Mercurial > repos > dereeper > uniqprimer
comparison uniqprimer-0.5.0/tmpPHilD4/tmpoutputprimers2.ps1 @ 0:cdd8f911ad91 draft
Uploaded
| author | dereeper |
|---|---|
| date | Fri, 07 Oct 2016 04:18:11 -0400 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:cdd8f911ad91 |
|---|---|
| 1 | |
| 2 Primer name 18 | |
| 3 Amplimer 1 | |
| 4 Sequence: CP000967 | |
| 5 | |
| 6 GATGGACCGGGTAAAAACCT hits forward strand at 117992 with 0 mismatches | |
| 7 TCGAAGTTGTCGTAGCTCCA hits reverse strand at [5121883] with 0 mismatches | |
| 8 Amplimer length: 202 bp | |
| 9 | |
| 10 Primer name 19 | |
| 11 Amplimer 1 | |
| 12 Sequence: CP000967 | |
| 13 | |
| 14 AGATGGACCGGGTAAAAACC hits forward strand at 117991 with 0 mismatches | |
| 15 TCGAAGTTGTCGTAGCTCCA hits reverse strand at [5121883] with 0 mismatches | |
| 16 Amplimer length: 203 bp | |
| 17 | |
| 18 Primer name 20 | |
| 19 Amplimer 1 | |
| 20 Sequence: CP000967 | |
| 21 | |
| 22 TCAATCAAGTGCGCTGCTAT hits forward strand at 3269992 with 0 mismatches | |
| 23 CGGCTACTACATTGGCAGGT hits reverse strand at [1969885] with 0 mismatches | |
| 24 Amplimer length: 200 bp | |
| 25 | |
| 26 Primer name 21 | |
| 27 Amplimer 1 | |
| 28 Sequence: CP000967 | |
| 29 | |
| 30 ATCAATCAAGTGCGCTGCTA hits forward strand at 3269991 with 0 mismatches | |
| 31 CGGCTACTACATTGGCAGGT hits reverse strand at [1969885] with 0 mismatches | |
| 32 Amplimer length: 201 bp | |
| 33 | |
| 34 Primer name 22 | |
| 35 Amplimer 1 | |
| 36 Sequence: CP000967 | |
| 37 | |
| 38 GTACAGATCGCCGAGCACTT hits forward strand at 1180498 with 0 mismatches | |
| 39 CCAATCCAGACTTGCGCTAT hits reverse strand at [4059377] with 0 mismatches | |
| 40 Amplimer length: 202 bp | |
| 41 | |
| 42 Primer name 23 | |
| 43 Amplimer 1 | |
| 44 Sequence: CP000967 | |
| 45 | |
| 46 GTACAGATCGCCGAGCACTT hits forward strand at 1180498 with 0 mismatches | |
| 47 CAATCCAGACTTGCGCTATG hits reverse strand at [4059378] with 0 mismatches | |
| 48 Amplimer length: 201 bp | |
| 49 | |
| 50 Primer name 30 | |
| 51 Amplimer 1 | |
| 52 Sequence: CP000967 | |
| 53 | |
| 54 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 55 GCTGGATTTTTGTTGCAGTC hits reverse strand at [5100760] with 0 mismatches | |
| 56 Amplimer length: 206 bp | |
| 57 Amplimer 2 | |
| 58 Sequence: CP000967 | |
| 59 | |
| 60 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 61 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3850284] with 0 mismatches | |
| 62 Amplimer length: 1250682 bp | |
| 63 Amplimer 3 | |
| 64 Sequence: CP000967 | |
| 65 | |
| 66 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 67 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3679829] with 0 mismatches | |
| 68 Amplimer length: 1421137 bp | |
| 69 Amplimer 4 | |
| 70 Sequence: CP000967 | |
| 71 | |
| 72 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 73 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3511484] with 0 mismatches | |
| 74 Amplimer length: 1589482 bp | |
| 75 Amplimer 5 | |
| 76 Sequence: CP000967 | |
| 77 | |
| 78 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 79 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3143025] with 0 mismatches | |
| 80 Amplimer length: 1957941 bp | |
| 81 Amplimer 6 | |
| 82 Sequence: CP000967 | |
| 83 | |
| 84 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 85 GCTGGATTTTTGTTGCAGTC hits reverse strand at [3141976] with 0 mismatches | |
| 86 Amplimer length: 1958990 bp | |
| 87 Amplimer 7 | |
| 88 Sequence: CP000967 | |
| 89 | |
| 90 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 91 GCTGGATTTTTGTTGCAGTC hits reverse strand at [2814761] with 0 mismatches | |
| 92 Amplimer length: 2286205 bp | |
| 93 Amplimer 8 | |
| 94 Sequence: CP000967 | |
| 95 | |
| 96 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 97 GCTGGATTTTTGTTGCAGTC hits reverse strand at [2529194] with 0 mismatches | |
| 98 Amplimer length: 2571772 bp | |
| 99 Amplimer 9 | |
| 100 Sequence: CP000967 | |
| 101 | |
| 102 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 103 GCTGGATTTTTGTTGCAGTC hits reverse strand at [2317107] with 0 mismatches | |
| 104 Amplimer length: 2783859 bp | |
| 105 Amplimer 10 | |
| 106 Sequence: CP000967 | |
| 107 | |
| 108 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 109 GCTGGATTTTTGTTGCAGTC hits reverse strand at [1973706] with 0 mismatches | |
| 110 Amplimer length: 3127260 bp | |
| 111 Amplimer 11 | |
| 112 Sequence: CP000967 | |
| 113 | |
| 114 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 115 GCTGGATTTTTGTTGCAGTC hits reverse strand at [1742289] with 0 mismatches | |
| 116 Amplimer length: 3358677 bp | |
| 117 Amplimer 12 | |
| 118 Sequence: CP000967 | |
| 119 | |
| 120 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 121 GCTGGATTTTTGTTGCAGTC hits reverse strand at [1702515] with 0 mismatches | |
| 122 Amplimer length: 3398451 bp | |
| 123 Amplimer 13 | |
| 124 Sequence: CP000967 | |
| 125 | |
| 126 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 127 GCTGGATTTTTGTTGCAGTC hits reverse strand at [164617] with 0 mismatches | |
| 128 Amplimer length: 4936349 bp | |
| 129 Amplimer 14 | |
| 130 Sequence: CP000967 | |
| 131 | |
| 132 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 133 GCTGGATTTTTGTTGCAGTC hits reverse strand at [76745] with 0 mismatches | |
| 134 Amplimer length: 5024221 bp | |
| 135 | |
| 136 Primer name 31 | |
| 137 Amplimer 1 | |
| 138 Sequence: CP000967 | |
| 139 | |
| 140 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 141 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [5100759] with 0 mismatches | |
| 142 Amplimer length: 207 bp | |
| 143 Amplimer 2 | |
| 144 Sequence: CP000967 | |
| 145 | |
| 146 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 147 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3850283] with 0 mismatches | |
| 148 Amplimer length: 1250683 bp | |
| 149 Amplimer 3 | |
| 150 Sequence: CP000967 | |
| 151 | |
| 152 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 153 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3679828] with 0 mismatches | |
| 154 Amplimer length: 1421138 bp | |
| 155 Amplimer 4 | |
| 156 Sequence: CP000967 | |
| 157 | |
| 158 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 159 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3511483] with 0 mismatches | |
| 160 Amplimer length: 1589483 bp | |
| 161 Amplimer 5 | |
| 162 Sequence: CP000967 | |
| 163 | |
| 164 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 165 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3143024] with 0 mismatches | |
| 166 Amplimer length: 1957942 bp | |
| 167 Amplimer 6 | |
| 168 Sequence: CP000967 | |
| 169 | |
| 170 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 171 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [3141975] with 0 mismatches | |
| 172 Amplimer length: 1958991 bp | |
| 173 Amplimer 7 | |
| 174 Sequence: CP000967 | |
| 175 | |
| 176 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 177 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2814760] with 0 mismatches | |
| 178 Amplimer length: 2286206 bp | |
| 179 Amplimer 8 | |
| 180 Sequence: CP000967 | |
| 181 | |
| 182 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 183 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2529193] with 0 mismatches | |
| 184 Amplimer length: 2571773 bp | |
| 185 Amplimer 9 | |
| 186 Sequence: CP000967 | |
| 187 | |
| 188 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 189 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [2317106] with 0 mismatches | |
| 190 Amplimer length: 2783860 bp | |
| 191 Amplimer 10 | |
| 192 Sequence: CP000967 | |
| 193 | |
| 194 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 195 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1973705] with 0 mismatches | |
| 196 Amplimer length: 3127261 bp | |
| 197 Amplimer 11 | |
| 198 Sequence: CP000967 | |
| 199 | |
| 200 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 201 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1742288] with 0 mismatches | |
| 202 Amplimer length: 3358678 bp | |
| 203 Amplimer 12 | |
| 204 Sequence: CP000967 | |
| 205 | |
| 206 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 207 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [1702514] with 0 mismatches | |
| 208 Amplimer length: 3398452 bp | |
| 209 Amplimer 13 | |
| 210 Sequence: CP000967 | |
| 211 | |
| 212 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 213 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [164616] with 0 mismatches | |
| 214 Amplimer length: 4936350 bp | |
| 215 Amplimer 14 | |
| 216 Sequence: CP000967 | |
| 217 | |
| 218 TCGATTCAAAGCCTTACCTGA hits forward strand at 139111 with 0 mismatches | |
| 219 AGCTGGATTTTTGTTGCAGTC hits reverse strand at [76744] with 0 mismatches | |
| 220 Amplimer length: 5024222 bp | |
| 221 | |
| 222 Primer name 32 | |
| 223 Amplimer 1 | |
| 224 Sequence: CP000967 | |
| 225 | |
| 226 ATCTGTCCGGGTTGGACTC hits forward strand at 1212161 with 0 mismatches | |
| 227 GGTCTTGAGCACTTCCGAAC hits reverse strand at [4027716] with 0 mismatches | |
| 228 Amplimer length: 200 bp | |
| 229 | |
| 230 Primer name 33 | |
| 231 Amplimer 1 | |
| 232 Sequence: CP000967 | |
| 233 | |
| 234 CAGATCATGTACCCGGTGCT hits forward strand at 1212445 with 0 mismatches | |
| 235 GCATCGCTGATGAAGTCGTA hits reverse strand at [4027423] with 0 mismatches | |
| 236 Amplimer length: 209 bp | |
| 237 | |
| 238 Primer name 34 | |
| 239 Amplimer 1 | |
| 240 Sequence: CP000967 | |
| 241 | |
| 242 CAGTAGCAACCCCTTCAGGT hits forward strand at 178116 with 0 mismatches | |
| 243 CGTTCGGGTTCTTAGTTCCA hits reverse strand at [5061759] with 0 mismatches | |
| 244 Amplimer length: 202 bp | |
| 245 Amplimer 2 | |
| 246 Sequence: CP000967 | |
| 247 | |
| 248 CAGTAGCAACCCCTTCAGGT hits forward strand at 115447 with 0 mismatches | |
| 249 CGTTCGGGTTCTTAGTTCCA hits reverse strand at [5061759] with 0 mismatches | |
| 250 Amplimer length: 62871 bp | |
| 251 | |
| 252 Primer name 36 | |
| 253 Amplimer 1 | |
| 254 Sequence: CP000967 | |
| 255 | |
| 256 GGACAGCCCTGTATGGAAAA hits forward strand at 2282909 with 0 mismatches | |
| 257 TGGAAGAAGCAGTTGCCAGT hits reverse strand at [2956968] with 0 mismatches | |
| 258 Amplimer length: 200 bp | |
| 259 | |
| 260 Primer name 37 | |
| 261 Amplimer 1 | |
| 262 Sequence: CP000967 | |
| 263 | |
| 264 GGACAGCCCTGTATGGAAAA hits forward strand at 2282909 with 0 mismatches | |
| 265 GGAGCTGACTGGAAGAAGCA hits reverse strand at [2956959] with 0 mismatches | |
| 266 Amplimer length: 209 bp | |
| 267 | |
| 268 Primer name 38 | |
| 269 Amplimer 1 | |
| 270 Sequence: CP000967 | |
| 271 | |
| 272 AAGCAGGTCTGGAACACCAC hits forward strand at 2284341 with 0 mismatches | |
| 273 GGAGTGCGTTAAAGCAGGTG hits reverse strand at [2955531] with 0 mismatches | |
| 274 Amplimer length: 205 bp | |
| 275 | |
| 276 Primer name 40 | |
| 277 Amplimer 1 | |
| 278 Sequence: CP000967 | |
| 279 | |
| 280 GCTTTGACCTTGTGGTCCAT hits forward strand at 2287923 with 0 mismatches | |
| 281 CCAGATCAGCGTCAGTGGTA hits reverse strand at [2951941] with 0 mismatches | |
| 282 Amplimer length: 213 bp | |
| 283 | |
| 284 Primer name 41 | |
| 285 Amplimer 1 | |
| 286 Sequence: CP000967 | |
| 287 | |
| 288 CAAATGAGACGTCTGCGGTA hits forward strand at 2288283 with 0 mismatches | |
| 289 TGCCTTTGTAGCACTGTGGA hits reverse strand at [2951589] with 0 mismatches | |
| 290 Amplimer length: 205 bp | |
| 291 | |
| 292 Primer name 42 | |
| 293 Amplimer 1 | |
| 294 Sequence: CP000967 | |
| 295 | |
| 296 CGTCATCAAACCAGACCTGA hits forward strand at 2289726 with 0 mismatches | |
| 297 TGGACTAGAAGCGCCTTGAT hits reverse strand at [2950147] with 0 mismatches | |
| 298 Amplimer length: 204 bp | |
| 299 | |
| 300 Primer name 43 | |
| 301 Amplimer 1 | |
| 302 Sequence: CP000967 | |
| 303 | |
| 304 AAACGCTAAGCCGGTACTGA hits forward strand at 2289795 with 0 mismatches | |
| 305 GTGATGATGTCGAGCGTGTC hits reverse strand at [2950069] with 0 mismatches | |
| 306 Amplimer length: 213 bp | |
| 307 | |
| 308 Primer name 44 | |
| 309 Amplimer 1 | |
| 310 Sequence: CP000967 | |
| 311 | |
| 312 CTGAAGGCAACGTTCTGCTA hits forward strand at 2290117 with 0 mismatches | |
| 313 GTCTCCCATTTGCCCTGAT hits reverse strand at [2949757] with 0 mismatches | |
| 314 Amplimer length: 203 bp | |
| 315 | |
| 316 Primer name 45 | |
| 317 Amplimer 1 | |
| 318 Sequence: CP000967 | |
| 319 | |
| 320 GAAGGCAACGTTCTGCTACG hits forward strand at 2290119 with 0 mismatches | |
| 321 GTCTCCCATTTGCCCTGAT hits reverse strand at [2949757] with 0 mismatches | |
| 322 Amplimer length: 201 bp | |
| 323 | |
| 324 Primer name 46 | |
| 325 Amplimer 1 | |
| 326 Sequence: CP000967 | |
| 327 | |
| 328 CGCAAGGTATCCAGTTCCTG hits forward strand at 2293873 with 0 mismatches | |
| 329 GGACCTCAGTGAAGGAGCAG hits reverse strand at [2945969] with 0 mismatches | |
| 330 Amplimer length: 235 bp | |
| 331 | |
| 332 Primer name 47 | |
| 333 Amplimer 1 | |
| 334 Sequence: CP000967 | |
| 335 | |
| 336 GGTATCCAGTTCCTGCTGCT hits forward strand at 2293878 with 0 mismatches | |
| 337 AGCACTACCGGACCTCAGTG hits reverse strand at [2945960] with 0 mismatches | |
| 338 Amplimer length: 239 bp | |
| 339 | |
| 340 Primer name 48 | |
| 341 Amplimer 1 | |
| 342 Sequence: CP000967 | |
| 343 | |
| 344 CGCAGCTGGTATGGATTTCT hits forward strand at 2296700 with 0 mismatches | |
| 345 ATCACAGCGCACAGCATAAG hits reverse strand at [2943175] with 0 mismatches | |
| 346 Amplimer length: 202 bp | |
| 347 | |
| 348 Primer name 49 | |
| 349 Amplimer 1 | |
| 350 Sequence: CP000967 | |
| 351 | |
| 352 CGGACATGTACGACGAGTTG hits forward strand at 2296936 with 0 mismatches | |
| 353 GACTCCCAAACCTGGAACAA hits reverse strand at [2942936] with 0 mismatches | |
| 354 Amplimer length: 205 bp | |
| 355 | |
| 356 Primer name 50 | |
| 357 Amplimer 1 | |
| 358 Sequence: CP000967 | |
| 359 | |
| 360 GTCACGATCCCGAATCAATC hits forward strand at 2299531 with 0 mismatches | |
| 361 GACAGTTCTTCGGCGTTCTC hits reverse strand at [2940346] with 0 mismatches | |
| 362 Amplimer length: 200 bp | |
| 363 | |
| 364 Primer name 51 | |
| 365 Amplimer 1 | |
| 366 Sequence: CP000967 | |
| 367 | |
| 368 TGGCGACTATGTCGGATGTA hits forward strand at 2303661 with 0 mismatches | |
| 369 GATGGTAGCGCGATGACTTT hits reverse strand at [2936216] with 0 mismatches | |
| 370 Amplimer length: 200 bp | |
| 371 | |
| 372 Primer name 59 | |
| 373 Amplimer 1 | |
| 374 Sequence: CP000967 | |
| 375 | |
| 376 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches | |
| 377 CATGCTCTGCGACGTAAAGA hits reverse strand at [1858272] with 0 mismatches | |
| 378 Amplimer length: 201 bp | |
| 379 Amplimer 2 | |
| 380 Sequence: CP000967 | |
| 381 | |
| 382 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches | |
| 383 CATGCTCTGCGACGTAAAGA hits reverse strand at [1532947] with 0 mismatches | |
| 384 Amplimer length: 325526 bp | |
| 385 Amplimer 3 | |
| 386 Sequence: CP000967 | |
| 387 | |
| 388 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches | |
| 389 CATGCTCTGCGACGTAAAGA hits reverse strand at [1523620] with 0 mismatches | |
| 390 Amplimer length: 334853 bp | |
| 391 Amplimer 4 | |
| 392 Sequence: CP000967 | |
| 393 | |
| 394 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches | |
| 395 CATGCTCTGCGACGTAAAGA hits reverse strand at [851396] with 0 mismatches | |
| 396 Amplimer length: 1007077 bp | |
| 397 Amplimer 5 | |
| 398 Sequence: CP000967 | |
| 399 | |
| 400 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches | |
| 401 CATGCTCTGCGACGTAAAGA hits reverse strand at [817783] with 0 mismatches | |
| 402 Amplimer length: 1040690 bp | |
| 403 Amplimer 6 | |
| 404 Sequence: CP000967 | |
| 405 | |
| 406 AAAATCCATCGGCGAAGTAA hits forward strand at 3381604 with 0 mismatches | |
| 407 CATGCTCTGCGACGTAAAGA hits reverse strand at [219270] with 0 mismatches | |
| 408 Amplimer length: 1639203 bp | |
| 409 | |
| 410 Primer name 60 | |
| 411 Amplimer 1 | |
| 412 Sequence: CP000967 | |
| 413 | |
| 414 GGATTGGTTGATCGATACGC hits forward strand at 3390600 with 0 mismatches | |
| 415 TCCCTAGCCGAAGAGCACTA hits reverse strand at [1849272] with 0 mismatches | |
| 416 Amplimer length: 205 bp | |
| 417 | |
| 418 Primer name 61 | |
| 419 Amplimer 1 | |
| 420 Sequence: CP000967 | |
| 421 | |
| 422 GCGAGAACTTTCATCCGAAG hits forward strand at 3390758 with 0 mismatches | |
| 423 CTTACGACGCAAAATGCAAA hits reverse strand at [1849106] with 0 mismatches | |
| 424 Amplimer length: 213 bp | |
| 425 | |
| 426 Primer name 62 | |
| 427 Amplimer 1 | |
| 428 Sequence: CP000967 | |
| 429 | |
| 430 GCACCGACATGAAGTTCCTC hits forward strand at 3391195 with 0 mismatches | |
| 431 TCAGGCAGTTCTTCCAGGTC hits reverse strand at [1848657] with 0 mismatches | |
| 432 Amplimer length: 225 bp | |
| 433 | |
| 434 Primer name 63 | |
| 435 Amplimer 1 | |
| 436 Sequence: CP000967 | |
| 437 | |
| 438 GGGAGGAGGTCTTCTTCCAT hits forward strand at 3391165 with 0 mismatches | |
| 439 CGTACTTGTCCAATGGATGCT hits reverse strand at [1848696] with 0 mismatches | |
| 440 Amplimer length: 216 bp | |
| 441 | |
| 442 Primer name 67 | |
| 443 Amplimer 1 | |
| 444 Sequence: CP000967 | |
| 445 | |
| 446 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches | |
| 447 CAAAGCTGCAACTGGTCAAG hits reverse strand at [3905281] with 0 mismatches | |
| 448 Amplimer length: 209 bp | |
| 449 Amplimer 2 | |
| 450 Sequence: CP000967 | |
| 451 | |
| 452 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches | |
| 453 CAAAGCTGCAACTGGTCAAG hits reverse strand at [3769446] with 0 mismatches | |
| 454 Amplimer length: 136044 bp | |
| 455 Amplimer 3 | |
| 456 Sequence: CP000967 | |
| 457 | |
| 458 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches | |
| 459 CAAAGCTGCAACTGGTCAAG hits reverse strand at [3359403] with 0 mismatches | |
| 460 Amplimer length: 546087 bp | |
| 461 Amplimer 4 | |
| 462 Sequence: CP000967 | |
| 463 | |
| 464 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches | |
| 465 CAAAGCTGCAACTGGTCAAG hits reverse strand at [2829994] with 0 mismatches | |
| 466 Amplimer length: 1075496 bp | |
| 467 Amplimer 5 | |
| 468 Sequence: CP000967 | |
| 469 | |
| 470 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches | |
| 471 CAAAGCTGCAACTGGTCAAG hits reverse strand at [2022434] with 0 mismatches | |
| 472 Amplimer length: 1883056 bp | |
| 473 Amplimer 6 | |
| 474 Sequence: CP000967 | |
| 475 | |
| 476 TTGCAAAGGACACCACAATC hits forward strand at 1334587 with 0 mismatches | |
| 477 CAAAGCTGCAACTGGTCAAG hits reverse strand at [37285] with 0 mismatches | |
| 478 Amplimer length: 3868205 bp | |
| 479 | |
| 480 Primer name 78 | |
| 481 Amplimer 1 | |
| 482 Sequence: CP000967 | |
| 483 | |
| 484 CGCCAACTGAACGAAAGCTA hits forward strand at 4520084 with 0 mismatches | |
| 485 AAGCGGGGTTTTTCGTAACT hits reverse strand at [719784] with 0 mismatches | |
| 486 Amplimer length: 209 bp | |
| 487 | |
| 488 Primer name 79 | |
| 489 Amplimer 1 | |
| 490 Sequence: CP000967 | |
| 491 | |
| 492 ACCACCGTTCTAGTGCATCG hits forward strand at 4520057 with 0 mismatches | |
| 493 TGCAAAGGGAGCTTGTATGA hits reverse strand at [719814] with 0 mismatches | |
| 494 Amplimer length: 206 bp | |
| 495 | |
| 496 Primer name 86 | |
| 497 Amplimer 1 | |
| 498 Sequence: CP000967 | |
| 499 | |
| 500 ACAGGACAGAGCCTTTACCG hits forward strand at 1393082 with 0 mismatches | |
| 501 TTACGCCACCCTTACTTTGC hits reverse strand at [3846793] with 0 mismatches | |
| 502 Amplimer length: 202 bp | |
| 503 | |
| 504 Primer name 87 | |
| 505 Amplimer 1 | |
| 506 Sequence: CP000967 | |
| 507 | |
| 508 ACGTTGGATGCGATCCTAGA hits forward strand at 1392471 with 0 mismatches | |
| 509 GGCGAATTGTGAGGTGAAAT hits reverse strand at [3847402] with 0 mismatches | |
| 510 Amplimer length: 204 bp | |
| 511 | |
| 512 Primer name 88 | |
| 513 Amplimer 1 | |
| 514 Sequence: CP000967 | |
| 515 | |
| 516 ATAAGCGCATCCTTCCTCAA hits forward strand at 1395162 with 0 mismatches | |
| 517 TGCCGTCTTCTTCATGTTCA hits reverse strand at [3844711] with 0 mismatches | |
| 518 Amplimer length: 204 bp | |
| 519 | |
| 520 Primer name 89 | |
| 521 Amplimer 1 | |
| 522 Sequence: CP000967 | |
| 523 | |
| 524 TGTCCGCAACCTGTTTACAA hits forward strand at 1395245 with 0 mismatches | |
| 525 GACGTTGTTGAACGCCTCTT hits reverse strand at [3844625] with 0 mismatches | |
| 526 Amplimer length: 207 bp | |
| 527 | |
| 528 Primer name 90 | |
| 529 Amplimer 1 | |
| 530 Sequence: CP000967 | |
| 531 | |
| 532 CGGTAGGCCCACTATGTTGT hits forward strand at 4544185 with 0 mismatches | |
| 533 CTTGTTCTGCCCGTTTCAAT hits reverse strand at [695692] with 0 mismatches | |
| 534 Amplimer length: 200 bp | |
| 535 | |
| 536 Primer name 91 | |
| 537 Amplimer 1 | |
| 538 Sequence: CP000967 | |
| 539 | |
| 540 CGAGACGGTGTAGTTGTGGA hits forward strand at 4543920 with 0 mismatches | |
| 541 CCTGCAAACTGGGTTTCAAT hits reverse strand at [695955] with 0 mismatches | |
| 542 Amplimer length: 202 bp | |
| 543 | |
| 544 Primer name 92 | |
| 545 Amplimer 1 | |
| 546 Sequence: CP000967 | |
| 547 | |
| 548 GAAACCCCTTGGTGCCTATT hits forward strand at 4544891 with 0 mismatches | |
| 549 AACGCGTTGTTTCAATCCA hits reverse strand at [694975] with 0 mismatches | |
| 550 Amplimer length: 211 bp | |
| 551 | |
| 552 Primer name 93 | |
| 553 Amplimer 1 | |
| 554 Sequence: CP000967 | |
| 555 | |
| 556 TGGTGCCTATTGTGCCTAAA hits forward strand at 4544900 with 0 mismatches | |
| 557 AACGCGTTGTTTCAATCCA hits reverse strand at [694975] with 0 mismatches | |
| 558 Amplimer length: 202 bp | |
| 559 | |
| 560 Primer name 96 | |
| 561 Amplimer 1 | |
| 562 Sequence: CP000967 | |
| 563 | |
| 564 GCACTCAAACCCCTGATTTT hits forward strand at 3531207 with 0 mismatches | |
| 565 GGGTGATCAAGCGTCAGTTT hits reverse strand at [1708664] with 0 mismatches | |
| 566 Amplimer length: 206 bp | |
| 567 Amplimer 2 | |
| 568 Sequence: CP000967 | |
| 569 | |
| 570 GCACTCAAACCCCTGATTTT hits forward strand at 3531207 with 0 mismatches | |
| 571 GGGTGATCAAGCGTCAGTTT hits reverse strand at [1301984] with 0 mismatches | |
| 572 Amplimer length: 406886 bp | |
| 573 | |
| 574 Primer name 97 | |
| 575 Amplimer 1 | |
| 576 Sequence: CP000967 | |
| 577 | |
| 578 CATTAGCTCACCGTCTTTCG hits forward strand at 3531125 with 0 mismatches | |
| 579 TGTCGAATCTGTGGCTGAAG hits reverse strand at [1708751] with 0 mismatches | |
| 580 Amplimer length: 201 bp | |
| 581 Amplimer 2 | |
| 582 Sequence: CP000967 | |
| 583 | |
| 584 CATTAGCTCACCGTCTTTCG hits forward strand at 3531125 with 0 mismatches | |
| 585 TGTCGAATCTGTGGCTGAAG hits reverse strand at [1302071] with 0 mismatches | |
| 586 Amplimer length: 406881 bp | |
| 587 | |
| 588 Primer name 100 | |
| 589 Amplimer 1 | |
| 590 Sequence: CP000967 | |
| 591 | |
| 592 GCCTCGACTTTGGATAGTGC hits forward strand at 3532106 with 0 mismatches | |
| 593 CTCTGAACAACTCCCCCTGA hits reverse strand at [1707771] with 0 mismatches | |
| 594 Amplimer length: 200 bp | |
| 595 | |
| 596 Primer name 101 | |
| 597 Amplimer 1 | |
| 598 Sequence: CP000967 | |
| 599 | |
| 600 GCTGCCTCGACTTTGGATAG hits forward strand at 3532103 with 0 mismatches | |
| 601 CTCTGAACAACTCCCCCTGA hits reverse strand at [1707771] with 0 mismatches | |
| 602 Amplimer length: 203 bp | |
| 603 | |
| 604 Primer name 102 | |
| 605 Amplimer 1 | |
| 606 Sequence: CP000967 | |
| 607 | |
| 608 GCATCCACACGCCTATTCTT hits forward strand at 3532551 with 0 mismatches | |
| 609 CTTGCTCTTCAAGGGGTCTG hits reverse strand at [1707311] with 0 mismatches | |
| 610 Amplimer length: 215 bp | |
| 611 | |
| 612 Primer name 103 | |
| 613 Amplimer 1 | |
| 614 Sequence: CP000967 | |
| 615 | |
| 616 AAGCATCCACACGCCTATTC hits forward strand at 3532549 with 0 mismatches | |
| 617 CTTGCTCTTCAAGGGGTCTG hits reverse strand at [1707311] with 0 mismatches | |
| 618 Amplimer length: 217 bp | |
| 619 | |
| 620 Primer name 104 | |
| 621 Amplimer 1 | |
| 622 Sequence: CP000967 | |
| 623 | |
| 624 AACGCATCGGCAAAATAATC hits forward strand at 3537809 with 0 mismatches | |
| 625 GTCTAACATGGGGGTTGTCG hits reverse strand at [1702068] with 0 mismatches | |
| 626 Amplimer length: 200 bp | |
| 627 | |
| 628 Primer name 105 | |
| 629 Amplimer 1 | |
| 630 Sequence: CP000967 | |
| 631 | |
| 632 GCGACCTGCTTTTAGACCTG hits forward strand at 3538657 with 0 mismatches | |
| 633 GCAAAGTCCACTTGCACAGA hits reverse strand at [1701215] with 0 mismatches | |
| 634 Amplimer length: 205 bp | |
| 635 | |
| 636 Primer name 106 | |
| 637 Amplimer 1 | |
| 638 Sequence: CP000967 | |
| 639 | |
| 640 ATCGTCCTGACACCGGATAG hits forward strand at 4594076 with 0 mismatches | |
| 641 CTGAACAACGCACCACAAAT hits reverse strand at [645801] with 0 mismatches | |
| 642 Amplimer length: 200 bp | |
| 643 | |
| 644 Primer name 117 | |
| 645 Amplimer 1 | |
| 646 Sequence: CP000967 | |
| 647 | |
| 648 GGCTATCTACGCCGATGAAG hits forward strand at 2835420 with 0 mismatches | |
| 649 GGCACAGCTGGTAATCCAGT hits reverse strand at [2404454] with 0 mismatches | |
| 650 Amplimer length: 203 bp | |
| 651 Amplimer 2 | |
| 652 Sequence: CP000967 | |
| 653 | |
| 654 GGCTATCTACGCCGATGAAG hits forward strand at 2623333 with 0 mismatches | |
| 655 GGCACAGCTGGTAATCCAGT hits reverse strand at [2616541] with 0 mismatches | |
| 656 Amplimer length: 203 bp | |
| 657 Amplimer 3 | |
| 658 Sequence: CP000967 | |
| 659 | |
| 660 GGCTATCTACGCCGATGAAG hits forward strand at 2623333 with 0 mismatches | |
| 661 GGCACAGCTGGTAATCCAGT hits reverse strand at [2404454] with 0 mismatches | |
| 662 Amplimer length: 212290 bp | |
| 663 | |
| 664 Primer name 118 | |
| 665 Amplimer 1 | |
| 666 Sequence: CP000967 | |
| 667 | |
| 668 TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches | |
| 669 ACTTCCATGGCTGAAGGATG hits reverse strand at [3663799] with 0 mismatches | |
| 670 Amplimer length: 206 bp | |
| 671 Amplimer 2 | |
| 672 Sequence: CP000967 | |
| 673 | |
| 674 TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches | |
| 675 ACTTCCATGGCTGAAGGATG hits reverse strand at [2582728] with 0 mismatches | |
| 676 Amplimer length: 1081277 bp | |
| 677 Amplimer 3 | |
| 678 Sequence: CP000967 | |
| 679 | |
| 680 TGGCTCGGCCATCTCTATAA hits forward strand at 1576072 with 0 mismatches | |
| 681 ACTTCCATGGCTGAAGGATG hits reverse strand at [2370641] with 0 mismatches | |
| 682 Amplimer length: 1293364 bp | |
| 683 | |
| 684 Primer name 122 | |
| 685 Amplimer 1 | |
| 686 Sequence: CP000967 | |
| 687 | |
| 688 TCCAAAGCGTCTGGCTTTAT hits forward strand at 1578682 with 0 mismatches | |
| 689 TTGGCCGTAGAGGTATCGTC hits reverse strand at [3661190] with 0 mismatches | |
| 690 Amplimer length: 205 bp | |
| 691 | |
| 692 Primer name 123 | |
| 693 Amplimer 1 | |
| 694 Sequence: CP000967 | |
| 695 | |
| 696 AAAGGCCAGCATCAAGAAGA hits forward strand at 1578044 with 0 mismatches | |
| 697 TTGGCCTTTCAAAGAAGGTG hits reverse strand at [3661825] with 0 mismatches | |
| 698 Amplimer length: 208 bp | |
| 699 | |
| 700 Primer name 126 | |
| 701 Amplimer 1 | |
| 702 Sequence: CP000967 | |
| 703 | |
| 704 GTGCACTTCCGACAGCAAAT hits forward strand at 1580412 with 0 mismatches | |
| 705 CCGAGAAGTTGAGCAAGGAA hits reverse strand at [3659455] with 0 mismatches | |
| 706 Amplimer length: 210 bp | |
| 707 | |
| 708 Primer name 127 | |
| 709 Amplimer 1 | |
| 710 Sequence: CP000967 | |
| 711 | |
| 712 ATTGTGCACTTCCGACAGC hits forward strand at 1580409 with 0 mismatches | |
| 713 CCGAGAAGTTGAGCAAGGAA hits reverse strand at [3659455] with 0 mismatches | |
| 714 Amplimer length: 213 bp | |
| 715 | |
| 716 Primer name 128 | |
| 717 Amplimer 1 | |
| 718 Sequence: CP000967 | |
| 719 | |
| 720 ATGGCCAATTCCAGAGCATA hits forward strand at 1582841 with 0 mismatches | |
| 721 CCAACACAGTTTCGGATGTG hits reverse strand at [3657032] with 0 mismatches | |
| 722 Amplimer length: 204 bp | |
| 723 | |
| 724 Primer name 129 | |
| 725 Amplimer 1 | |
| 726 Sequence: CP000967 | |
| 727 | |
| 728 AAGGCAAGTACGCAGAGCAT hits forward strand at 1582552 with 0 mismatches | |
| 729 CCCAAGGACAGGATAGTTGC hits reverse strand at [3657313] with 0 mismatches | |
| 730 Amplimer length: 212 bp | |
| 731 | |
| 732 Primer name 130 | |
| 733 Amplimer 1 | |
| 734 Sequence: CP000967 | |
| 735 | |
| 736 CCAGCGTACTGATGTCGATG hits forward strand at 2848588 with 0 mismatches | |
| 737 CTTCGACAAAACGCACTCAA hits reverse strand at [2391289] with 0 mismatches | |
| 738 Amplimer length: 200 bp | |
| 739 Amplimer 2 | |
| 740 Sequence: CP000967 | |
| 741 | |
| 742 CCAGCGTACTGATGTCGATG hits forward strand at 2636501 with 0 mismatches | |
| 743 CTTCGACAAAACGCACTCAA hits reverse strand at [2603376] with 0 mismatches | |
| 744 Amplimer length: 200 bp | |
| 745 Amplimer 3 | |
| 746 Sequence: CP000967 | |
| 747 | |
| 748 CCAGCGTACTGATGTCGATG hits forward strand at 2636501 with 0 mismatches | |
| 749 CTTCGACAAAACGCACTCAA hits reverse strand at [2391289] with 0 mismatches | |
| 750 Amplimer length: 212287 bp | |
| 751 | |
| 752 Primer name 151 | |
| 753 Amplimer 1 | |
| 754 Sequence: CP000967 | |
| 755 | |
| 756 CAGGACCGGAACCTTCATAA hits forward strand at 2874411 with 0 mismatches | |
| 757 CTATGGCTTGACCCTCGAAA hits reverse strand at [2365466] with 0 mismatches | |
| 758 Amplimer length: 200 bp | |
| 759 Amplimer 2 | |
| 760 Sequence: CP000967 | |
| 761 | |
| 762 CAGGACCGGAACCTTCATAA hits forward strand at 2662324 with 0 mismatches | |
| 763 CTATGGCTTGACCCTCGAAA hits reverse strand at [2577553] with 0 mismatches | |
| 764 Amplimer length: 200 bp | |
| 765 Amplimer 3 | |
| 766 Sequence: CP000967 | |
| 767 | |
| 768 CAGGACCGGAACCTTCATAA hits forward strand at 2662324 with 0 mismatches | |
| 769 CTATGGCTTGACCCTCGAAA hits reverse strand at [2365466] with 0 mismatches | |
| 770 Amplimer length: 212287 bp | |
| 771 | |
| 772 Primer name 152 | |
| 773 Amplimer 1 | |
| 774 Sequence: CP000967 | |
| 775 | |
| 776 GAGTTGTCGCCGGAAAAATA hits forward strand at 2880573 with 0 mismatches | |
| 777 GCTATTGGCAAAGCTTCGAT hits reverse strand at [2359300] with 0 mismatches | |
| 778 Amplimer length: 204 bp | |
| 779 Amplimer 2 | |
| 780 Sequence: CP000967 | |
| 781 | |
| 782 GAGTTGTCGCCGGAAAAATA hits forward strand at 2668486 with 0 mismatches | |
| 783 GCTATTGGCAAAGCTTCGAT hits reverse strand at [2571387] with 0 mismatches | |
| 784 Amplimer length: 204 bp | |
| 785 Amplimer 3 | |
| 786 Sequence: CP000967 | |
| 787 | |
| 788 GAGTTGTCGCCGGAAAAATA hits forward strand at 2668486 with 0 mismatches | |
| 789 GCTATTGGCAAAGCTTCGAT hits reverse strand at [2359300] with 0 mismatches | |
| 790 Amplimer length: 212291 bp | |
| 791 | |
| 792 Primer name 153 | |
| 793 Amplimer 1 | |
| 794 Sequence: CP000967 | |
| 795 | |
| 796 GCGATCGCCATCCTAGATAA hits forward strand at 2880644 with 0 mismatches | |
| 797 CCATAGGTGATGCCTTCTCG hits reverse strand at [2359232] with 0 mismatches | |
| 798 Amplimer length: 201 bp | |
| 799 Amplimer 2 | |
| 800 Sequence: CP000967 | |
| 801 | |
| 802 GCGATCGCCATCCTAGATAA hits forward strand at 2668557 with 0 mismatches | |
| 803 CCATAGGTGATGCCTTCTCG hits reverse strand at [2571319] with 0 mismatches | |
| 804 Amplimer length: 201 bp | |
| 805 Amplimer 3 | |
| 806 Sequence: CP000967 | |
| 807 | |
| 808 GCGATCGCCATCCTAGATAA hits forward strand at 2668557 with 0 mismatches | |
| 809 CCATAGGTGATGCCTTCTCG hits reverse strand at [2359232] with 0 mismatches | |
| 810 Amplimer length: 212288 bp | |
| 811 | |
| 812 Primer name 154 | |
| 813 Amplimer 1 | |
| 814 Sequence: CP000967 | |
| 815 | |
| 816 ACGACGCAGTCCCTGTTAGT hits forward strand at 2880896 with 0 mismatches | |
| 817 GCGGAATTAGCGGTATCTTG hits reverse strand at [2358974] with 0 mismatches | |
| 818 Amplimer length: 207 bp | |
| 819 Amplimer 2 | |
| 820 Sequence: CP000967 | |
| 821 | |
| 822 ACGACGCAGTCCCTGTTAGT hits forward strand at 2668809 with 0 mismatches | |
| 823 GCGGAATTAGCGGTATCTTG hits reverse strand at [2571061] with 0 mismatches | |
| 824 Amplimer length: 207 bp | |
| 825 Amplimer 3 | |
| 826 Sequence: CP000967 | |
| 827 | |
| 828 ACGACGCAGTCCCTGTTAGT hits forward strand at 2668809 with 0 mismatches | |
| 829 GCGGAATTAGCGGTATCTTG hits reverse strand at [2358974] with 0 mismatches | |
| 830 Amplimer length: 212294 bp | |
| 831 | |
| 832 Primer name 155 | |
| 833 Amplimer 1 | |
| 834 Sequence: CP000967 | |
| 835 | |
| 836 GCAGGATTGTCATCAGCGTA hits forward strand at 2881156 with 0 mismatches | |
| 837 TATGATCCGTATGGGGCAAC hits reverse strand at [2358718] with 0 mismatches | |
| 838 Amplimer length: 203 bp | |
| 839 Amplimer 2 | |
| 840 Sequence: CP000967 | |
| 841 | |
| 842 GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches | |
| 843 TATGATCCGTATGGGGCAAC hits reverse strand at [2570805] with 0 mismatches | |
| 844 Amplimer length: 203 bp | |
| 845 Amplimer 3 | |
| 846 Sequence: CP000967 | |
| 847 | |
| 848 GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches | |
| 849 TATGATCCGTATGGGGCAAC hits reverse strand at [2365098] with 0 mismatches | |
| 850 Amplimer length: 205910 bp | |
| 851 Amplimer 4 | |
| 852 Sequence: CP000967 | |
| 853 | |
| 854 GCAGGATTGTCATCAGCGTA hits forward strand at 2669069 with 0 mismatches | |
| 855 TATGATCCGTATGGGGCAAC hits reverse strand at [2358718] with 0 mismatches | |
| 856 Amplimer length: 212290 bp | |
| 857 | |
| 858 Primer name 162 | |
| 859 Amplimer 1 | |
| 860 Sequence: CP000967 | |
| 861 | |
| 862 TTTTGGCTGTGCTTTACACG hits forward strand at 2893326 with 0 mismatches | |
| 863 CGACATCACCCACTACATCG hits reverse strand at [2346551] with 0 mismatches | |
| 864 Amplimer length: 200 bp | |
| 865 Amplimer 2 | |
| 866 Sequence: CP000967 | |
| 867 | |
| 868 TTTTGGCTGTGCTTTACACG hits forward strand at 2681239 with 0 mismatches | |
| 869 CGACATCACCCACTACATCG hits reverse strand at [2558638] with 0 mismatches | |
| 870 Amplimer length: 200 bp | |
| 871 Amplimer 3 | |
| 872 Sequence: CP000967 | |
| 873 | |
| 874 TTTTGGCTGTGCTTTACACG hits forward strand at 2681239 with 0 mismatches | |
| 875 CGACATCACCCACTACATCG hits reverse strand at [2346551] with 0 mismatches | |
| 876 Amplimer length: 212287 bp | |
| 877 | |
| 878 Primer name 163 | |
| 879 Amplimer 1 | |
| 880 Sequence: CP000967 | |
| 881 | |
| 882 CCGGGGTACTCAGTGTCAGT hits forward strand at 2890144 with 0 mismatches | |
| 883 CAGTTCGTCCAATACGCAGA hits reverse strand at [2349730] with 0 mismatches | |
| 884 Amplimer length: 203 bp | |
| 885 Amplimer 2 | |
| 886 Sequence: CP000967 | |
| 887 | |
| 888 CCGGGGTACTCAGTGTCAGT hits forward strand at 2678057 with 0 mismatches | |
| 889 CAGTTCGTCCAATACGCAGA hits reverse strand at [2561817] with 0 mismatches | |
| 890 Amplimer length: 203 bp | |
| 891 Amplimer 3 | |
| 892 Sequence: CP000967 | |
| 893 | |
| 894 CCGGGGTACTCAGTGTCAGT hits forward strand at 2678057 with 0 mismatches | |
| 895 CAGTTCGTCCAATACGCAGA hits reverse strand at [2349730] with 0 mismatches | |
| 896 Amplimer length: 212290 bp | |
| 897 | |
| 898 Primer name 174 | |
| 899 Amplimer 1 | |
| 900 Sequence: CP000967 | |
| 901 | |
| 902 ACCGTGATTACCCTGCTCAC hits forward strand at 2719849 with 0 mismatches | |
| 903 ATACCACCGAATAGCGGATG hits reverse strand at [2520002] with 0 mismatches | |
| 904 Amplimer length: 226 bp | |
| 905 Amplimer 2 | |
| 906 Sequence: CP000967 | |
| 907 | |
| 908 ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches | |
| 909 ATACCACCGAATAGCGGATG hits reverse strand at [2732089] with 0 mismatches | |
| 910 Amplimer length: 226 bp | |
| 911 Amplimer 3 | |
| 912 Sequence: CP000967 | |
| 913 | |
| 914 ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches | |
| 915 ATACCACCGAATAGCGGATG hits reverse strand at [2520002] with 0 mismatches | |
| 916 Amplimer length: 212313 bp | |
| 917 | |
| 918 Primer name 175 | |
| 919 Amplimer 1 | |
| 920 Sequence: CP000967 | |
| 921 | |
| 922 ACCGTGATTACCCTGCTCAC hits forward strand at 2719849 with 0 mismatches | |
| 923 CCACCATACCACCGAATAGC hits reverse strand at [2519997] with 0 mismatches | |
| 924 Amplimer length: 231 bp | |
| 925 Amplimer 2 | |
| 926 Sequence: CP000967 | |
| 927 | |
| 928 ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches | |
| 929 CCACCATACCACCGAATAGC hits reverse strand at [2732084] with 0 mismatches | |
| 930 Amplimer length: 231 bp | |
| 931 Amplimer 3 | |
| 932 Sequence: CP000967 | |
| 933 | |
| 934 ACCGTGATTACCCTGCTCAC hits forward strand at 2507762 with 0 mismatches | |
| 935 CCACCATACCACCGAATAGC hits reverse strand at [2519997] with 0 mismatches | |
| 936 Amplimer length: 212318 bp | |
| 937 | |
| 938 Primer name 182 | |
| 939 Amplimer 1 | |
| 940 Sequence: CP000967 | |
| 941 | |
| 942 ATGTCGCGGAGAAACTTCAT hits forward strand at 3850774 with 0 mismatches | |
| 943 CCTGTGTGGGACGGTTTTAT hits reverse strand at [1389102] with 0 mismatches | |
| 944 Amplimer length: 201 bp | |
| 945 Amplimer 2 | |
| 946 Sequence: CP000967 | |
| 947 | |
| 948 ATGTCGCGGAGAAACTTCAT hits forward strand at 3847242 with 0 mismatches | |
| 949 CCTGTGTGGGACGGTTTTAT hits reverse strand at [1389102] with 0 mismatches | |
| 950 Amplimer length: 3733 bp | |
| 951 | |
| 952 Primer name 183 | |
| 953 Amplimer 1 | |
| 954 Sequence: CP000967 | |
| 955 | |
| 956 ACCGACAGCTCGACATACTTG hits forward strand at 3850603 with 0 mismatches | |
| 957 GGCACCGACATGAAGTTTCT hits reverse strand at [1389274] with 0 mismatches | |
| 958 Amplimer length: 200 bp | |
| 959 | |
| 960 Primer name 216 | |
| 961 Amplimer 1 | |
| 962 Sequence: CP000967 | |
| 963 | |
| 964 TGCCCCATACGGATCATACT hits forward strand at 2881341 with 0 mismatches | |
| 965 TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches | |
| 966 Amplimer length: 204 bp | |
| 967 Amplimer 2 | |
| 968 Sequence: CP000967 | |
| 969 | |
| 970 TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches | |
| 971 TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches | |
| 972 Amplimer length: 204 bp | |
| 973 Amplimer 3 | |
| 974 Sequence: CP000967 | |
| 975 | |
| 976 TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches | |
| 977 TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches | |
| 978 Amplimer length: 6584 bp | |
| 979 Amplimer 4 | |
| 980 Sequence: CP000967 | |
| 981 | |
| 982 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches | |
| 983 TACGACGGACAGAATGTGGT hits reverse strand at [2570619] with 0 mismatches | |
| 984 Amplimer length: 204 bp | |
| 985 Amplimer 5 | |
| 986 Sequence: CP000967 | |
| 987 | |
| 988 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches | |
| 989 TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches | |
| 990 Amplimer length: 205911 bp | |
| 991 Amplimer 6 | |
| 992 Sequence: CP000967 | |
| 993 | |
| 994 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches | |
| 995 TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches | |
| 996 Amplimer length: 212291 bp | |
| 997 Amplimer 7 | |
| 998 Sequence: CP000967 | |
| 999 | |
| 1000 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches | |
| 1001 TACGACGGACAGAATGTGGT hits reverse strand at [2576999] with 0 mismatches | |
| 1002 Amplimer length: 204 bp | |
| 1003 Amplimer 8 | |
| 1004 Sequence: CP000967 | |
| 1005 | |
| 1006 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches | |
| 1007 TACGACGGACAGAATGTGGT hits reverse strand at [2570619] with 0 mismatches | |
| 1008 Amplimer length: 6584 bp | |
| 1009 Amplimer 9 | |
| 1010 Sequence: CP000967 | |
| 1011 | |
| 1012 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches | |
| 1013 TACGACGGACAGAATGTGGT hits reverse strand at [2364912] with 0 mismatches | |
| 1014 Amplimer length: 212291 bp | |
| 1015 Amplimer 10 | |
| 1016 Sequence: CP000967 | |
| 1017 | |
| 1018 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches | |
| 1019 TACGACGGACAGAATGTGGT hits reverse strand at [2358532] with 0 mismatches | |
| 1020 Amplimer length: 218671 bp | |
| 1021 | |
| 1022 Primer name 217 | |
| 1023 Amplimer 1 | |
| 1024 Sequence: CP000967 | |
| 1025 | |
| 1026 TGCCCCATACGGATCATACT hits forward strand at 2881341 with 0 mismatches | |
| 1027 GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches | |
| 1028 Amplimer length: 205 bp | |
| 1029 Amplimer 2 | |
| 1030 Sequence: CP000967 | |
| 1031 | |
| 1032 TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches | |
| 1033 GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches | |
| 1034 Amplimer length: 205 bp | |
| 1035 Amplimer 3 | |
| 1036 Sequence: CP000967 | |
| 1037 | |
| 1038 TGCCCCATACGGATCATACT hits forward strand at 2874961 with 0 mismatches | |
| 1039 GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches | |
| 1040 Amplimer length: 6585 bp | |
| 1041 Amplimer 4 | |
| 1042 Sequence: CP000967 | |
| 1043 | |
| 1044 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches | |
| 1045 GTACGACGGACAGAATGTGG hits reverse strand at [2570618] with 0 mismatches | |
| 1046 Amplimer length: 205 bp | |
| 1047 Amplimer 5 | |
| 1048 Sequence: CP000967 | |
| 1049 | |
| 1050 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches | |
| 1051 GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches | |
| 1052 Amplimer length: 205912 bp | |
| 1053 Amplimer 6 | |
| 1054 Sequence: CP000967 | |
| 1055 | |
| 1056 TGCCCCATACGGATCATACT hits forward strand at 2669254 with 0 mismatches | |
| 1057 GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches | |
| 1058 Amplimer length: 212292 bp | |
| 1059 Amplimer 7 | |
| 1060 Sequence: CP000967 | |
| 1061 | |
| 1062 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches | |
| 1063 GTACGACGGACAGAATGTGG hits reverse strand at [2576998] with 0 mismatches | |
| 1064 Amplimer length: 205 bp | |
| 1065 Amplimer 8 | |
| 1066 Sequence: CP000967 | |
| 1067 | |
| 1068 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches | |
| 1069 GTACGACGGACAGAATGTGG hits reverse strand at [2570618] with 0 mismatches | |
| 1070 Amplimer length: 6585 bp | |
| 1071 Amplimer 9 | |
| 1072 Sequence: CP000967 | |
| 1073 | |
| 1074 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches | |
| 1075 GTACGACGGACAGAATGTGG hits reverse strand at [2364911] with 0 mismatches | |
| 1076 Amplimer length: 212292 bp | |
| 1077 Amplimer 10 | |
| 1078 Sequence: CP000967 | |
| 1079 | |
| 1080 TGCCCCATACGGATCATACT hits forward strand at 2662874 with 0 mismatches | |
| 1081 GTACGACGGACAGAATGTGG hits reverse strand at [2358531] with 0 mismatches | |
| 1082 Amplimer length: 218672 bp | |
| 1083 | |
| 1084 Primer name 232 | |
| 1085 Amplimer 1 | |
| 1086 Sequence: CP000967 | |
| 1087 | |
| 1088 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1089 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2341701] with 0 mismatches | |
| 1090 Amplimer length: 226 bp | |
| 1091 Amplimer 2 | |
| 1092 Sequence: CP000967 | |
| 1093 | |
| 1094 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1095 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2336956] with 0 mismatches | |
| 1096 Amplimer length: 4971 bp | |
| 1097 Amplimer 3 | |
| 1098 Sequence: CP000967 | |
| 1099 | |
| 1100 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1101 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1135328] with 0 mismatches | |
| 1102 Amplimer length: 1206599 bp | |
| 1103 Amplimer 4 | |
| 1104 Sequence: CP000967 | |
| 1105 | |
| 1106 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1107 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1129887] with 0 mismatches | |
| 1108 Amplimer length: 1212040 bp | |
| 1109 Amplimer 5 | |
| 1110 Sequence: CP000967 | |
| 1111 | |
| 1112 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1113 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1125487] with 0 mismatches | |
| 1114 Amplimer length: 1216440 bp | |
| 1115 Amplimer 6 | |
| 1116 Sequence: CP000967 | |
| 1117 | |
| 1118 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1119 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1121489] with 0 mismatches | |
| 1120 Amplimer length: 1220438 bp | |
| 1121 Amplimer 7 | |
| 1122 Sequence: CP000967 | |
| 1123 | |
| 1124 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1125 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1116372] with 0 mismatches | |
| 1126 Amplimer length: 1225555 bp | |
| 1127 Amplimer 8 | |
| 1128 Sequence: CP000967 | |
| 1129 | |
| 1130 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1131 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2553788] with 0 mismatches | |
| 1132 Amplimer length: 226 bp | |
| 1133 Amplimer 9 | |
| 1134 Sequence: CP000967 | |
| 1135 | |
| 1136 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1137 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2549043] with 0 mismatches | |
| 1138 Amplimer length: 4971 bp | |
| 1139 Amplimer 10 | |
| 1140 Sequence: CP000967 | |
| 1141 | |
| 1142 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1143 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2341701] with 0 mismatches | |
| 1144 Amplimer length: 212313 bp | |
| 1145 Amplimer 11 | |
| 1146 Sequence: CP000967 | |
| 1147 | |
| 1148 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1149 AGCTCCTCTTCGTTGAATGC hits reverse strand at [2336956] with 0 mismatches | |
| 1150 Amplimer length: 217058 bp | |
| 1151 Amplimer 12 | |
| 1152 Sequence: CP000967 | |
| 1153 | |
| 1154 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1155 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1135328] with 0 mismatches | |
| 1156 Amplimer length: 1418686 bp | |
| 1157 Amplimer 13 | |
| 1158 Sequence: CP000967 | |
| 1159 | |
| 1160 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1161 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1129887] with 0 mismatches | |
| 1162 Amplimer length: 1424127 bp | |
| 1163 Amplimer 14 | |
| 1164 Sequence: CP000967 | |
| 1165 | |
| 1166 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1167 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1125487] with 0 mismatches | |
| 1168 Amplimer length: 1428527 bp | |
| 1169 Amplimer 15 | |
| 1170 Sequence: CP000967 | |
| 1171 | |
| 1172 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1173 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1121489] with 0 mismatches | |
| 1174 Amplimer length: 1432525 bp | |
| 1175 Amplimer 16 | |
| 1176 Sequence: CP000967 | |
| 1177 | |
| 1178 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1179 AGCTCCTCTTCGTTGAATGC hits reverse strand at [1116372] with 0 mismatches | |
| 1180 Amplimer length: 1437642 bp | |
| 1181 Amplimer 17 | |
| 1182 Sequence: CP000967 | |
| 1183 | |
| 1184 AGCTCCTCTTCGTTGAATGC hits forward strand at 1645295 with 0 mismatches | |
| 1185 CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches | |
| 1186 Amplimer length: 226 bp | |
| 1187 Amplimer 18 | |
| 1188 Sequence: CP000967 | |
| 1189 | |
| 1190 AGCTCCTCTTCGTTGAATGC hits forward strand at 559164 with 0 mismatches | |
| 1191 CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches | |
| 1192 Amplimer length: 1086357 bp | |
| 1193 | |
| 1194 Primer name 233 | |
| 1195 Amplimer 1 | |
| 1196 Sequence: CP000967 | |
| 1197 | |
| 1198 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1199 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2341699] with 0 mismatches | |
| 1200 Amplimer length: 228 bp | |
| 1201 Amplimer 2 | |
| 1202 Sequence: CP000967 | |
| 1203 | |
| 1204 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1205 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2336954] with 0 mismatches | |
| 1206 Amplimer length: 4973 bp | |
| 1207 Amplimer 3 | |
| 1208 Sequence: CP000967 | |
| 1209 | |
| 1210 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1211 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1135326] with 0 mismatches | |
| 1212 Amplimer length: 1206601 bp | |
| 1213 Amplimer 4 | |
| 1214 Sequence: CP000967 | |
| 1215 | |
| 1216 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1217 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1129885] with 0 mismatches | |
| 1218 Amplimer length: 1212042 bp | |
| 1219 Amplimer 5 | |
| 1220 Sequence: CP000967 | |
| 1221 | |
| 1222 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1223 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1125485] with 0 mismatches | |
| 1224 Amplimer length: 1216442 bp | |
| 1225 Amplimer 6 | |
| 1226 Sequence: CP000967 | |
| 1227 | |
| 1228 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1229 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1121487] with 0 mismatches | |
| 1230 Amplimer length: 1220440 bp | |
| 1231 Amplimer 7 | |
| 1232 Sequence: CP000967 | |
| 1233 | |
| 1234 CACAGCACTCTTTCGAGGTG hits forward strand at 2898150 with 0 mismatches | |
| 1235 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1116370] with 0 mismatches | |
| 1236 Amplimer length: 1225557 bp | |
| 1237 Amplimer 8 | |
| 1238 Sequence: CP000967 | |
| 1239 | |
| 1240 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1241 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2553786] with 0 mismatches | |
| 1242 Amplimer length: 228 bp | |
| 1243 Amplimer 9 | |
| 1244 Sequence: CP000967 | |
| 1245 | |
| 1246 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1247 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2549041] with 0 mismatches | |
| 1248 Amplimer length: 4973 bp | |
| 1249 Amplimer 10 | |
| 1250 Sequence: CP000967 | |
| 1251 | |
| 1252 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1253 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2341699] with 0 mismatches | |
| 1254 Amplimer length: 212315 bp | |
| 1255 Amplimer 11 | |
| 1256 Sequence: CP000967 | |
| 1257 | |
| 1258 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1259 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [2336954] with 0 mismatches | |
| 1260 Amplimer length: 217060 bp | |
| 1261 Amplimer 12 | |
| 1262 Sequence: CP000967 | |
| 1263 | |
| 1264 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1265 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1135326] with 0 mismatches | |
| 1266 Amplimer length: 1418688 bp | |
| 1267 Amplimer 13 | |
| 1268 Sequence: CP000967 | |
| 1269 | |
| 1270 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1271 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1129885] with 0 mismatches | |
| 1272 Amplimer length: 1424129 bp | |
| 1273 Amplimer 14 | |
| 1274 Sequence: CP000967 | |
| 1275 | |
| 1276 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1277 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1125485] with 0 mismatches | |
| 1278 Amplimer length: 1428529 bp | |
| 1279 Amplimer 15 | |
| 1280 Sequence: CP000967 | |
| 1281 | |
| 1282 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1283 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1121487] with 0 mismatches | |
| 1284 Amplimer length: 1432527 bp | |
| 1285 Amplimer 16 | |
| 1286 Sequence: CP000967 | |
| 1287 | |
| 1288 CACAGCACTCTTTCGAGGTG hits forward strand at 2686063 with 0 mismatches | |
| 1289 CGAGCTCCTCTTCGTTGAAT hits reverse strand at [1116370] with 0 mismatches | |
| 1290 Amplimer length: 1437644 bp | |
| 1291 Amplimer 17 | |
| 1292 Sequence: CP000967 | |
| 1293 | |
| 1294 CGAGCTCCTCTTCGTTGAAT hits forward strand at 1645293 with 0 mismatches | |
| 1295 CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches | |
| 1296 Amplimer length: 228 bp | |
| 1297 Amplimer 18 | |
| 1298 Sequence: CP000967 | |
| 1299 | |
| 1300 CGAGCTCCTCTTCGTTGAAT hits forward strand at 559162 with 0 mismatches | |
| 1301 CACAGCACTCTTTCGAGGTG hits reverse strand at [3594556] with 0 mismatches | |
| 1302 Amplimer length: 1086359 bp | |
| 1303 | |
| 1304 Primer name 248 | |
| 1305 Amplimer 1 | |
| 1306 Sequence: CP000967 | |
| 1307 | |
| 1308 CCAGACCTTGACGCTGGAC hits forward strand at 1857781 with 0 mismatches | |
| 1309 CCGGTGTTCCGAAGGAGAT hits reverse strand at [3382096] with 0 mismatches | |
| 1310 Amplimer length: 200 bp | |
| 1311 | |
| 1312 Primer name 249 | |
| 1313 Amplimer 1 | |
| 1314 Sequence: CP000967 | |
| 1315 | |
| 1316 CCAGACCTTGACGCTGGA hits forward strand at 1857781 with 0 mismatches | |
| 1317 CCGGTGTTCCGAAGGAGAT hits reverse strand at [3382096] with 0 mismatches | |
| 1318 Amplimer length: 200 bp | |
| 1319 | |
| 1320 Primer name 250 | |
| 1321 Amplimer 1 | |
| 1322 Sequence: CP000967 | |
| 1323 | |
| 1324 ATACGCTCACTGCCACCTG hits forward strand at 1858071 with 0 mismatches | |
| 1325 CCAAGTCGGATTGGTCTGAT hits reverse strand at [3381805] with 0 mismatches | |
| 1326 Amplimer length: 201 bp | |
| 1327 | |
| 1328 Primer name 251 | |
| 1329 Amplimer 1 | |
| 1330 Sequence: CP000967 | |
| 1331 | |
| 1332 GATACGCTCACTGCCACCTG hits forward strand at 1858070 with 0 mismatches | |
| 1333 AAGTCGGATTGGTCTGATGC hits reverse strand at [3381807] with 0 mismatches | |
| 1334 Amplimer length: 200 bp |