diff uniqprimer-0.5.0/tmpPHilD4/tmpoutputprimers2.ps1 @ 0:cdd8f911ad91 draft

Uploaded
author dereeper
date Fri, 07 Oct 2016 04:18:11 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/uniqprimer-0.5.0/tmpPHilD4/tmpoutputprimers2.ps1	Fri Oct 07 04:18:11 2016 -0400
@@ -0,0 +1,1334 @@
+
+Primer name 18
+Amplimer 1
+	Sequence: CP000967  
+	
+	GATGGACCGGGTAAAAACCT hits forward strand at 117992 with 0 mismatches
+	TCGAAGTTGTCGTAGCTCCA hits reverse strand at [5121883] with 0 mismatches
+	Amplimer length: 202 bp
+
+Primer name 19
+Amplimer 1
+	Sequence: CP000967  
+	
+	AGATGGACCGGGTAAAAACC hits forward strand at 117991 with 0 mismatches
+	TCGAAGTTGTCGTAGCTCCA hits reverse strand at [5121883] with 0 mismatches
+	Amplimer length: 203 bp
+
+Primer name 20
+Amplimer 1
+	Sequence: CP000967  
+	
+	TCAATCAAGTGCGCTGCTAT hits forward strand at 3269992 with 0 mismatches
+	CGGCTACTACATTGGCAGGT hits reverse strand at [1969885] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 21
+Amplimer 1
+	Sequence: CP000967  
+	
+	ATCAATCAAGTGCGCTGCTA hits forward strand at 3269991 with 0 mismatches
+	CGGCTACTACATTGGCAGGT hits reverse strand at [1969885] with 0 mismatches
+	Amplimer length: 201 bp
+
+Primer name 22
+Amplimer 1
+	Sequence: CP000967  
+	
+	GTACAGATCGCCGAGCACTT hits forward strand at 1180498 with 0 mismatches
+	CCAATCCAGACTTGCGCTAT hits reverse strand at [4059377] with 0 mismatches
+	Amplimer length: 202 bp
+
+Primer name 23
+Amplimer 1
+	Sequence: CP000967  
+	
+	GTACAGATCGCCGAGCACTT hits forward strand at 1180498 with 0 mismatches
+	CAATCCAGACTTGCGCTATG hits reverse strand at [4059378] with 0 mismatches
+	Amplimer length: 201 bp
+
+Primer name 30
+Amplimer 1
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [5100760] with 0 mismatches
+	Amplimer length: 206 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [3850284] with 0 mismatches
+	Amplimer length: 1250682 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [3679829] with 0 mismatches
+	Amplimer length: 1421137 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [3511484] with 0 mismatches
+	Amplimer length: 1589482 bp
+Amplimer 5
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [3143025] with 0 mismatches
+	Amplimer length: 1957941 bp
+Amplimer 6
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [3141976] with 0 mismatches
+	Amplimer length: 1958990 bp
+Amplimer 7
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [2814761] with 0 mismatches
+	Amplimer length: 2286205 bp
+Amplimer 8
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [2529194] with 0 mismatches
+	Amplimer length: 2571772 bp
+Amplimer 9
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [2317107] with 0 mismatches
+	Amplimer length: 2783859 bp
+Amplimer 10
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [1973706] with 0 mismatches
+	Amplimer length: 3127260 bp
+Amplimer 11
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [1742289] with 0 mismatches
+	Amplimer length: 3358677 bp
+Amplimer 12
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [1702515] with 0 mismatches
+	Amplimer length: 3398451 bp
+Amplimer 13
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [164617] with 0 mismatches
+	Amplimer length: 4936349 bp
+Amplimer 14
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	GCTGGATTTTTGTTGCAGTC hits reverse strand at [76745] with 0 mismatches
+	Amplimer length: 5024221 bp
+
+Primer name 31
+Amplimer 1
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [5100759] with 0 mismatches
+	Amplimer length: 207 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3850283] with 0 mismatches
+	Amplimer length: 1250683 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3679828] with 0 mismatches
+	Amplimer length: 1421138 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3511483] with 0 mismatches
+	Amplimer length: 1589483 bp
+Amplimer 5
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3143024] with 0 mismatches
+	Amplimer length: 1957942 bp
+Amplimer 6
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3141975] with 0 mismatches
+	Amplimer length: 1958991 bp
+Amplimer 7
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2814760] with 0 mismatches
+	Amplimer length: 2286206 bp
+Amplimer 8
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2529193] with 0 mismatches
+	Amplimer length: 2571773 bp
+Amplimer 9
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2317106] with 0 mismatches
+	Amplimer length: 2783860 bp
+Amplimer 10
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1973705] with 0 mismatches
+	Amplimer length: 3127261 bp
+Amplimer 11
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1742288] with 0 mismatches
+	Amplimer length: 3358678 bp
+Amplimer 12
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1702514] with 0 mismatches
+	Amplimer length: 3398452 bp
+Amplimer 13
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [164616] with 0 mismatches
+	Amplimer length: 4936350 bp
+Amplimer 14
+	Sequence: CP000967  
+	
+	TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches
+	AGCTGGATTTTTGTTGCAGTC hits reverse strand at [76744] with 0 mismatches
+	Amplimer length: 5024222 bp
+
+Primer name 32
+Amplimer 1
+	Sequence: CP000967  
+	
+	ATCTGTCCGGGTTGGACTC hits forward strand at 1212161 with 0 mismatches
+	GGTCTTGAGCACTTCCGAAC hits reverse strand at [4027716] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 33
+Amplimer 1
+	Sequence: CP000967  
+	
+	CAGATCATGTACCCGGTGCT hits forward strand at 1212445 with 0 mismatches
+	GCATCGCTGATGAAGTCGTA hits reverse strand at [4027423] with 0 mismatches
+	Amplimer length: 209 bp
+
+Primer name 34
+Amplimer 1
+	Sequence: CP000967  
+	
+	CAGTAGCAACCCCTTCAGGT hits forward strand at 178116 with 0 mismatches
+	CGTTCGGGTTCTTAGTTCCA hits reverse strand at [5061759] with 0 mismatches
+	Amplimer length: 202 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	CAGTAGCAACCCCTTCAGGT hits forward strand at 115447 with 0 mismatches
+	CGTTCGGGTTCTTAGTTCCA hits reverse strand at [5061759] with 0 mismatches
+	Amplimer length: 62871 bp
+
+Primer name 36
+Amplimer 1
+	Sequence: CP000967  
+	
+	GGACAGCCCTGTATGGAAAA hits forward strand at 2282909 with 0 mismatches
+	TGGAAGAAGCAGTTGCCAGT hits reverse strand at [2956968] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 37
+Amplimer 1
+	Sequence: CP000967  
+	
+	GGACAGCCCTGTATGGAAAA hits forward strand at 2282909 with 0 mismatches
+	GGAGCTGACTGGAAGAAGCA hits reverse strand at [2956959] with 0 mismatches
+	Amplimer length: 209 bp
+
+Primer name 38
+Amplimer 1
+	Sequence: CP000967  
+	
+	AAGCAGGTCTGGAACACCAC hits forward strand at 2284341 with 0 mismatches
+	GGAGTGCGTTAAAGCAGGTG hits reverse strand at [2955531] with 0 mismatches
+	Amplimer length: 205 bp
+
+Primer name 40
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCTTTGACCTTGTGGTCCAT hits forward strand at 2287923 with 0 mismatches
+	CCAGATCAGCGTCAGTGGTA hits reverse strand at [2951941] with 0 mismatches
+	Amplimer length: 213 bp
+
+Primer name 41
+Amplimer 1
+	Sequence: CP000967  
+	
+	CAAATGAGACGTCTGCGGTA hits forward strand at 2288283 with 0 mismatches
+	TGCCTTTGTAGCACTGTGGA hits reverse strand at [2951589] with 0 mismatches
+	Amplimer length: 205 bp
+
+Primer name 42
+Amplimer 1
+	Sequence: CP000967  
+	
+	CGTCATCAAACCAGACCTGA hits forward strand at 2289726 with 0 mismatches
+	TGGACTAGAAGCGCCTTGAT hits reverse strand at [2950147] with 0 mismatches
+	Amplimer length: 204 bp
+
+Primer name 43
+Amplimer 1
+	Sequence: CP000967  
+	
+	AAACGCTAAGCCGGTACTGA hits forward strand at 2289795 with 0 mismatches
+	GTGATGATGTCGAGCGTGTC hits reverse strand at [2950069] with 0 mismatches
+	Amplimer length: 213 bp
+
+Primer name 44
+Amplimer 1
+	Sequence: CP000967  
+	
+	CTGAAGGCAACGTTCTGCTA hits forward strand at 2290117 with 0 mismatches
+	GTCTCCCATTTGCCCTGAT hits reverse strand at [2949757] with 0 mismatches
+	Amplimer length: 203 bp
+
+Primer name 45
+Amplimer 1
+	Sequence: CP000967  
+	
+	GAAGGCAACGTTCTGCTACG hits forward strand at 2290119 with 0 mismatches
+	GTCTCCCATTTGCCCTGAT hits reverse strand at [2949757] with 0 mismatches
+	Amplimer length: 201 bp
+
+Primer name 46
+Amplimer 1
+	Sequence: CP000967  
+	
+	CGCAAGGTATCCAGTTCCTG hits forward strand at 2293873 with 0 mismatches
+	GGACCTCAGTGAAGGAGCAG hits reverse strand at [2945969] with 0 mismatches
+	Amplimer length: 235 bp
+
+Primer name 47
+Amplimer 1
+	Sequence: CP000967  
+	
+	GGTATCCAGTTCCTGCTGCT hits forward strand at 2293878 with 0 mismatches
+	AGCACTACCGGACCTCAGTG hits reverse strand at [2945960] with 0 mismatches
+	Amplimer length: 239 bp
+
+Primer name 48
+Amplimer 1
+	Sequence: CP000967  
+	
+	CGCAGCTGGTATGGATTTCT hits forward strand at 2296700 with 0 mismatches
+	ATCACAGCGCACAGCATAAG hits reverse strand at [2943175] with 0 mismatches
+	Amplimer length: 202 bp
+
+Primer name 49
+Amplimer 1
+	Sequence: CP000967  
+	
+	CGGACATGTACGACGAGTTG hits forward strand at 2296936 with 0 mismatches
+	GACTCCCAAACCTGGAACAA hits reverse strand at [2942936] with 0 mismatches
+	Amplimer length: 205 bp
+
+Primer name 50
+Amplimer 1
+	Sequence: CP000967  
+	
+	GTCACGATCCCGAATCAATC hits forward strand at 2299531 with 0 mismatches
+	GACAGTTCTTCGGCGTTCTC hits reverse strand at [2940346] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 51
+Amplimer 1
+	Sequence: CP000967  
+	
+	TGGCGACTATGTCGGATGTA hits forward strand at 2303661 with 0 mismatches
+	GATGGTAGCGCGATGACTTT hits reverse strand at [2936216] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 59
+Amplimer 1
+	Sequence: CP000967  
+	
+	AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
+	CATGCTCTGCGACGTAAAGA hits reverse strand at [1858272] with 0 mismatches
+	Amplimer length: 201 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
+	CATGCTCTGCGACGTAAAGA hits reverse strand at [1532947] with 0 mismatches
+	Amplimer length: 325526 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
+	CATGCTCTGCGACGTAAAGA hits reverse strand at [1523620] with 0 mismatches
+	Amplimer length: 334853 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
+	CATGCTCTGCGACGTAAAGA hits reverse strand at [851396] with 0 mismatches
+	Amplimer length: 1007077 bp
+Amplimer 5
+	Sequence: CP000967  
+	
+	AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
+	CATGCTCTGCGACGTAAAGA hits reverse strand at [817783] with 0 mismatches
+	Amplimer length: 1040690 bp
+Amplimer 6
+	Sequence: CP000967  
+	
+	AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches
+	CATGCTCTGCGACGTAAAGA hits reverse strand at [219270] with 0 mismatches
+	Amplimer length: 1639203 bp
+
+Primer name 60
+Amplimer 1
+	Sequence: CP000967  
+	
+	GGATTGGTTGATCGATACGC hits forward strand at 3390600 with 0 mismatches
+	TCCCTAGCCGAAGAGCACTA hits reverse strand at [1849272] with 0 mismatches
+	Amplimer length: 205 bp
+
+Primer name 61
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCGAGAACTTTCATCCGAAG hits forward strand at 3390758 with 0 mismatches
+	CTTACGACGCAAAATGCAAA hits reverse strand at [1849106] with 0 mismatches
+	Amplimer length: 213 bp
+
+Primer name 62
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCACCGACATGAAGTTCCTC hits forward strand at 3391195 with 0 mismatches
+	TCAGGCAGTTCTTCCAGGTC hits reverse strand at [1848657] with 0 mismatches
+	Amplimer length: 225 bp
+
+Primer name 63
+Amplimer 1
+	Sequence: CP000967  
+	
+	GGGAGGAGGTCTTCTTCCAT hits forward strand at 3391165 with 0 mismatches
+	CGTACTTGTCCAATGGATGCT hits reverse strand at [1848696] with 0 mismatches
+	Amplimer length: 216 bp
+
+Primer name 67
+Amplimer 1
+	Sequence: CP000967  
+	
+	TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
+	CAAAGCTGCAACTGGTCAAG hits reverse strand at [3905281] with 0 mismatches
+	Amplimer length: 209 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
+	CAAAGCTGCAACTGGTCAAG hits reverse strand at [3769446] with 0 mismatches
+	Amplimer length: 136044 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
+	CAAAGCTGCAACTGGTCAAG hits reverse strand at [3359403] with 0 mismatches
+	Amplimer length: 546087 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
+	CAAAGCTGCAACTGGTCAAG hits reverse strand at [2829994] with 0 mismatches
+	Amplimer length: 1075496 bp
+Amplimer 5
+	Sequence: CP000967  
+	
+	TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
+	CAAAGCTGCAACTGGTCAAG hits reverse strand at [2022434] with 0 mismatches
+	Amplimer length: 1883056 bp
+Amplimer 6
+	Sequence: CP000967  
+	
+	TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches
+	CAAAGCTGCAACTGGTCAAG hits reverse strand at [37285] with 0 mismatches
+	Amplimer length: 3868205 bp
+
+Primer name 78
+Amplimer 1
+	Sequence: CP000967  
+	
+	CGCCAACTGAACGAAAGCTA hits forward strand at 4520084 with 0 mismatches
+	AAGCGGGGTTTTTCGTAACT hits reverse strand at [719784] with 0 mismatches
+	Amplimer length: 209 bp
+
+Primer name 79
+Amplimer 1
+	Sequence: CP000967  
+	
+	ACCACCGTTCTAGTGCATCG hits forward strand at 4520057 with 0 mismatches
+	TGCAAAGGGAGCTTGTATGA hits reverse strand at [719814] with 0 mismatches
+	Amplimer length: 206 bp
+
+Primer name 86
+Amplimer 1
+	Sequence: CP000967  
+	
+	ACAGGACAGAGCCTTTACCG hits forward strand at 1393082 with 0 mismatches
+	TTACGCCACCCTTACTTTGC hits reverse strand at [3846793] with 0 mismatches
+	Amplimer length: 202 bp
+
+Primer name 87
+Amplimer 1
+	Sequence: CP000967  
+	
+	ACGTTGGATGCGATCCTAGA hits forward strand at 1392471 with 0 mismatches
+	GGCGAATTGTGAGGTGAAAT hits reverse strand at [3847402] with 0 mismatches
+	Amplimer length: 204 bp
+
+Primer name 88
+Amplimer 1
+	Sequence: CP000967  
+	
+	ATAAGCGCATCCTTCCTCAA hits forward strand at 1395162 with 0 mismatches
+	TGCCGTCTTCTTCATGTTCA hits reverse strand at [3844711] with 0 mismatches
+	Amplimer length: 204 bp
+
+Primer name 89
+Amplimer 1
+	Sequence: CP000967  
+	
+	TGTCCGCAACCTGTTTACAA hits forward strand at 1395245 with 0 mismatches
+	GACGTTGTTGAACGCCTCTT hits reverse strand at [3844625] with 0 mismatches
+	Amplimer length: 207 bp
+
+Primer name 90
+Amplimer 1
+	Sequence: CP000967  
+	
+	CGGTAGGCCCACTATGTTGT hits forward strand at 4544185 with 0 mismatches
+	CTTGTTCTGCCCGTTTCAAT hits reverse strand at [695692] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 91
+Amplimer 1
+	Sequence: CP000967  
+	
+	CGAGACGGTGTAGTTGTGGA hits forward strand at 4543920 with 0 mismatches
+	CCTGCAAACTGGGTTTCAAT hits reverse strand at [695955] with 0 mismatches
+	Amplimer length: 202 bp
+
+Primer name 92
+Amplimer 1
+	Sequence: CP000967  
+	
+	GAAACCCCTTGGTGCCTATT hits forward strand at 4544891 with 0 mismatches
+	AACGCGTTGTTTCAATCCA hits reverse strand at [694975] with 0 mismatches
+	Amplimer length: 211 bp
+
+Primer name 93
+Amplimer 1
+	Sequence: CP000967  
+	
+	TGGTGCCTATTGTGCCTAAA hits forward strand at 4544900 with 0 mismatches
+	AACGCGTTGTTTCAATCCA hits reverse strand at [694975] with 0 mismatches
+	Amplimer length: 202 bp
+
+Primer name 96
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCACTCAAACCCCTGATTTT hits forward strand at 3531207 with 0 mismatches
+	GGGTGATCAAGCGTCAGTTT hits reverse strand at [1708664] with 0 mismatches
+	Amplimer length: 206 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	GCACTCAAACCCCTGATTTT hits forward strand at 3531207 with 0 mismatches
+	GGGTGATCAAGCGTCAGTTT hits reverse strand at [1301984] with 0 mismatches
+	Amplimer length: 406886 bp
+
+Primer name 97
+Amplimer 1
+	Sequence: CP000967  
+	
+	CATTAGCTCACCGTCTTTCG hits forward strand at 3531125 with 0 mismatches
+	TGTCGAATCTGTGGCTGAAG hits reverse strand at [1708751] with 0 mismatches
+	Amplimer length: 201 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	CATTAGCTCACCGTCTTTCG hits forward strand at 3531125 with 0 mismatches
+	TGTCGAATCTGTGGCTGAAG hits reverse strand at [1302071] with 0 mismatches
+	Amplimer length: 406881 bp
+
+Primer name 100
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCCTCGACTTTGGATAGTGC hits forward strand at 3532106 with 0 mismatches
+	CTCTGAACAACTCCCCCTGA hits reverse strand at [1707771] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 101
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCTGCCTCGACTTTGGATAG hits forward strand at 3532103 with 0 mismatches
+	CTCTGAACAACTCCCCCTGA hits reverse strand at [1707771] with 0 mismatches
+	Amplimer length: 203 bp
+
+Primer name 102
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCATCCACACGCCTATTCTT hits forward strand at 3532551 with 0 mismatches
+	CTTGCTCTTCAAGGGGTCTG hits reverse strand at [1707311] with 0 mismatches
+	Amplimer length: 215 bp
+
+Primer name 103
+Amplimer 1
+	Sequence: CP000967  
+	
+	AAGCATCCACACGCCTATTC hits forward strand at 3532549 with 0 mismatches
+	CTTGCTCTTCAAGGGGTCTG hits reverse strand at [1707311] with 0 mismatches
+	Amplimer length: 217 bp
+
+Primer name 104
+Amplimer 1
+	Sequence: CP000967  
+	
+	AACGCATCGGCAAAATAATC hits forward strand at 3537809 with 0 mismatches
+	GTCTAACATGGGGGTTGTCG hits reverse strand at [1702068] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 105
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCGACCTGCTTTTAGACCTG hits forward strand at 3538657 with 0 mismatches
+	GCAAAGTCCACTTGCACAGA hits reverse strand at [1701215] with 0 mismatches
+	Amplimer length: 205 bp
+
+Primer name 106
+Amplimer 1
+	Sequence: CP000967  
+	
+	ATCGTCCTGACACCGGATAG hits forward strand at 4594076 with 0 mismatches
+	CTGAACAACGCACCACAAAT hits reverse strand at [645801] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 117
+Amplimer 1
+	Sequence: CP000967  
+	
+	GGCTATCTACGCCGATGAAG hits forward strand at 2835420 with 0 mismatches
+	GGCACAGCTGGTAATCCAGT hits reverse strand at [2404454] with 0 mismatches
+	Amplimer length: 203 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	GGCTATCTACGCCGATGAAG hits forward strand at 2623333 with 0 mismatches
+	GGCACAGCTGGTAATCCAGT hits reverse strand at [2616541] with 0 mismatches
+	Amplimer length: 203 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	GGCTATCTACGCCGATGAAG hits forward strand at 2623333 with 0 mismatches
+	GGCACAGCTGGTAATCCAGT hits reverse strand at [2404454] with 0 mismatches
+	Amplimer length: 212290 bp
+
+Primer name 118
+Amplimer 1
+	Sequence: CP000967  
+	
+	TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches
+	ACTTCCATGGCTGAAGGATG hits reverse strand at [3663799] with 0 mismatches
+	Amplimer length: 206 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches
+	ACTTCCATGGCTGAAGGATG hits reverse strand at [2582728] with 0 mismatches
+	Amplimer length: 1081277 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches
+	ACTTCCATGGCTGAAGGATG hits reverse strand at [2370641] with 0 mismatches
+	Amplimer length: 1293364 bp
+
+Primer name 122
+Amplimer 1
+	Sequence: CP000967  
+	
+	TCCAAAGCGTCTGGCTTTAT hits forward strand at 1578682 with 0 mismatches
+	TTGGCCGTAGAGGTATCGTC hits reverse strand at [3661190] with 0 mismatches
+	Amplimer length: 205 bp
+
+Primer name 123
+Amplimer 1
+	Sequence: CP000967  
+	
+	AAAGGCCAGCATCAAGAAGA hits forward strand at 1578044 with 0 mismatches
+	TTGGCCTTTCAAAGAAGGTG hits reverse strand at [3661825] with 0 mismatches
+	Amplimer length: 208 bp
+
+Primer name 126
+Amplimer 1
+	Sequence: CP000967  
+	
+	GTGCACTTCCGACAGCAAAT hits forward strand at 1580412 with 0 mismatches
+	CCGAGAAGTTGAGCAAGGAA hits reverse strand at [3659455] with 0 mismatches
+	Amplimer length: 210 bp
+
+Primer name 127
+Amplimer 1
+	Sequence: CP000967  
+	
+	ATTGTGCACTTCCGACAGC hits forward strand at 1580409 with 0 mismatches
+	CCGAGAAGTTGAGCAAGGAA hits reverse strand at [3659455] with 0 mismatches
+	Amplimer length: 213 bp
+
+Primer name 128
+Amplimer 1
+	Sequence: CP000967  
+	
+	ATGGCCAATTCCAGAGCATA hits forward strand at 1582841 with 0 mismatches
+	CCAACACAGTTTCGGATGTG hits reverse strand at [3657032] with 0 mismatches
+	Amplimer length: 204 bp
+
+Primer name 129
+Amplimer 1
+	Sequence: CP000967  
+	
+	AAGGCAAGTACGCAGAGCAT hits forward strand at 1582552 with 0 mismatches
+	CCCAAGGACAGGATAGTTGC hits reverse strand at [3657313] with 0 mismatches
+	Amplimer length: 212 bp
+
+Primer name 130
+Amplimer 1
+	Sequence: CP000967  
+	
+	CCAGCGTACTGATGTCGATG hits forward strand at 2848588 with 0 mismatches
+	CTTCGACAAAACGCACTCAA hits reverse strand at [2391289] with 0 mismatches
+	Amplimer length: 200 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	CCAGCGTACTGATGTCGATG hits forward strand at 2636501 with 0 mismatches
+	CTTCGACAAAACGCACTCAA hits reverse strand at [2603376] with 0 mismatches
+	Amplimer length: 200 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	CCAGCGTACTGATGTCGATG hits forward strand at 2636501 with 0 mismatches
+	CTTCGACAAAACGCACTCAA hits reverse strand at [2391289] with 0 mismatches
+	Amplimer length: 212287 bp
+
+Primer name 151
+Amplimer 1
+	Sequence: CP000967  
+	
+	CAGGACCGGAACCTTCATAA hits forward strand at 2874411 with 0 mismatches
+	CTATGGCTTGACCCTCGAAA hits reverse strand at [2365466] with 0 mismatches
+	Amplimer length: 200 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	CAGGACCGGAACCTTCATAA hits forward strand at 2662324 with 0 mismatches
+	CTATGGCTTGACCCTCGAAA hits reverse strand at [2577553] with 0 mismatches
+	Amplimer length: 200 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	CAGGACCGGAACCTTCATAA hits forward strand at 2662324 with 0 mismatches
+	CTATGGCTTGACCCTCGAAA hits reverse strand at [2365466] with 0 mismatches
+	Amplimer length: 212287 bp
+
+Primer name 152
+Amplimer 1
+	Sequence: CP000967  
+	
+	GAGTTGTCGCCGGAAAAATA hits forward strand at 2880573 with 0 mismatches
+	GCTATTGGCAAAGCTTCGAT hits reverse strand at [2359300] with 0 mismatches
+	Amplimer length: 204 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	GAGTTGTCGCCGGAAAAATA hits forward strand at 2668486 with 0 mismatches
+	GCTATTGGCAAAGCTTCGAT hits reverse strand at [2571387] with 0 mismatches
+	Amplimer length: 204 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	GAGTTGTCGCCGGAAAAATA hits forward strand at 2668486 with 0 mismatches
+	GCTATTGGCAAAGCTTCGAT hits reverse strand at [2359300] with 0 mismatches
+	Amplimer length: 212291 bp
+
+Primer name 153
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCGATCGCCATCCTAGATAA hits forward strand at 2880644 with 0 mismatches
+	CCATAGGTGATGCCTTCTCG hits reverse strand at [2359232] with 0 mismatches
+	Amplimer length: 201 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	GCGATCGCCATCCTAGATAA hits forward strand at 2668557 with 0 mismatches
+	CCATAGGTGATGCCTTCTCG hits reverse strand at [2571319] with 0 mismatches
+	Amplimer length: 201 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	GCGATCGCCATCCTAGATAA hits forward strand at 2668557 with 0 mismatches
+	CCATAGGTGATGCCTTCTCG hits reverse strand at [2359232] with 0 mismatches
+	Amplimer length: 212288 bp
+
+Primer name 154
+Amplimer 1
+	Sequence: CP000967  
+	
+	ACGACGCAGTCCCTGTTAGT hits forward strand at 2880896 with 0 mismatches
+	GCGGAATTAGCGGTATCTTG hits reverse strand at [2358974] with 0 mismatches
+	Amplimer length: 207 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	ACGACGCAGTCCCTGTTAGT hits forward strand at 2668809 with 0 mismatches
+	GCGGAATTAGCGGTATCTTG hits reverse strand at [2571061] with 0 mismatches
+	Amplimer length: 207 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	ACGACGCAGTCCCTGTTAGT hits forward strand at 2668809 with 0 mismatches
+	GCGGAATTAGCGGTATCTTG hits reverse strand at [2358974] with 0 mismatches
+	Amplimer length: 212294 bp
+
+Primer name 155
+Amplimer 1
+	Sequence: CP000967  
+	
+	GCAGGATTGTCATCAGCGTA hits forward strand at 2881156 with 0 mismatches
+	TATGATCCGTATGGGGCAAC hits reverse strand at [2358718] with 0 mismatches
+	Amplimer length: 203 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches
+	TATGATCCGTATGGGGCAAC hits reverse strand at [2570805] with 0 mismatches
+	Amplimer length: 203 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches
+	TATGATCCGTATGGGGCAAC hits reverse strand at [2365098] with 0 mismatches
+	Amplimer length: 205910 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches
+	TATGATCCGTATGGGGCAAC hits reverse strand at [2358718] with 0 mismatches
+	Amplimer length: 212290 bp
+
+Primer name 162
+Amplimer 1
+	Sequence: CP000967  
+	
+	TTTTGGCTGTGCTTTACACG hits forward strand at 2893326 with 0 mismatches
+	CGACATCACCCACTACATCG hits reverse strand at [2346551] with 0 mismatches
+	Amplimer length: 200 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	TTTTGGCTGTGCTTTACACG hits forward strand at 2681239 with 0 mismatches
+	CGACATCACCCACTACATCG hits reverse strand at [2558638] with 0 mismatches
+	Amplimer length: 200 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	TTTTGGCTGTGCTTTACACG hits forward strand at 2681239 with 0 mismatches
+	CGACATCACCCACTACATCG hits reverse strand at [2346551] with 0 mismatches
+	Amplimer length: 212287 bp
+
+Primer name 163
+Amplimer 1
+	Sequence: CP000967  
+	
+	CCGGGGTACTCAGTGTCAGT hits forward strand at 2890144 with 0 mismatches
+	CAGTTCGTCCAATACGCAGA hits reverse strand at [2349730] with 0 mismatches
+	Amplimer length: 203 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	CCGGGGTACTCAGTGTCAGT hits forward strand at 2678057 with 0 mismatches
+	CAGTTCGTCCAATACGCAGA hits reverse strand at [2561817] with 0 mismatches
+	Amplimer length: 203 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	CCGGGGTACTCAGTGTCAGT hits forward strand at 2678057 with 0 mismatches
+	CAGTTCGTCCAATACGCAGA hits reverse strand at [2349730] with 0 mismatches
+	Amplimer length: 212290 bp
+
+Primer name 174
+Amplimer 1
+	Sequence: CP000967  
+	
+	ACCGTGATTACCCTGCTCAC hits forward strand at 2719849 with 0 mismatches
+	ATACCACCGAATAGCGGATG hits reverse strand at [2520002] with 0 mismatches
+	Amplimer length: 226 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches
+	ATACCACCGAATAGCGGATG hits reverse strand at [2732089] with 0 mismatches
+	Amplimer length: 226 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches
+	ATACCACCGAATAGCGGATG hits reverse strand at [2520002] with 0 mismatches
+	Amplimer length: 212313 bp
+
+Primer name 175
+Amplimer 1
+	Sequence: CP000967  
+	
+	ACCGTGATTACCCTGCTCAC hits forward strand at 2719849 with 0 mismatches
+	CCACCATACCACCGAATAGC hits reverse strand at [2519997] with 0 mismatches
+	Amplimer length: 231 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches
+	CCACCATACCACCGAATAGC hits reverse strand at [2732084] with 0 mismatches
+	Amplimer length: 231 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches
+	CCACCATACCACCGAATAGC hits reverse strand at [2519997] with 0 mismatches
+	Amplimer length: 212318 bp
+
+Primer name 182
+Amplimer 1
+	Sequence: CP000967  
+	
+	ATGTCGCGGAGAAACTTCAT hits forward strand at 3850774 with 0 mismatches
+	CCTGTGTGGGACGGTTTTAT hits reverse strand at [1389102] with 0 mismatches
+	Amplimer length: 201 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	ATGTCGCGGAGAAACTTCAT hits forward strand at 3847242 with 0 mismatches
+	CCTGTGTGGGACGGTTTTAT hits reverse strand at [1389102] with 0 mismatches
+	Amplimer length: 3733 bp
+
+Primer name 183
+Amplimer 1
+	Sequence: CP000967  
+	
+	ACCGACAGCTCGACATACTTG hits forward strand at 3850603 with 0 mismatches
+	GGCACCGACATGAAGTTTCT hits reverse strand at [1389274] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 216
+Amplimer 1
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2881341 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches
+	Amplimer length: 204 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches
+	Amplimer length: 204 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches
+	Amplimer length: 6584 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2570619] with 0 mismatches
+	Amplimer length: 204 bp
+Amplimer 5
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches
+	Amplimer length: 205911 bp
+Amplimer 6
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches
+	Amplimer length: 212291 bp
+Amplimer 7
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2576999] with 0 mismatches
+	Amplimer length: 204 bp
+Amplimer 8
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2570619] with 0 mismatches
+	Amplimer length: 6584 bp
+Amplimer 9
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches
+	Amplimer length: 212291 bp
+Amplimer 10
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
+	TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches
+	Amplimer length: 218671 bp
+
+Primer name 217
+Amplimer 1
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2881341 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches
+	Amplimer length: 205 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches
+	Amplimer length: 205 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches
+	Amplimer length: 6585 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2570618] with 0 mismatches
+	Amplimer length: 205 bp
+Amplimer 5
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches
+	Amplimer length: 205912 bp
+Amplimer 6
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches
+	Amplimer length: 212292 bp
+Amplimer 7
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2576998] with 0 mismatches
+	Amplimer length: 205 bp
+Amplimer 8
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2570618] with 0 mismatches
+	Amplimer length: 6585 bp
+Amplimer 9
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches
+	Amplimer length: 212292 bp
+Amplimer 10
+	Sequence: CP000967  
+	
+	TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches
+	GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches
+	Amplimer length: 218672 bp
+
+Primer name 232
+Amplimer 1
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [2341701] with 0 mismatches
+	Amplimer length: 226 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [2336956] with 0 mismatches
+	Amplimer length: 4971 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1135328] with 0 mismatches
+	Amplimer length: 1206599 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1129887] with 0 mismatches
+	Amplimer length: 1212040 bp
+Amplimer 5
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1125487] with 0 mismatches
+	Amplimer length: 1216440 bp
+Amplimer 6
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1121489] with 0 mismatches
+	Amplimer length: 1220438 bp
+Amplimer 7
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1116372] with 0 mismatches
+	Amplimer length: 1225555 bp
+Amplimer 8
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [2553788] with 0 mismatches
+	Amplimer length: 226 bp
+Amplimer 9
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [2549043] with 0 mismatches
+	Amplimer length: 4971 bp
+Amplimer 10
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [2341701] with 0 mismatches
+	Amplimer length: 212313 bp
+Amplimer 11
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [2336956] with 0 mismatches
+	Amplimer length: 217058 bp
+Amplimer 12
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1135328] with 0 mismatches
+	Amplimer length: 1418686 bp
+Amplimer 13
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1129887] with 0 mismatches
+	Amplimer length: 1424127 bp
+Amplimer 14
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1125487] with 0 mismatches
+	Amplimer length: 1428527 bp
+Amplimer 15
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1121489] with 0 mismatches
+	Amplimer length: 1432525 bp
+Amplimer 16
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	AGCTCCTCTTCGTTGAATGC hits reverse strand at [1116372] with 0 mismatches
+	Amplimer length: 1437642 bp
+Amplimer 17
+	Sequence: CP000967  
+	
+	AGCTCCTCTTCGTTGAATGC hits forward strand at 1645295 with 0 mismatches
+	CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches
+	Amplimer length: 226 bp
+Amplimer 18
+	Sequence: CP000967  
+	
+	AGCTCCTCTTCGTTGAATGC hits forward strand at 559164 with 0 mismatches
+	CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches
+	Amplimer length: 1086357 bp
+
+Primer name 233
+Amplimer 1
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2341699] with 0 mismatches
+	Amplimer length: 228 bp
+Amplimer 2
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2336954] with 0 mismatches
+	Amplimer length: 4973 bp
+Amplimer 3
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1135326] with 0 mismatches
+	Amplimer length: 1206601 bp
+Amplimer 4
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1129885] with 0 mismatches
+	Amplimer length: 1212042 bp
+Amplimer 5
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1125485] with 0 mismatches
+	Amplimer length: 1216442 bp
+Amplimer 6
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1121487] with 0 mismatches
+	Amplimer length: 1220440 bp
+Amplimer 7
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1116370] with 0 mismatches
+	Amplimer length: 1225557 bp
+Amplimer 8
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2553786] with 0 mismatches
+	Amplimer length: 228 bp
+Amplimer 9
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2549041] with 0 mismatches
+	Amplimer length: 4973 bp
+Amplimer 10
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2341699] with 0 mismatches
+	Amplimer length: 212315 bp
+Amplimer 11
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2336954] with 0 mismatches
+	Amplimer length: 217060 bp
+Amplimer 12
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1135326] with 0 mismatches
+	Amplimer length: 1418688 bp
+Amplimer 13
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1129885] with 0 mismatches
+	Amplimer length: 1424129 bp
+Amplimer 14
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1125485] with 0 mismatches
+	Amplimer length: 1428529 bp
+Amplimer 15
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1121487] with 0 mismatches
+	Amplimer length: 1432527 bp
+Amplimer 16
+	Sequence: CP000967  
+	
+	CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches
+	CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1116370] with 0 mismatches
+	Amplimer length: 1437644 bp
+Amplimer 17
+	Sequence: CP000967  
+	
+	CGAGCTCCTCTTCGTTGAAT hits forward strand at 1645293 with 0 mismatches
+	CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches
+	Amplimer length: 228 bp
+Amplimer 18
+	Sequence: CP000967  
+	
+	CGAGCTCCTCTTCGTTGAAT hits forward strand at 559162 with 0 mismatches
+	CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches
+	Amplimer length: 1086359 bp
+
+Primer name 248
+Amplimer 1
+	Sequence: CP000967  
+	
+	CCAGACCTTGACGCTGGAC hits forward strand at 1857781 with 0 mismatches
+	CCGGTGTTCCGAAGGAGAT hits reverse strand at [3382096] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 249
+Amplimer 1
+	Sequence: CP000967  
+	
+	CCAGACCTTGACGCTGGA hits forward strand at 1857781 with 0 mismatches
+	CCGGTGTTCCGAAGGAGAT hits reverse strand at [3382096] with 0 mismatches
+	Amplimer length: 200 bp
+
+Primer name 250
+Amplimer 1
+	Sequence: CP000967  
+	
+	ATACGCTCACTGCCACCTG hits forward strand at 1858071 with 0 mismatches
+	CCAAGTCGGATTGGTCTGAT hits reverse strand at [3381805] with 0 mismatches
+	Amplimer length: 201 bp
+
+Primer name 251
+Amplimer 1
+	Sequence: CP000967  
+	
+	GATACGCTCACTGCCACCTG hits forward strand at 1858070 with 0 mismatches
+	AAGTCGGATTGGTCTGATGC hits reverse strand at [3381807] with 0 mismatches
+	Amplimer length: 200 bp