# HG changeset patch
# User rnateam
# Date 1433497626 14400
# Node ID 28a85319a3c61e85359e5a76f055387ea746bbdd
Uploaded
diff -r 000000000000 -r 28a85319a3c6 compalignp.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/compalignp.xml Fri Jun 05 05:47:06 2015 -0400
@@ -0,0 +1,50 @@
+
+
+
+ compalignp
+
+
+
+
+
+
+ $output
+]]>
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ Paranoia version of squids compalign.
+
+Compute fractional "identity" between trusted alignment and test alignment
+Identity of the multiple sequence alignments is defined as
+the averaged identity over all N(N-1)/2 pairwise alignments.
+
+
+]]>
+
+
+ 10.1186/1748-7188-1-19
+
+
diff -r 000000000000 -r 28a85319a3c6 tests/eukaryotic-trnas_2.1.clustal
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tests/eukaryotic-trnas_2.1.clustal Fri Jun 05 05:47:06 2015 -0400
@@ -0,0 +1,7 @@
+CLUSTAL 2.1 multiple sequence alignment
+
+
+Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
+Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
+ ************************************** ************** ******* *********
+
diff -r 000000000000 -r 28a85319a3c6 tests/eukaryotic-trnas_2.1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tests/eukaryotic-trnas_2.1.out Fri Jun 05 05:47:06 2015 -0400
@@ -0,0 +1,1 @@
+1.00
diff -r 000000000000 -r 28a85319a3c6 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Fri Jun 05 05:47:06 2015 -0400
@@ -0,0 +1,22 @@
+
+
+
+
+
+
+
+
+ http://www.biophys.uni-duesseldorf.de/bralibase/compalignp.tgz
+
+
+
+
+
+ make"
+
+ $INSTALL_DIR
+
+
+
+
+