changeset 0:28a85319a3c6 draft

Uploaded

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/compalignp.xml	Fri Jun 05 05:47:06 2015 -0400
@@ -0,0 +1,50 @@
+<tool id="compalignp" name="Compalignp" version="1.0">
+    <description></description>
+    <requirements>
+        <requirement type="package" version="1.0">compalignp</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" />
+        <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" />
+    </stdio>
+    <command>
+<![CDATA[
+    compalignp
+        -t $rna_alignment_target
+        -r $rna_alignment_reference
+        $flag_verbose
+    > $output
+]]>
+    </command>
+    <inputs>
+        <param format="clustalw,stockholm" name="rna_aligment_target" type="data" label="Target RNA Alignment" help="(-t)" />
+        <param format="clustalw,stockholm" name="rna_aligment_reference" type="data" label="Reference RNA Alignment" help="(-r)" />
+        <param name="flag_verbose" type="boolean" true-value="-v" false-value="" label="Verbose output" help="(-v)" />
+    </inputs>
+    <outputs>
+        <data name="output" format="txt" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="rna_alignment_target" value="eukaryotic-trnas_2.1.clustal"/>
+            <param name="rna_alignment_reference" value="eukaryotic-trnas_2.1.clustal"/>
+            <output name="output" file="eukaryotic-trnas_2.1.out"/>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**compalignp**
+
+> Paranoia version of squids compalign. 
+
+Compute fractional "identity" between trusted alignment and test alignment
+Identity of the multiple sequence alignments is defined as
+the averaged identity over all N(N-1)/2 pairwise alignments.
+
+
+]]>
+    </help>
+<citations>
+  <citation type="doi">10.1186/1748-7188-1-19</citation>
+</citations>
+</tool>

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tests/eukaryotic-trnas_2.1.clustal	Fri Jun 05 05:47:06 2015 -0400
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34      TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35      GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+                                     ************************************** ************** ******* ********* 
+

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tests/eukaryotic-trnas_2.1.out	Fri Jun 05 05:47:06 2015 -0400
@@ -0,0 +1,1 @@
+1.00

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Fri Jun 05 05:47:06 2015 -0400
@@ -0,0 +1,22 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="vienna_rna" version="2.1.5">
+        <repository changeset_revision="b77eb5bc6ad8" name="package_vienna_rna_2_1_5" owner="iuc" prior_installation_required="True" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="compalignp" version="1.0">
+        <install version="1.0">
+            <actions>
+                <action type="download_by_url">http://www.biophys.uni-duesseldorf.de/bralibase/compalignp.tgz</action>
+                <action type="set_environment_for_install">
+                    <repository changeset_revision="8ebcef4aedfb" name="package_squid_1_9g" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu">
+                        <package name="squid" version="1.9g" />
+                    </repository>
+                </action>
+                <action type="shell_command">make" </action>
+                <action type="set_environment">
+                    <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR</environment_variable>
+                </action>
+            </actions>
+        </install>
+    </package>
+</tool_dependency>