimer length: 205 bp
|
|
|
417
|
|
|
418 Primer name 61
|
|
|
419 Amplimer 1
|
|
|
420 Sequence: CP000967
|
|
|
421
|
|
|
422 GCGAGAACTTTCATCCGAAG hits forward strand at 3390758 with 0 mismatches
|
|
|
423 CTTACGACGCAAAATGCAAA hits reverse strand at [1849106] with 0 mismatches
|
|
|
424 Amplimer length: 213 bp
|
|
|
425
|
|
|
426 Primer name 62
|
|
|
427 Amplimer 1
|
|
|
428 Sequence: CP000967
|
|
|
429
|
|
|
430 GCACCGACATGAAGTTCCTC hits forward strand at 3391195 with 0 mismatches
|
|
|
431 TCAGGCAGTTCTTCCAGGTC hits reverse strand at [1848657] with 0 mismatches
|
|
|
432 Amplimer length: 225 bp
|
|
|
433
|
|
|
434 Primer name 63
|
|
|
435 Amplimer 1
|
|
|
436 Sequence: CP000967
|
|
|
437
|
|
|
438 GGGAGGAGGTCTTCTTCCAT hits forward strand at 3391165 with 0 mismatches
|
|
|
439 CGTACTTGTCCAATGGATGCT hits reverse strand at [1848696] with 0 mismatches
|
|
|
440 Amplimer length: 216 bp
|
|
|
441
|
|
|
442 Primer name 67
|
|
|
443 Amplimer 1
|
|
|
444 Sequence: CP000967
|
|
|
445
|
|
|
446 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
|
|
|
447 CAAAGCTGCAACTGGTCAAG hits reverse strand at [3905281] with 0 mismatches
|
|
|
448 Amplimer length: 209 bp
|
|
|
449 Amplimer 2
|
|
|
450 Sequence: CP000967
|
|
|
451
|
|
|
452 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
|
|
|
453 CAAAGCTGCAACTGGTCAAG hits reverse strand at [3769446] with 0 mismatches
|
|
|
454 Amplimer length: 136044 bp
|
|
|
455 Amplimer 3
|
|
|
456 Sequence: CP000967
|
|
|
457
|
|
|
458 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
|
|
|
459 CAAAGCTGCAACTGGTCAAG hits reverse strand at [3359403] with 0 mismatches
|
|
|
460 Amplimer length: 546087 bp
|
|
|
461 Amplimer 4
|
|
|
462 Sequence: CP000967
|
|
|
463
|
|
|
464 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
|
|
|
465 CAAAGCTGCAACTGGTCAAG hits reverse strand at [2829994] with 0 mismatches
|
|
|
466 Amplimer length: 1075496 bp
|
|
|
467 Amplimer 5
|
|
|
468 Sequence: CP000967
|
|
|
469
|
|
|
470 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
|
|
|
471 CAAAGCTGCAACTGGTCAAG hits reverse strand at [2022434] with 0 mismatches
|
|
|
472 Amplimer length: 1883056 bp
|
|
|
473 Amplimer 6
|
|
|
474 Sequence: CP000967
|
|
|
475
|
|
|
476 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
|
|
|
477 CAAAGCTGCAACTGGTCAAG hits reverse strand at [37285] with 0 mismatches
|
|
|
478 Amplimer length: 3868205 bp
|
|
|
479
|
|
|
480 Primer name 78
|
|
|
481 Amplimer 1
|
|
|
482 Sequence: CP000967
|
|
|
483
|
|
|
484 CGCCAACTGAACGAAAGCTA hits forward strand at 4520084 with 0 mismatches
|
|
|
485 AAGCGGGGTTTTTCGTAACT hits reverse strand at [719784] with 0 mismatches
|
|
|
486 Amplimer length: 209 bp
|
|
|
487
|
|
|
488 Primer name 79
|
|
|
489 Amplimer 1
|
|
|
490 Sequence: CP000967
|
|
|
491
|
|
|
492 ACCACCGTTCTAGTGCATCG hits forward strand at 4520057 with 0 mismatches
|
|
|
493 TGCAAAGGGAGCTTGTATGA hits reverse strand at [719814] with 0 mismatches
|
|
|
494 Amplimer length: 206 bp
|
|
|
495
|
|
|
496 Primer name 86
|
|
|
497 Amplimer 1
|
|
|
498 Sequence: CP000967
|
|
|
499
|
|
|
500 ACAGGACAGAGCCTTTACCG hits forward strand at 1393082 with 0 mismatches
|
|
|
501 TTACGCCACCCTTACTTTGC hits reverse strand at [3846793] with 0 mismatches
|
|
|
502 Amplimer length: 202 bp
|
|
|
503
|
|
|
504 Primer name 87
|
|
|
505 Amplimer 1
|
|
|
506 Sequence: CP000967
|
|
|
507
|
|
|
508 ACGTTGGATGCGATCCTAGA hits forward strand at 1392471 with 0 mismatches
|
|
|
509 GGCGAATTGTGAGGTGAAAT hits reverse strand at [3847402] with 0 mismatches
|
|
|
510 Amplimer length: 204 bp
|
|
|
511
|
|
|
512 Primer name 88
|
|
|
513 Amplimer 1
|
|
|
514 Sequence: CP000967
|
|
|
515
|
|
|
516 ATAAGCGCATCCTTCCTCAA hits forward strand at 1395162 with 0 mismatches
|
|
|
517 TGCCGTCTTCTTCATGTTCA hits reverse strand at [3844711] with 0 mismatches
|
|
|
518 Amplimer length: 204 bp
|
|
|
519
|
|
|
520 Primer name 89
|
|
|
521 Amplimer 1
|
|
|
522 Sequence: CP000967
|
|
|
523
|
|
|
524 TGTCCGCAACCTGTTTACAA hits forward strand at 1395245 with 0 mismatches
|
|
|
525 GACGTTGTTGAACGCCTCTT hits reverse strand at [3844625] with 0 mismatches
|
|
|
526 Amplimer length: 207 bp
|
|
|
527
|
|
|
528 Primer name 90
|
|
|
529 Amplimer 1
|
|
|
530 Sequence: CP000967
|
|
|
531
|
|
|
532 CGGTAGGCCCACTATGTTGT hits forward strand at 4544185 with 0 mismatches
|
|
|
533 CTTGTTCTGCCCGTTTCAAT hits reverse strand at [695692] with 0 mismatches
|
|
|
534 Amplimer length: 200 bp
|
|
|
535
|
|
|
536 Primer name 91
|
|
|
537 Amplimer 1
|
|
|
538 Sequence: CP000967
|
|
|
539
|
|
|
540 CGAGACGGTGTAGTTGTGGA hits forward strand at 4543920 with 0 mismatches
|
|
|
541 CCTGCAAACTGGGTTTCAAT hits reverse strand at [695955] with 0 mismatches
|
|
|
542 Amplimer length: 202 bp
|
|
|
543
|
|
|
544 Primer name 92
|
|
|
545 Amplimer 1
|
|
|
546 Sequence: CP000967
|
|
|
547
|
|
|
548 GAAACCCCTTGGTGCCTATT hits forward strand at 4544891 with 0 mismatches
|
|
|
549 AACGCGTTGTTTCAATCCA hits reverse strand at [694975] with 0 mismatches
|
|
|
550 Amplimer length: 211 bp
|
|
|
551
|
|
|
552 Primer name 93
|
|
|
553 Amplimer 1
|
|
|
554 Sequence: CP000967
|
|
|
555
|
|
|
556 TGGTGCCTATTGTGCCTAAA hits forward strand at 4544900 with 0 mismatches
|
|
|
557 AACGCGTTGTTTCAATCCA hits reverse strand at [694975] with 0 mismatches
|
|
|
558 Amplimer length: 202 bp
|
|
|
559
|
|
|
560 Primer name 96
|
|
|
561 Amplimer 1
|
|
|
562 Sequence: CP000967
|
|
|
563
|
|
|
564 GCACTCAAACCCCTGATTTT hits forward strand at 3531207 with 0 mismatches
|
|
|
565 GGGTGATCAAGCGTCAGTTT hits reverse strand at [1708664] with 0 mismatches
|
|
|
566 Amplimer length: 206 bp
|
|
|
567 Amplimer 2
|
|
|
568 Sequence: CP000967
|
|
|
569
|
|
|
570 GCACTCAAACCCCTGATTTT hits forward strand at 3531207 with 0 mismatches
|
|
|
571 GGGTGATCAAGCGTCAGTTT hits reverse strand at [1301984] with 0 mismatches
|
|
|
572 Amplimer length: 406886 bp
|
|
|
573
|
|
|
574 Primer name 97
|
|
|
575 Amplimer 1
|
|
|
576 Sequence: CP000967
|
|
|
577
|
|
|
578 CATTAGCTCACCGTCTTTCG hits forward strand at 3531125 with 0 mismatches
|
|
|
579 TGTCGAATCTGTGGCTGAAG hits reverse strand at [1708751] with 0 mismatches
|
|
|
580 Amplimer length: 201 bp
|
|
|
581 Amplimer 2
|
|
|
582 Sequence: CP000967
|
|
|
583
|
|
|
584 CATTAGCTCACCGTCTTTCG hits forward strand at 3531125 with 0 mismatches
|
|
|
585 TGTCGAATCTGTGGCTGAAG hits reverse strand at [1302071] with 0 mismatches
|
|
|
586 Amplimer length: 406881 bp
|
|
|
587
|
|
|
588 Primer name 100
|
|
|
589 Amplimer 1
|
|
|
590 Sequence: CP000967
|
|
|
591
|
|
|
592 GCCTCGACTTTGGATAGTGC hits forward strand at 3532106 with 0 mismatches
|
|
|
593 CTCTGAACAACTCCCCCTGA hits reverse strand at [1707771] with 0 mismatches
|
|
|
594 Amplimer length: 200 bp
|
|
|
595
|
|
|
596 Primer name 101
|
|
|
597 Amplimer 1
|
|
|
598 Sequence: CP000967
|
|
|
599
|
|
|
600 GCTGCCTCGACTTTGGATAG hits forward strand at 3532103 with 0 mismatches
|
|
|
601 CTCTGAACAACTCCCCCTGA hits reverse strand at [1707771] with 0 mismatches
|
|
|
602 Amplimer length: 203 bp
|
|
|
603
|
|
|
604 Primer name 102
|
|
|
605 Amplimer 1
|
|
|
606 Sequence: CP000967
|
|
|
607
|
|
|
608 GCATCCACACGCCTATTCTT hits forward strand at 3532551 with 0 mismatches
|
|
|
609 CTTGCTCTTCAAGGGGTCTG hits reverse strand at [1707311] with 0 mismatches
|
|
|
610 Amplimer length: 215 bp
|
|
|
611
|
|
|
612 Primer name 103
|
|
|
613 Amplimer 1
|
|
|
614 Sequence: CP000967
|
|
|
615
|
|
|
616 AAGCATCCACACGCCTATTC hits forward strand at 3532549 with 0 mismatches
|
|
|
617 CTTGCTCTTCAAGGGGTCTG hits reverse strand at [1707311] with 0 mismatches
|
|
|
618 Amplimer length: 217 bp
|
|
|
619
|
|
|
620 Primer name 104
|
|
|
621 Amplimer 1
|
|
|
622 Sequence: CP000967
|
|
|
623
|
|
|
624 AACGCATCGGCAAAATAATC hits forward strand at 3537809 with 0 mismatches
|
|
|
625 GTCTAACATGGGGGTTGTCG hits reverse strand at [1702068] with 0 mismatches
|
|
|
626 Amplimer length: 200 bp
|
|
|
627
|
|
|
628 Primer name 105
|
|
|
629 Amplimer 1
|
|
|
630 Sequence: CP000967
|
|
|
631
|
|
|
632 GCGACCTGCTTTTAGACCTG hits forward strand at 3538657 with 0 mismatches
|
|
|
633 GCAAAGTCCACTTGCACAGA hits reverse strand at [1701215] with 0 mismatches
|
|
|
634 Amplimer length: 205 bp
|
|
|
635
|
|
|
636 Primer name 106
|
|
|
637 Amplimer 1
|
|
|
638 Sequence: CP000967
|
|
|
639
|
|
|
640 ATCGTCCTGACACCGGATAG hits forward strand at 4594076 with 0 mismatches
|
|
|
641 CTGAACAACGCACCACAAAT hits reverse strand at [645801] with 0 mismatches
|
|
|
642 Amplimer length: 200 bp
|
|
|
643
|
|
|
644 Primer name 117
|
|
|
645 Amplimer 1
|
|
|
646 Sequence: CP000967
|
|
|
647
|
|
|
648 GGCTATCTACGCCGATGAAG hits forward strand at 2835420 with 0 mismatches
|
|
|
649 GGCACAGCTGGTAATCCAGT hits reverse strand at [2404454] with 0 mismatches
|
|
|
650 Amplimer length: 203 bp
|
|
|
651 Amplimer 2
|
|
|
652 Sequence: CP000967
|
|
|
653
|
|
|
654 GGCTATCTACGCCGATGAAG hits forward strand at 2623333 with 0 mismatches
|
|
|
655 GGCACAGCTGGTAATCCAGT hits reverse strand at [2616541] with 0 mismatches
|
|
|
656 Amplimer length: 203 bp
|
|
|
657 Amplimer 3
|
|
|
658 Sequence: CP000967
|
|
|
659
|
|
|
660 GGCTATCTACGCCGATGAAG hits forward strand at 2623333 with 0 mismatches
|
|
|
661 GGCACAGCTGGTAATCCAGT hits reverse strand at [2404454] with 0 mismatches
|
|
|
662 Amplimer length: 212290 bp
|
|
|
663
|
|
|
664 Primer name 118
|
|
|
665 Amplimer 1
|
|
|
666 Sequence: CP000967
|
|
|
667
|
|
|
668 TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches
|
|
|
669 ACTTCCATGGCTGAAGGATG hits reverse strand at [3663799] with 0 mismatches
|
|
|
670 Amplimer length: 206 bp
|
|
|
671 Amplimer 2
|
|
|
672 Sequence: CP000967
|
|
|
673
|
|
|
674 TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches
|
|
|
675 ACTTCCATGGCTGAAGGATG hits reverse strand at [2582728] with 0 mismatches
|
|
|
676 Amplimer length: 1081277 bp
|
|
|
677 Amplimer 3
|
|
|
678 Sequence: CP000967
|
|
|
679
|
|
|
680 TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches
|
|
|
681 ACTTCCATGGCTGAAGGATG hits reverse strand at [2370641] with 0 mismatches
|
|
|
682 Amplimer length: 1293364 bp
|
|
|
683
|
|
|
684 Primer name 122
|
|
|
685 Amplimer 1
|
|
|
686 Sequence: CP000967
|
|
|
687
|
|
|
688 TCCAAAGCGTCTGGCTTTAT hits forward strand at 1578682 with 0 mismatches
|
|
|
689 TTGGCCGTAGAGGTATCGTC hits reverse strand at [3661190] with 0 mismatches
|
|
|
690 Amplimer length: 205 bp
|
|
|
691
|
|
|
692 Primer name 123
|
|
|
693 Amplimer 1
|
|
|
694 Sequence: CP000967
|
|
|
695
|
|
|
696 AAAGGCCAGCATCAAGAAGA hits forward strand at 1578044 with 0 mismatches
|
|
|
697 TTGGCCTTTCAAAGAAGGTG hits reverse strand at [3661825] with 0 mismatches
|
|
|
698 Amplimer length: 208 bp
|
|
|
699
|
|
|
700 Primer name 126
|
|
|
701 Amplimer 1
|
|
|
702 Sequence: CP000967
|
|
|
703
|
|
|
704 GTGCACTTCCGACAGCAAAT hits forward strand at 1580412 with 0 mismatches
|
|
|
705 CCGAGAAGTTGAGCAAGGAA hits reverse strand at [3659455] with 0 mismatches
|
|
|
706 Amplimer length: 210 bp
|
|
|
707
|
|
|
708 Primer name 127
|
|
|
709 Amplimer 1
|
|
|
710 Sequence: CP000967
|
|
|
711
|
|
|
712 ATTGTGCACTTCCGACAGC hits forward strand at 1580409 with 0 mismatches
|
|
|
713 CCGAGAAGTTGAGCAAGGAA hits reverse strand at [3659455] with 0 mismatches
|
|
|
714 Amplimer length: 213 bp
|
|
|
715
|
|
|
716 Primer name 128
|
|
|
717 Amplimer 1
|
|
|
718 Sequence: CP000967
|
|
|
719
|
|
|
720 ATGGCCAATTCCAGAGCATA hits forward strand at 1582841 with 0 mismatches
|
|
|
721 CCAACACAGTTTCGGATGTG hits reverse strand at [3657032] with 0 mismatches
|
|
|
722 Amplimer length: 204 bp
|
|
|
723
|
|
|
724 Primer name 129
|
|
|
725 Amplimer 1
|
|
|
726 Sequence: CP000967
|
|
|
727
|
|
|
728 AAGGCAAGTACGCAGAGCAT hits forward strand at 1582552 with 0 mismatches
|
|
|
729 CCCAAGGACAGGATAGTTGC hits reverse strand at [3657313] with 0 mismatches
|
|
|
730 Amplimer length: 212 bp
|
|
|
731
|
|
|
732 Primer name 130
|
|
|
733 Amplimer 1
|
|
|
734 Sequence: CP000967
|
|
|
735
|
|
|
736 CCAGCGTACTGATGTCGATG hits forward strand at 2848588 with 0 mismatches
|
|
|
737 CTTCGACAAAACGCACTCAA hits reverse strand at [2391289] with 0 mismatches
|
|
|
738 Amplimer length: 200 bp
|
|
|
739 Amplimer 2
|
|
|
740 Sequence: CP000967
|
|
|
741
|
|
|
742 CCAGCGTACTGATGTCGATG hits forward strand at 2636501 with 0 mismatches
|
|
|
743 CTTCGACAAAACGCACTCAA hits reverse strand at [2603376] with 0 mismatches
|
|
|
744 Amplimer length: 200 bp
|
|
|
745 Amplimer 3
|
|
|
746 Sequence: CP000967
|
|
|
747
|
|
|
748 CCAGCGTACTGATGTCGATG hits forward strand at 2636501 with 0 mismatches
|
|
|
749 CTTCGACAAAACGCACTCAA hits reverse strand at [2391289] with 0 mismatches
|
|
|
750 Amplimer length: 212287 bp
|
|
|
751
|
|
|
752 Primer name 151
|
|
|
753 Amplimer 1
|
|
|
754 Sequence: CP000967
|
|
|
755
|
|
|
756 CAGGACCGGAACCTTCATAA hits forward strand at 2874411 with 0 mismatches
|
|
|
757 CTATGGCTTGACCCTCGAAA hits reverse strand at [2365466] with 0 mismatches
|
|
|
758 Amplimer length: 200 bp
|
|
|
759 Amplimer 2
|
|
|
760 Sequence: CP000967
|
|
|
761
|
|
|
762 CAGGACCGGAACCTTCATAA hits forward strand at 2662324 with 0 mismatches
|
|
|
763 CTATGGCTTGACCCTCGAAA hits reverse strand at [2577553] with 0 mismatches
|
|
|
764 Amplimer length: 200 bp
|
|
|
765 Amplimer 3
|
|
|
766 Sequence: CP000967
|
|
|
767
|
|
|
768 CAGGACCGGAACCTTCATAA hits forward strand at 2662324 with 0 mismatches
|
|
|
769 CTATGGCTTGACCCTCGAAA hits reverse strand at [2365466] with 0 mismatches
|
|
|
770 Amplimer length: 212287 bp
|
|
|
771
|
|
|
772 Primer name 152
|
|
|
773 Amplimer 1
|
|
|
774 Sequence: CP000967
|
|
|
775
|
|
|
776 GAGTTGTCGCCGGAAAAATA hits forward strand at 2880573 with 0 mismatches
|
|
|
777 GCTATTGGCAAAGCTTCGAT hits reverse strand at [2359300] with 0 mismatches
|
|
|
778 Amplimer length: 204 bp
|
|
|
779 Amplimer 2
|
|
|
780 Sequence: CP000967
|
|
|
781
|
|
|
782 GAGTTGTCGCCGGAAAAATA hits forward strand at 2668486 with 0 mismatches
|
|
|
783 GCTATTGGCAAAGCTTCGAT hits reverse strand at [2571387] with 0 mismatches
|
|
|
784 Amplimer length: 204 bp
|
|
|
785 Amplimer 3
|
|
|
786 Sequence: CP000967
|
|
|
787
|
|
|
788 GAGTTGTCGCCGGAAAAATA hits forward strand at 2668486 with 0 mismatches
|
|
|
789 GCTATTGGCAAAGCTTCGAT hits reverse strand at [2359300] with 0 mismatches
|
|
|
790 Amplimer length: 212291 bp
|
|
|
791
|
|
|
792 Primer name 153
|
|
|
793 Amplimer 1
|
|
|
794 Sequence: CP000967
|
|
|
795
|
|
|
796 GCGATCGCCATCCTAGATAA hits forward strand at 2880644 with 0 mismatches
|
|
|
797 CCATAGGTGATGCCTTCTCG hits reverse strand at [2359232] with 0 mismatches
|
|
|
798 Amplimer length: 201 bp
|
|
|
799 Amplimer 2
|
|
|
800 Sequence: CP000967
|
|
|
801
|
|
|
802 GCGATCGCCATCCTAGATAA hits forward strand at 2668557 with 0 mismatches
|
|
|
803 CCATAGGTGATGCCTTCTCG hits reverse strand at [2571319] with 0 mismatches
|
|
|
804 Amplimer length: 201 bp
|
|
|
805 Amplimer 3
|
|
|
806 Sequence: CP000967
|
|
|
807
|
|
|
808 GCGATCGCCATCCTAGATAA hits forward strand at 2668557 with 0 mismatches
|
|
|
809 CCATAGGTGATGCCTTCTCG hits reverse strand at [2359232] with 0 mismatches
|
|
|
810 Amplimer length: 212288 bp
|
|
|
811
|
|
|
812 Primer name 154
|
|
|
813 Amplimer 1
|
|
|
814 Sequence: CP000967
|
|
|
815
|
|
|
816 ACGACGCAGTCCCTGTTAGT hits forward strand at 2880896 with 0 mismatches
|
|
|
817 GCGGAATTAGCGGTATCTTG hits reverse strand at [2358974] with 0 mismatches
|
|
|
818 Amplimer length: 207 bp
|
|
|
819 Amplimer 2
|
|
|
820 Sequence: CP000967
|
|
|
821
|
|
|
822 ACGACGCAGTCCCTGTTAGT hits forward strand at 2668809 with 0 mismatches
|
|
|
823 GCGGAATTAGCGGTATCTTG hits reverse strand at [2571061] with 0 mismatches
|
|
|
824 Amplimer length: 207 bp
|
|
|
825 Amplimer 3
|
|
|
826 Sequence: CP000967
|
|
|
827
|
|
|
828 ACGACGCAGTCCCTGTTAGT hits forward strand at 2668809 with 0 mismatches
|
|
|
829 GCGGAATTAGCGGTATCTTG hits reverse strand at [2358974] with 0 mismatches
|
|
|
830 Amplimer length: 212294 bp
|
|
|
831
|
|
|
832 Primer name 155
|
|
|
833 Amplimer 1
|
|
|
834 Sequence: CP000967
|
|
|
835
|
|
|
836 GCAGGATTGTCATCAGCGTA hits forward strand at 2881156 with 0 mismatches
|
|
|
837 TATGATCCGTATGGGGCAAC hits reverse strand at [2358718] with 0 mismatches
|
|
|
838 Amplimer length: 203 bp
|
|
|
839 Amplimer 2
|
|
|
840 Sequence: CP000967
|
|
|
841
|
|
|
842 GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches
|
|
|
843 TATGATCCGTATGGGGCAAC hits reverse strand at [2570805] with 0 mismatches
|
|
|
844 Amplimer length: 203 bp
|
|
|
845 Amplimer 3
|
|
|
846 Sequence: CP000967
|
|
|
847
|
|
|
848 GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches
|
|
|
849 TATGATCCGTATGGGGCAAC hits reverse strand at [2365098] with 0 mismatches
|
|
|
850 Amplimer length: 205910 bp
|
|
|
851 Amplimer 4
|
|
|
852 Sequence: CP000967
|
|
|
853
|
|
|
854 GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches
|
|
|
855 TATGATCCGTATGGGGCAAC hits reverse strand at [2358718] with 0 mismatches
|
|
|
856 Amplimer length: 212290 bp
|
|
|
857
|
|
|
858 Primer name 162
|
|
|
859 Amplimer 1
|
|
|
860 Sequence: CP000967
|
|
|
861
|
|
|
862 TTTTGGCTGTGCTTTACACG hits forward strand at 2893326 with 0 mismatches
|
|
|
863 CGACATCACCCACTACATCG hits reverse strand at [2346551] with 0 mismatches
|
|
|
864 Amplimer length: 200 bp
|
|
|
865 Amplimer 2
|
|
|
866 Sequence: CP000967
|
|
|
867
|
|
|
868 TTTTGGCTGTGCTTTACACG hits forward strand at 2681239 with 0 mismatches
|
|
|
869 CGACATCACCCACTACATCG hits reverse strand at [2558638] with 0 mismatches
|
|
|
870 Amplimer length: 200 bp
|
|
|
871 Amplimer 3
|
|
|
872 Sequence: CP000967
|
|
|
873
|
|
|
874 TTTTGGCTGTGCTTTACACG hits forward strand at 2681239 with 0 mismatches
|
|
|
875 CGACATCACCCACTACATCG hits reverse strand at [2346551] with 0 mismatches
|
|
|
876 Amplimer length: 212287 bp
|
|
|
877
|
|
|
878 Primer name 163
|
|
|
879 Amplimer 1
|
|
|
880 Sequence: CP000967
|
|
|
881
|
|
|
882 CCGGGGTACTCAGTGTCAGT hits forward strand at 2890144 with 0 mismatches
|
|
|
883 CAGTTCGTCCAATACGCAGA hits reverse strand at [2349730] with 0 mismatches
|
|
|
884 Amplimer length: 203 bp
|
|
|
885 Amplimer 2
|
|
|
886 Sequence: CP000967
|
|
|
887
|
|
|
888 CCGGGGTACTCAGTGTCAGT hits forward strand at 2678057 with 0 mismatches
|
|
|
889 CAGTTCGTCCAATACGCAGA hits reverse strand at [2561817] with 0 mismatches
|
|
|
890 Amplimer length: 203 bp
|
|
|
891 Amplimer 3
|
|
|
892 Sequence: CP000967
|
|
|
893
|
|
|
894 CCGGGGTACTCAGTGTCAGT hits forward strand at 2678057 with 0 mismatches
|
|
|
895 CAGTTCGTCCAATACGCAGA hits reverse strand at [2349730] with 0 mismatches
|
|
|
896 Amplimer length: 212290 bp
|
|
|
897
|
|
|
898 Primer name 174
|
|
|
899 Amplimer 1
|
|
|
900 Sequence: CP000967
|
|
|
901
|
|
|
902 ACCGTGATTACCCTGCTCAC hits forward strand at 2719849 with 0 mismatches
|
|
|
903 ATACCACCGAATAGCGGATG hits reverse strand at [2520002] with 0 mismatches
|
|
|
904 Amplimer length: 226 bp
|
|
|
905 Amplimer 2
|
|
|
906 Sequence: CP000967
|
|
|
907
|
|
|
908 ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches
|
|
|
909 ATACCACCGAATAGCGGATG hits reverse strand at [2732089] with 0 mismatches
|
|
|
910 Amplimer length: 226 bp
|
|
|
911 Amplimer 3
|
|
|
912 Sequence: CP000967
|
|
|
913
|
|
|
914 ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches
|
|
|
915 ATACCACCGAATAGCGGATG hits reverse strand at [2520002] with 0 mismatches
|
|
|
916 Amplimer length: 212313 bp
|
|
|
917
|
|
|
918 Primer name 175
|
|
|
919 Amplimer 1
|
|
|
920 Sequence: CP000967
|
|
|
921
|
|
|
922 ACCGTGATTACCCTGCTCAC hits forward strand at 2719849 with 0 mismatches
|
|
|
923 CCACCATACCACCGAATAGC hits reverse strand at [2519997] with 0 mismatches
|
|
|
924 Amplimer length: 231 bp
|
|
|
925 Amplimer 2
|
|
|
926 Sequence: CP000967
|
|
|
927
|
|
|
928 ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches
|
|
|
929 CCACCATACCACCGAATAGC hits reverse strand at [2732084] with 0 mismatches
|
|
|
930 Amplimer length: 231 bp
|
|
|
931 Amplimer 3
|
|
|
932 Sequence: CP000967
|
|
|
933
|
|
|
934 ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches
|
|
|
935 CCACCATACCACCGAATAGC hits reverse strand at [2519997] with 0 mismatches
|
|
|
936 Amplimer length: 212318 bp
|
|
|
937
|
|
|
938 Primer name 182
|
|
|
939 Amplimer 1
|
|
|
940 Sequence: CP000967
|
|
|
941
|
|
|
942 ATGTCGCGGAGAAACTTCAT hits forward strand at 3850774 with 0 mismatches
|
|
|
943 CCTGTGTGGGACGGTTTTAT hits reverse strand at [1389102] with 0 mismatches
|
|
|
944 Amplimer length: 201 bp
|
|
|
945 Amplimer 2
|
|
|
946 Sequence: CP000967
|
|
|
947
|
|
|
948 ATGTCGCGGAGAAACTTCAT hits forward strand at 3847242 with 0 mismatches
|
|
|
949 CCTGTGTGGGACGGTTTTAT hits reverse strand at [1389102] with 0 mismatches
|
|
|
950 Amplimer length: 3733 bp
|
|
|
951
|
|
|
952 Primer name 183
|
|
|
953 Amplimer 1
|
|
|
954 Sequence: CP000967
|
|
|
955
|
|
|
956 ACCGACAGCTCGACATACTTG hits forward strand at 3850603 with 0 mismatches
|
|
|
957 GGCACCGACATGAAGTTTCT hits reverse strand at [1389274] with 0 mismatches
|
|
|
958 Amplimer length: 200 bp
|
|
|
959
|
|
|
960 Primer name 216
|
|
|
961 Amplimer 1
|
|
|
962 Sequence: CP000967
|
|
|
963
|
|
|
964 TGCCCCATACGGATCATACT hits forward strand at 2881341 with 0 mismatches
|
|
|
965 TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches
|
|
|
966 Amplimer length: 204 bp
|
|
|
967 Amplimer 2
|
|
|
968 Sequence: CP000967
|
|
|
969
|
|
|
970 TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches
|
|
|
971 TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches
|
|
|
972 Amplimer length: 204 bp
|
|
|
973 Amplimer 3
|
|
|
974 Sequence: CP000967
|
|
|
975
|
|
|
976 TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches
|
|
|
977 TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches
|
|
|
978 Amplimer length: 6584 bp
|
|
|
979 Amplimer 4
|
|
|
980 Sequence: CP000967
|
|
|
981
|
|
|
982 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
|
|
|
983 TACGACGGACAGAATGTGGT hits reverse strand at [2570619] with 0 mismatches
|
|
|
984 Amplimer length: 204 bp
|
|
|
985 Amplimer 5
|
|
|
986 Sequence: CP000967
|
|
|
987
|
|
|
988 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
|
|
|
989 TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches
|
|
|
990 Amplimer length: 205911 bp
|
|
|
991 Amplimer 6
|
|
|
992 Sequence: CP000967
|
|
|
993
|
|
|
994 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
|
|
|
995 TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches
|
|
|
996 Amplimer length: 212291 bp
|
|
|
997 Amplimer 7
|
|
|
998 Sequence: CP000967
|
|
|
999
|
|
|
1000 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
|
|
|
1001 TACGACGGACAGAATGTGGT hits reverse strand at [2576999] with 0 mismatches
|
|
|
1002 Amplimer length: 204 bp
|
|
|
1003 Amplimer 8
|
|
|
1004 Sequence: CP000967
|
|
|
1005
|
|
|
1006 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
|
|
|
1007 TACGACGGACAGAATGTGGT hits reverse strand at [2570619] with 0 mismatches
|
|
|
1008 Amplimer length: 6584 bp
|
|
|
1009 Amplimer 9
|
|
|
1010 Sequence: CP000967
|
|
|
1011
|
|
|
1012 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
|
|
|
1013 TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches
|
|
|
1014 Amplimer length: 212291 bp
|
|
|
1015 Amplimer 10
|
|
|
1016 Sequence: CP000967
|
|
|
1017
|
|
|
1018 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
|
|
|
1019 TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches
|
|
|
1020 Amplimer length: 218671 bp
|
|
|
1021
|
|
|
1022 Primer name 217
|
|
|
1023 Amplimer 1
|
|
|
1024 Sequence: CP000967
|
|
|
1025
|
|
|
1026 TGCCCCATACGGATCATACT hits forward strand at 2881341 with 0 mismatches
|
|
|
1027 GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches
|
|
|
1028 Amplimer length: 205 bp
|
|
|
1029 Amplimer 2
|
|
|
1030 Sequence: CP000967
|
|
|
1031
|
|
|
1032 TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches
|
|
|
1033 GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches
|
|
|
1034 Amplimer length: 205 bp
|
|
|
1035 Amplimer 3
|
|
|
1036 Sequence: CP000967
|
|
|
1037
|
|
|
1038 TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches
|
|
|
1039 GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches
|
|
|
1040 Amplimer length: 6585 bp
|
|
|
1041 Amplimer 4
|
|
|
1042 Sequence: CP000967
|
|
|
1043
|
|
|
1044 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
|
|
|
1045 GTACGACGGACAGAATGTGG hits reverse strand at [2570618] with 0 mismatches
|
|
|
1046 Amplimer length: 205 bp
|
|
|
1047 Amplimer 5
|
|
|
1048 Sequence: CP000967
|
|
|
1049
|
|
|
1050 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
|
|
|
1051 GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches
|
|
|
1052 Amplimer length: 205912 bp
|
|
|
1053 Amplimer 6
|
|
|
1054 Sequence: CP000967
|
|
|
1055
|
|
|
1056 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
|
|
|
1057 GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches
|
|
|
1058 Amplimer length: 212292 bp
|
|
|
1059 Amplimer 7
|
|
|
1060 Sequence: CP000967
|
|
|
1061
|
|
|
1062 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
|
|
|
1063 GTACGACGGACAGAATGTGG hits reverse strand at [2576998] with 0 mismatches
|
|
|
1064 Amplimer length: 205 bp
|
|
|
1065 Amplimer 8
|
|
|
1066 Sequence: CP000967
|
|
|
1067
|
|
|
1068 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
|
|
|
1069 GTACGACGGACAGAATGTGG hits reverse strand at [2570618] with 0 mismatches
|
|
|
1070 Amplimer length: 6585 bp
|
|
|
1071 Amplimer 9
|
|
|
1072 Sequence: CP000967
|
|
|
1073
|
|
|
1074 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
|
|
|
1075 GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches
|
|
|
1076 Amplimer length: 212292 bp
|
|
|
1077 Amplimer 10
|
|
|
1078 Sequence: CP000967
|
|
|
1079
|
|
|
1080 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
|
|
|
1081 GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches
|
|
|
1082 Amplimer length: 218672 bp
|
|
|
1083
|
|
|
1084 Primer name 232
|
|
|
1085 Amplimer 1
|
|
|
1086 Sequence: CP000967
|
|
|
1087
|
|
|
1088 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1089 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2341701] with 0 mismatches
|
|
|
1090 Amplimer length: 226 bp
|
|
|
1091 Amplimer 2
|
|
|
1092 Sequence: CP000967
|
|
|
1093
|
|
|
1094 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1095 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2336956] with 0 mismatches
|
|
|
1096 Amplimer length: 4971 bp
|
|
|
1097 Amplimer 3
|
|
|
1098 Sequence: CP000967
|
|
|
1099
|
|
|
1100 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1101 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1135328] with 0 mismatches
|
|
|
1102 Amplimer length: 1206599 bp
|
|
|
1103 Amplimer 4
|
|
|
1104 Sequence: CP000967
|
|
|
1105
|
|
|
1106 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1107 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1129887] with 0 mismatches
|
|
|
1108 Amplimer length: 1212040 bp
|
|
|
1109 Amplimer 5
|
|
|
1110 Sequence: CP000967
|
|
|
1111
|
|
|
1112 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1113 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1125487] with 0 mismatches
|
|
|
1114 Amplimer length: 1216440 bp
|
|
|
1115 Amplimer 6
|
|
|
1116 Sequence: CP000967
|
|
|
1117
|
|
|
1118 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1119 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1121489] with 0 mismatches
|
|
|
1120 Amplimer length: 1220438 bp
|
|
|
1121 Amplimer 7
|
|
|
1122 Sequence: CP000967
|
|
|
1123
|
|
|
1124 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1125 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1116372] with 0 mismatches
|
|
|
1126 Amplimer length: 1225555 bp
|
|
|
1127 Amplimer 8
|
|
|
1128 Sequence: CP000967
|
|
|
1129
|
|
|
1130 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1131 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2553788] with 0 mismatches
|
|
|
1132 Amplimer length: 226 bp
|
|
|
1133 Amplimer 9
|
|
|
1134 Sequence: CP000967
|
|
|
1135
|
|
|
1136 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1137 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2549043] with 0 mismatches
|
|
|
1138 Amplimer length: 4971 bp
|
|
|
1139 Amplimer 10
|
|
|
1140 Sequence: CP000967
|
|
|
1141
|
|
|
1142 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1143 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2341701] with 0 mismatches
|
|
|
1144 Amplimer length: 212313 bp
|
|
|
1145 Amplimer 11
|
|
|
1146 Sequence: CP000967
|
|
|
1147
|
|
|
1148 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1149 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2336956] with 0 mismatches
|
|
|
1150 Amplimer length: 217058 bp
|
|
|
1151 Amplimer 12
|
|
|
1152 Sequence: CP000967
|
|
|
1153
|
|
|
1154 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1155 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1135328] with 0 mismatches
|
|
|
1156 Amplimer length: 1418686 bp
|
|
|
1157 Amplimer 13
|
|
|
1158 Sequence: CP000967
|
|
|
1159
|
|
|
1160 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1161 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1129887] with 0 mismatches
|
|
|
1162 Amplimer length: 1424127 bp
|
|
|
1163 Amplimer 14
|
|
|
1164 Sequence: CP000967
|
|
|
1165
|
|
|
1166 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1167 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1125487] with 0 mismatches
|
|
|
1168 Amplimer length: 1428527 bp
|
|
|
1169 Amplimer 15
|
|
|
1170 Sequence: CP000967
|
|
|
1171
|
|
|
1172 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1173 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1121489] with 0 mismatches
|
|
|
1174 Amplimer length: 1432525 bp
|
|
|
1175 Amplimer 16
|
|
|
1176 Sequence: CP000967
|
|
|
1177
|
|
|
1178 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1179 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1116372] with 0 mismatches
|
|
|
1180 Amplimer length: 1437642 bp
|
|
|
1181 Amplimer 17
|
|
|
1182 Sequence: CP000967
|
|
|
1183
|
|
|
1184 AGCTCCTCTTCGTTGAATGC hits forward strand at 1645295 with 0 mismatches
|
|
|
1185 CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches
|
|
|
1186 Amplimer length: 226 bp
|
|
|
1187 Amplimer 18
|
|
|
1188 Sequence: CP000967
|
|
|
1189
|
|
|
1190 AGCTCCTCTTCGTTGAATGC hits forward strand at 559164 with 0 mismatches
|
|
|
1191 CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches
|
|
|
1192 Amplimer length: 1086357 bp
|
|
|
1193
|
|
|
1194 Primer name 233
|
|
|
1195 Amplimer 1
|
|
|
1196 Sequence: CP000967
|
|
|
1197
|
|
|
1198 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1199 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2341699] with 0 mismatches
|
|
|
1200 Amplimer length: 228 bp
|
|
|
1201 Amplimer 2
|
|
|
1202 Sequence: CP000967
|
|
|
1203
|
|
|
1204 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1205 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2336954] with 0 mismatches
|
|
|
1206 Amplimer length: 4973 bp
|
|
|
1207 Amplimer 3
|
|
|
1208 Sequence: CP000967
|
|
|
1209
|
|
|
1210 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1211 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1135326] with 0 mismatches
|
|
|
1212 Amplimer length: 1206601 bp
|
|
|
1213 Amplimer 4
|
|
|
1214 Sequence: CP000967
|
|
|
1215
|
|
|
1216 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1217 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1129885] with 0 mismatches
|
|
|
1218 Amplimer length: 1212042 bp
|
|
|
1219 Amplimer 5
|
|
|
1220 Sequence: CP000967
|
|
|
1221
|
|
|
1222 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1223 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1125485] with 0 mismatches
|
|
|
1224 Amplimer length: 1216442 bp
|
|
|
1225 Amplimer 6
|
|
|
1226 Sequence: CP000967
|
|
|
1227
|
|
|
1228 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1229 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1121487] with 0 mismatches
|
|
|
1230 Amplimer length: 1220440 bp
|
|
|
1231 Amplimer 7
|
|
|
1232 Sequence: CP000967
|
|
|
1233
|
|
|
1234 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
|
|
|
1235 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1116370] with 0 mismatches
|
|
|
1236 Amplimer length: 1225557 bp
|
|
|
1237 Amplimer 8
|
|
|
1238 Sequence: CP000967
|
|
|
1239
|
|
|
1240 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1241 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2553786] with 0 mismatches
|
|
|
1242 Amplimer length: 228 bp
|
|
|
1243 Amplimer 9
|
|
|
1244 Sequence: CP000967
|
|
|
1245
|
|
|
1246 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1247 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2549041] with 0 mismatches
|
|
|
1248 Amplimer length: 4973 bp
|
|
|
1249 Amplimer 10
|
|
|
1250 Sequence: CP000967
|
|
|
1251
|
|
|
1252 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1253 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2341699] with 0 mismatches
|
|
|
1254 Amplimer length: 212315 bp
|
|
|
1255 Amplimer 11
|
|
|
1256 Sequence: CP000967
|
|
|
1257
|
|
|
1258 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1259 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2336954] with 0 mismatches
|
|
|
1260 Amplimer length: 217060 bp
|
|
|
1261 Amplimer 12
|
|
|
1262 Sequence: CP000967
|
|
|
1263
|
|
|
1264 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1265 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1135326] with 0 mismatches
|
|
|
1266 Amplimer length: 1418688 bp
|
|
|
1267 Amplimer 13
|
|
|
1268 Sequence: CP000967
|
|
|
1269
|
|
|
1270 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1271 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1129885] with 0 mismatches
|
|
|
1272 Amplimer length: 1424129 bp
|
|
|
1273 Amplimer 14
|
|
|
1274 Sequence: CP000967
|
|
|
1275
|
|
|
1276 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1277 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1125485] with 0 mismatches
|
|
|
1278 Amplimer length: 1428529 bp
|
|
|
1279 Amplimer 15
|
|
|
1280 Sequence: CP000967
|
|
|
1281
|
|
|
1282 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1283 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1121487] with 0 mismatches
|
|
|
1284 Amplimer length: 1432527 bp
|
|
|
1285 Amplimer 16
|
|
|
1286 Sequence: CP000967
|
|
|
1287
|
|
|
1288 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
|
|
|
1289 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1116370] with 0 mismatches
|
|
|
1290 Amplimer length: 1437644 bp
|
|
|
1291 Amplimer 17
|
|
|
1292 Sequence: CP000967
|
|
|
1293
|
|
|
1294 CGAGCTCCTCTTCGTTGAAT hits forward strand at 1645293 with 0 mismatches
|
|
|
1295 CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches
|
|
|
1296 Amplimer length: 228 bp
|
|
|
1297 Amplimer 18
|
|
|
1298 Sequence: CP000967
|
|
|
1299
|
|
|
1300 CGAGCTCCTCTTCGTTGAAT hits forward strand at 559162 with 0 mismatches
|
|
|
1301 CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches
|
|
|
1302 Amplimer length: 1086359 bp
|
|
|
1303
|
|
|
1304 Primer name 248
|
|
|
1305 Amplimer 1
|
|
|
1306 Sequence: CP000967
|
|
|
1307
|
|
|
1308 CCAGACCTTGACGCTGGAC hits forward strand at 1857781 with 0 mismatches
|
|
|
1309 CCGGTGTTCCGAAGGAGAT hits reverse strand at [3382096] with 0 mismatches
|
|
|
1310 Amplimer length: 200 bp
|
|
|
1311
|
|
|
1312 Primer name 249
|
|
|
1313 Amplimer 1
|
|
|
1314 Sequence: CP000967
|
|
|
1315
|
|
|
1316 CCAGACCTTGACGCTGGA hits forward strand at 1857781 with 0 mismatches
|
|
|
1317 CCGGTGTTCCGAAGGAGAT hits reverse strand at [3382096] with 0 mismatches
|
|
|
1318 Amplimer length: 200 bp
|
|
|
1319
|
|
|
1320 Primer name 250
|
|
|
1321 Amplimer 1
|
|
|
1322 Sequence: CP000967
|
|
|
1323
|
|
|
1324 ATACGCTCACTGCCACCTG hits forward strand at 1858071 with 0 mismatches
|
|
|
1325 CCAAGTCGGATTGGTCTGAT hits reverse strand at [3381805] with 0 mismatches
|
|
|
1326 Amplimer length: 201 bp
|
|
|
1327
|
|
|
1328 Primer name 251
|
|
|
1329 Amplimer 1
|
|
|
1330 Sequence: CP000967
|
|
|
1331
|
|
|
1332 GATACGCTCACTGCCACCTG hits forward strand at 1858070 with 0 mismatches
|
|
|
1333 AAGTCGGATTGGTCTGATGC hits reverse strand at [3381807] with 0 mismatches
|
|
|
1334 Amplimer length: 200 bp
|
