Mercurial > repos > nikos > ucsc_tools

changeset 18:a47f03c50780 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author nikos
date Tue, 09 Sep 2014 10:28:01 -0400
parents 0847315fa035
children fc7f090fd00b
files bedClip.sh bedClip.xml bedExtendRanges.xml bigWigSummary.xml bigwig2summary.sh bigwig2summary.xml faCount.xml test-data/.DS_Store test-data/._.DS_Store test-data/1.bed test-data/1.bigwig test-data/1.fasta test-data/1.tabular test-data/1.txt test-data/2.bed test-data/2.tabular test-data/3.bed test-data/3.tabular test-data/4.bed test-data/4.tabular test-data/test-data/1.fasta test-data/test-data/3.tabular test-data/test-data/4.tabular tool_dependencies.xml
diffstat 24 files changed, 151 insertions(+), 596 deletions(-) [+]
line wrap: on
line diff
--- a/bedClip.sh	Tue Sep 09 10:22:40 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,3 +0,0 @@
-#!/bin/bash
-
-bedClip $1 <(fetchChromSizes $2 2> /dev/null) $3
--- a/bedClip.xml	Tue Sep 09 10:22:40 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,65 +0,0 @@
-<tool id="bedClip" name="bedClip">
-    <description> Remove lines from bed file that refer to off-chromosome places.</description>
-    <requirements>
-        <requirement type="package" version="1.0">fetchChromSizes</requirement>
-        <requirement type="package" version="1.0">bedClip</requirement>
-    </requirements>
-    <command interpreter="bash"> 
-	## Set genome assembly 
-
-	#set $Genome = str( $genome_cond.genome )
-	#if str( $genome_cond ) == 'OTHER':
-		#set $Genome = str( $genome_cond.genome_other )
-	#end if
-	
-	bedClip.sh $input $Genome $output
-    </command>
-    <inputs>
-        <param name="input" type="data" format="bed" label="Input"/>
-        <conditional name="genome_cond">
-	    <param name="genome" type="select" label="Genome Assembly">
-        	<option value="hg19">Human (Homo sapiens): hg19</option>
-	        <option value="hg18">Human (Homo sapiens): hg18</option>
-        	<option value="mm10">Mouse (Mus musculus): mm10</option>
-	        <option value="mm9">Mouse (Mus musculus): mm9</option>
-        	<option value="ce10">C. elegans: ce10</option>
-	        <option value="ce6">C. elegans: ce6</option>
-        	<option value="dm3">D. melanogaster: dm3</option>
-	        <option value="OTHER">Other</option>
-            </param>
-	    <when value="OTHER">
-        	<param name="genome_other" type="text" label="Other genome assemly"/>
-      	    </when>
-	    <when value="hg19" type="text" />
-      	    <when value="hg18" type="text" />
-      	    <when value="mm10" type="text" />
-      	    <when value="mm9" type="text" />
-	    <when value="ce10" type="text" />
-	    <when value="ce6" type="text" />
-	    <when value="dm3" type="text" />
-	</conditional>
-
-    </inputs>
-  
-    <outputs>
-        <data format="input" name="output"/> 
-    </outputs>
-    
-    <tests>
-        <test>
-            <param name="input" value="3.bed" />
-            <param name="genome" value="hg19" />
-            <output name="output" file="1.bed" />
-        </test>
-    </tests>
-
-    <help>
-**What it does**
-bedClip - Remove lines from bed file that refer to off-chromosome places.
-
-**Usage**
-
-  bedClip input.bed chrom.sizes output.bed
-
-    </help>
-</tool>
--- a/bedExtendRanges.xml	Tue Sep 09 10:22:40 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,82 +0,0 @@
-<tool id="bedExtendRanges" name="bedExtendRanges">
-    <description> Extend length of entries in bed 6+. </description>
-    <requirements>
-        <requirement type="package" version="1.0">bedExtendRanges</requirement>
-    </requirements>
-    <command> 
-	## Set genome assembly 
-
-	#set $Genome = str( $genome_cond.genome )
-	#if str( $genome_cond ) == 'OTHER':
-		#set $Genome = str( $genome_cond.genome_other )
-	#end if
-	
-	bedExtendRanges -user=genome -host=genome-mysql.cse.ucsc.edu $Genome $length $input 2> /dev/null > $output
-    </command>
-    <inputs>
-        <param name="input" type="data" format="bed" label="Input"/>
-        <conditional name="genome_cond">
-            <param name="genome" type="select" label="Genome Assembly (-g)">
-	        <option value="hg19">Human (Homo sapiens): hg19</option>
-        	<option value="hg18">Human (Homo sapiens): hg18</option>
-	        <option value="mm10">Mouse (Mus musculus): mm10</option>
-        	<option value="mm9">Mouse (Mus musculus): mm9</option>
-        	<option value="ce10">C. elegans: ce10</option>
-	        <option value="ce6">C. elegans: ce6</option>
-	        <option value="dm3">D. melanogaster: dm3</option>
-        	<option value="OTHER">Other</option>
-            </param>
-            <when value="OTHER">
-      		<param name="genome_other" type="text" label="Other genome assemly"/>
-            </when>
-      	    <when value="hg19" type="text" />
-            <when value="hg18" type="text" />
-      	    <when value="mm10" type="text" />
-            <when value="mm9" type="text" />
-            <when value="ce10" type="text" />
-            <when value="ce6" type="text" />
-            <when value="dm3" type="text" />
-    	</conditional>
-        <param name="length" type="integer" value="0" label="Length extension (base-pairs)" />
-
-    </inputs>
-  
-    <outputs>
-        <data format="input" name="output"/> 
-    </outputs>
-
-    <tests>
-	<test>
-	    <param name="input" value="2.bed" />
-	    <param name="genome" value="hg19" />
-	    <param name="length" value="5000" />
-	    <output name="output" file="4.bed" />
-	</test>
-    </tests>
-
-    <help>
-
-**What it does**
-
-bedExtendRanges_ - extend length of entries in bed 6+ data to be at least the given length,
-taking strand directionality into account.
-
-.. _bedExtendRanges: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bedExtendRanges
-
-**Usage**
-
-   bedExtendRanges database length files(s)
-
-**Example**
-
-  * bedExtendRanges -user=genome -host=genome-mysql.cse.ucsc.edu hg18 250 stdin
-
-  will transform:
-    chr1 500 525 . 100 +
-    chr1 1000 1025 . 100 -
-  to:
-    chr1 500 750 . 100 +
-    chr1 775 1025 . 100 -
-
-    </help>
-</tool>
--- a/bigWigSummary.xml	Tue Sep 09 10:22:40 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,43 +0,0 @@
-<tool id="bigWigSummary" name="bigWigSummary">
-    <description> Extract summary information from a bigWig file. </description>
-    <command> 
-	bigWigSummary $input $chrom $start $end $dataPoints -type=$type> $output
-    </command>
-    <inputs>
-        <param name="input" type="data" format="bigwig" label="Input"/>
-        <param name="chrom" type="text" value="chr" label="Chromosome" help="E.g. 'chr7'"/>
-        <param name="start" type="integer" value="" label="Start coordinate" help="BED format (0-based)."/>
-        <param name="end" type="integer" value="" label="End coordinate" help="BED format (0-based)."/>    
-        <param name="dataPoints" type="integer" value="1" label="Number of (equal) parts to break down the selected region."  help="Choose 1 for simple summary."/>
-        <param name="type" type="select" label="Operation">
-	    <option value="mean">Average value in region (default)</option>
-            <option value="min">Minimum value in region</option>
-            <option value="max">Maximum value in region</option>
-            <option value="std">Standard deviation in region</option>
-            <option value="coverage">Percentage of region that is covered</option>
-        </param>
-    </inputs>
-  
-    <outputs>
-        <data format="text" name="output"/> 
-    </outputs>
-
-    <tests>
-	<test>
-	    <param name="input" value="1.bigwig" />
-	    <param name="chrom" value="chr21" />
-	    <param name="start" value="10000000" />
-            <param name="end" value="50000000" />
-	    <param name="dataPoints" value="3" />
-	    <param name="type" value="std" />
-	    <output name="output" file="1.txt" />
-	</test>
-    </tests>
-    <help>
-
-**Usage**
-  * bigWigSummary file.bigWig chrom start end dataPoints
-  * Get summary data from bigWig for indicated region, broken into dataPoints equal parts.  (Use dataPoints=1 for simple summary.)
-
-    </help>
-</tool>
--- a/bigwig2summary.sh	Tue Sep 09 10:22:40 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,131 +0,0 @@
-#!/bin/bash
-# $Id: bigwig2summary_stdout 34 2014-02-20 08:31:20Z jens $
-
-#USE IN GALAXY
-#This script extract summary values (mean, min, max, std or coverage) from a bigwig file for a number of equal sized bins across genomic regions given in bed file.
-#If the bed file contains 6 columns (or more), column 6 is expected to contain strand information. Summary values from a negative strand will be reversed.
-
-########################################
-#bigwigSummary has 3 non-standard outputs:
-#1) n/a #(no data in bin)
-#2) no data #(no data in entire region)
-#3) <number> is not a valid option (typically if negative coordinate)
-
-#Default settings & input parsing. "" indicates required user input.
-nbins=1
-rm_header_line=0
-summary_type=mean
-
-#parse input
-while getopts hef:b:o:n:t: myarg
-do	case "$myarg" in
-	h)	echo "Usage: bigwig2summary_stdout -f <BIGWIG_FILE> -b <BED_FILE> -o <ASSEMBLY> -n <NUMBER OF BINS> -t <SUMMARY TYPE> -e"
-	        echo "Corrects for strand if bed-file has 6 columns or more. Col 6 assumed to contain strand infomation"
-		exit ;;
-	f)	bigwig_file="$OPTARG" ;;
-	b)	bed_file="$OPTARG" ;; #must be tab separated without header
-	o)	org_assembly="$OPTARG" ;;
-	n)	nbins="$OPTARG" ;;
-	t)	summary_type="$OPTARG" ;;
-	e)	rm_header_line=2 ;; #flag. if -e then first line is removed
-	[?])	echo "Usage: bigwig2summary_stdout -f <BIGWIG_FILE> -b <BED_FILE> -o <ASSEMBLY> -n <NUMBER OF BINS> -t <SUMMARY TYPE> -e"
-	        echo "Corrects for strand if bed-file has 6 columns or more. Col 6 assumed to contain strand infomation"
-		exit 1 ;;
-	esac
-done
-
-###################################################
-###VALIDATE INPUT
-###################################################
-
-#get chromosome sizes from bigwig file. bigwig file does not contain name of genome assembly.
-org_assembly_file=`mktemp -u`
-fetchChromSizes $org_assembly 2>/dev/null > $org_assembly_file
-if [ $? -ne 0 ]; then 
-  echo "ERROR: Organism genome assembly does not exist" 
-  rm $org_assembly_file
-  exit
-fi
-
-#check input bed_file. bedClip only checks first 3 columns!
-if [ `bedClip -verbose=2 <(tail -n +${rm_header_line} $bed_file) $org_assembly_file /dev/null 2>&1 | wc -l` -gt 0 ]; then
-  echo -e "ERROR: Input bed file is not in proper format!\nTry 'bedClip' to find lines causing error"
-  echo "Make sure that bigwig and bed files are using the same genome assembly"
-  exit 1
-fi
-
-#make string of "nbins" 0's to insert in regions, where no reads are found
-if [ $nbins -gt 1 ]; then
-  seq_string=`seq 1 $nbins`
-  zero_string=`printf "0\t%.s" {$seq_string} | perl -pe "s/\t$//"` 
-fi
-
-#make sure the given summary type exists
-if [ `echo $summary_type | egrep "(mean|max|min|std|coverage)" | wc -l` -ne 1 ]; then
-  echo "ERROR: Summary type must be: mean, max, min, std or coverage. Default is 'mean'"
-  exit 1
-fi
-
-#determine number of fields in bed_file
-if [ `tail -n +${rm_header_line} $bed_file | awk '{print NF}' | uniq | wc -l` -eq 1 ]; then
-  nfields_bed=`tail -n +${rm_header_line} $bed_file | awk '{print NF}' | uniq`
-else
-  echo "ERROR: Bed file does not have constant number of line columns"
-  exit 1
-fi  
-
-if [[ $nbins -gt 1 && $nfields_bed -ge 6 ]]; then
-  strand_uniq_chars=`tail -n +${rm_header_line} $bed_file | cut -f6 | sort -u | perl -pe "s/\n//"`
-  if [[ $strand_uniq_chars != "+-" && $strand_uniq_chars != "-+" ]] ; then
-    echo "ERROR: Column 6 in bed file must only contain '+' or '-' characters"
-    exit 1
-  fi
-fi 
-
-###################################################
-###EXTRACT DENSITIES FROM NORMALIZED BIGWIG FILE
-###################################################
-
-
-#if more than 1 bin AND >= 6 fields (i.e. has strand column)
-if [[ $nbins -gt 1 && $nfields_bed -ge 6 ]]; then
-
-  #cut columns 1-3+6 | rm header if flag set
-  cut -f1-3,6 $bed_file | tail -n +${rm_header_line} | while read -r line; do
-  
-    #read 4 fields into variables
-    read -r cur_chr cur_start cur_end cur_strand <<<"$line"
-    #run bigWigSummary. Combine stdout and stderr | treat exceptions and errors after 'done'
-    bigWigSummary $bigwig_file $cur_chr $cur_start $cur_end $nbins -type=${summary_type} 2>&1 | perl -pe "s/no data.+$/${zero_string}/" | awk 'BEGIN{OFS="\t"}{ if("'"$cur_strand"'"=="-") { for (i=NF; i>0; i--) { printf("%s\t",$i) } printf("\n") } else { print $0 } }'
-  done | perl -pe "s/n\/a/0/g" | perl -pe "s/^\t?0\t?$/${zero_string}/" | perl -pe "s/ +/\t/g"  | perl -pe "s/\t$//" |  sed '/^$/d'
-
-#if more than 1 bin AND less than 6 fields (i.e. no strand column)
-elif [[ $nbins -gt 1 && $nfields_bed -lt 6 ]]; then
-
-  #cut columns 1-3 | rm header if flag set
-  cut -f1-3 $bed_file | tail -n +${rm_header_line} | while read -r line; do
-  
-    #read 3 fields into variables
-    read -r cur_chr cur_start cur_end <<<"$line"
-    #run bigWigSummary. Combine stdout and stderr | treat exceptions and errors after 'done'
-    bigWigSummary $bigwig_file $cur_chr $cur_start $cur_end $nbins -type=${summary_type} 2>&1 
-  
-  done | perl -pe "s/n\/a/0/g" | perl -pe "s/no data.+$/${zero_string}/" | perl -pe "s/^\t?0\t?$/${zero_string}/" | perl -pe "s/ +/\t/g" | sed '/^$/d'
-
-
-#if 1 bin. Strand column irrelevant 
-else
-
-  cut -f1-3 $bed_file | tail -n +${rm_header_line} | while read -r line; do
-  
-    read -r cur_chr cur_start cur_end <<<"$line"
-    bigWigSummary $bigwig_file $cur_chr $cur_start $cur_end 1 -type=${summary_type} 2>&1
-    
-  done | perl -pe "s/no data.+$/0/" | perl -pe "s/n\/a/0/g" | sed '/^$/d'
-  
-fi 
-  
-
-
-  
-  
--- a/bigwig2summary.xml	Tue Sep 09 10:22:40 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,106 +0,0 @@
-<tool id="bigwig2_summary" name="bigWig2Summary">
-    <description> Extract summary information from a bigWig file across multiple genomic regions specified by the user. </description>
-    <requirements>
-        <requirement type="package" version="1.0">bigWigSummary</requirement>
-        <requirement type="package" version="1.0">fetchChromSizes</requirement>
-        <requirement type="package" version="1.0">bedClip</requirement>
-    </requirements>
-    <command interpreter="bash"> 
-	bigwig2summary.sh -f $input_bw -b $input_bed -n $bins -o $assembly -t $type $header > $output
-    </command>
-    <inputs>
-        <param name="input_bw" type="data" format="bigwig" label="Extract summary from" help="bigWig format."/>
-        <param name="input_bed" type="data" format="tabular" label="using genomic regions in" help="TAB delimited BED-like file."/>
-        <param name="bins" type="integer" value="1" label="Number of bins" help="Postitive integer"/>
-        <param name="assembly" type="text" label="Orgamism assembly" help="E.g. hg19" />
-        <param name="header" type="boolean" checked="False" truevalue="-e" falsevalue=" " label="Does the genomic region file contain a header?" />    
-        <param name="type" type="select" label="Operation" help="">
-	    <option value="mean">Average value in region (default)</option>
-            <option value="min">Minimum value in region</option>
-            <option value="max">Maximum value in region</option>
-            <option value="std">Standard deviation in region</option>
-            <option value="coverage">Percentage of region that is covered</option>
-        </param>
-    </inputs>
-  
-    <outputs>
-        <data format="tabular" name="output"/> 
-    </outputs>
-
-    <tests>
-        <test>
-	    <param name="input_bw" value="1.bigwig" />
-	    <param name="input_bed" value="1.bed" />
-	    <param name="bins" value="3" />
-	    <param name="assembly" value="hg19" />
-	    <param name="header" value="true" />
-	    <output name="output" file="1.tabular" />
-        </test>
-        <test>
-            <param name="input_bw" value="1.bigwig" />
-            <param name="input_bed" value="2.bed" />
-            <param name="bins" value="5" />
-            <param name="assembly" value="hg19" />
-            <param name="header" value="true" />
-            <output name="output" file="2.tabular" />
-        </test>
-    </tests>
-
-    <help>
-
-This tool extracts summary values (mean, min, max, std or coverage) from a **bigWig** file for a number of equal sized bins across genomic regions given in an a "BED-like" file.
-
-The script this tool is based on is written by Jens Vilstrup Johansen and uses bigWigSummary_, bedClip_ and fetchChromSizes_.
-
-.. _bigWigSummary: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigSummary 
-
-.. _bedClip: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bedClip
-
--- _fetchChromSizes: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/fetchChromSizes
-
------
-
-.. class:: infomark
-
-The file contaning the genomic region must be TAB-delimited with at list 3 columns representing Chromosome, ChrStart and ChrEnd. If the file contains 6 columns (or more), column 6 is expected to contain strand information. Summary values from a negative strand will be reversed.
- 
------
-
-**Example 1**
-
-Input BED file::
-
-  chr19   50178708        50180708
-  chr6    90348174        90350174
-  chr16   58495848        58497848
-  chr5    180580242       180582242
-  chr9    120177017       120179017  
-
-Extract summary (*#* of bins = 3):: 
-
-  0		0		0
-  0.144886	0		0
-  0.507327	1.14649		1.38456
-  0.221471	0.144886	0.309857
-  0.348944	0.426638	0.244495
-
-**Example 2**
-
-Input BED file (with strand information)::
-
-  chr19	  50178708	50180708	NM_198318	0	+	PRMT1
-  chr6	  90348174	90350174	NM_020466	0	-	LYRM2
-  chr16	  58495848	58497848	NM_020465	0	+	NDRG4
-  chr5 	  180580242	180582242	NM_206880	0	+	OR2V2
-  chr9    120177017     120179017       NM_014010       0       -	ASTN2
-
-Extract summary (*#* of bins = 3)::
-
-  0		0		0
-  0		0		0.144886
-  0.507327	1.14649		1.38456
-  0.221471	0.144886	0.309857
-  0.244495	0.426638	0.348944
-
-    </help>
-</tool>
--- a/faCount.xml	Tue Sep 09 10:22:40 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,78 +0,0 @@
-<tool id="faCount" name="faCount">
-    <description> Count base statistics and CpGs in FASTA files.</description>
-    <requirements>
-        <requirement type="package" version="1.0">faCount</requirement>
-    </requirements>
-    <command>
-	faCount $summary $dinuc $strands $input > $output
-    </command>
-
-    <inputs>
-	<param name="input" type="data" format="fasta" label="FASTA file" />
-	<param name="summary" type="boolean" checked="false" falsevalue="" truevalue="-summary" label="Show only summary statistics" />
-	<param name="dinuc" type="boolean" checked="false" falsevalue="" truevalue="-dinuc" label="Include statistics on dinucletoide frequencies" />
-	<param name="strands" type="boolean" checked="false" falsevalue="" truevalue="-strands" label="Count bases on both strands" />
-    </inputs>
-
-    <outputs>
-	<data format="tabular" name="output" />
-    </outputs>
-
-    <tests>
-	<test>
-	    <param name="input" value="1.fasta" />
-	    <output name="output" file="2.tabular" />
-	</test>
-	<test>
-	    <param name="input" value="1.fasta" />
-	    <param name="summary" value="true" />
-	    <param name="dinuc" value="true" />
-	    <param name="strands" value="true" />
-	    <output name="output" file="3.tabular" />
-    	</test>
-    </tests>
-
-    <help>
-**What it does**
-
-faCount_ - Count base statistics and CpGs in FA files.
-
-.. _faCount: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/faCount
-
-**Usage**
-  
-faCount file(s).fa -summary -dinuc -strands
-
-**Examples**
-
-Example 1::
-
-  faCount 1.fasta
-
-  #seq		len	A	C	G	T	N	cpg
-  HSFAU1	515	125	138	146	106	0	23
-  HSFAU2	514	124	138	146	106	0	25
-  HSFAU3	518	125	139	149	105	0	25
-  HSFAU4	524	128	142	148	106	0	26
-  HSFAU5	518	124	138	147	109	0	25
-  total		2589	626	695	736	532	0	124
-
-Example 2::
-
-  faCount 1.fasta -summary
-
-  #seq		len	A	C	G	T	N	cpg
-  total		2589	626	695	736	532	0	124
-  prcnt		1.0  	0.2418	0.2684	0.2843	0.2055	0.0000	0.0479
-
-Example 3::
-
-  faCount 1.fasta -summary -strands
-  
-  #seq		len	A	C	G	T	N	cpg
-  total		5178	1158	1431	1431	1158	0	248
-  prcnt		1.0  	0.2236	0.2764	0.2764	0.2236	0.0000	0.0479
-
-    </help>
-
-</tool>
Binary file test-data/.DS_Store has changed
Binary file test-data/._.DS_Store has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.bed	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,5 @@
+chr19	50178708	50180708
+chr6	90348174	90350174
+chr16	58495848	58497848
+chr5	180580242	180582242
+chr9	120177017	120179017
Binary file test-data/1.bigwig has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.fasta	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,50 @@
+>HSFAU1
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggccccctggaggatgaggccactctgggccagtgcggggtggaggccc
+tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
+>HSFAU2
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggcgcgcccctggaggatgcactctgggccagtgcggggtggaggccc
+tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
+>HSFAU3
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
+tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaagggggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
+>HSFAU4
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgaaatagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
+tgactaccctggaagtagcaggccgcatgcttgcccgaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
+>HSFAU5
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
+tgactaccctggaagtaggccgcatgctttttggaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.tabular	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,4 @@
+0.144886	0	0
+0.507327	1.14649	1.38456
+0.221471	0.144886	0.309857
+0.348944	0.426638	0.244495
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.txt	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,1 @@
+0.796113	0.273952	0.437672
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/2.bed	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,5 @@
+chr19	50178708	50180708	NM_198318	0	+	PRMT1
+chr6	90348174	90350174	NM_020466	0	-	LYRM2
+chr16	58495848	58497848	NM_020465	0	+	NDRG4
+chr5	180580242	180582242	NM_206880	0	+	OR2V2
+chr9	120177017	120179017	NM_014010	0	-	ASTN2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/2.tabular	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,4 @@
+0	0	0	0.144886	0
+0.396878	0.970009	1.1091	1.17538	1.40612
+0.203829	0.21262	0.144886	0.409996	0.274558
+0.180424	0.430989	0.458898	0.35171	0.307157
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/3.bed	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,7 @@
+chr19	50178708	50180708
+chr21	48119895	48139895
+chr6	90348174	90350174
+chr16	58495848	58497848
+chr5	180580242	180582242
+chr17	81194210	81196210
+chr9	120177017	120179017  
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/3.tabular	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,7 @@
+#seq	len	A	C	G	T	N	cpg
+HSFAU1	515	125	138	146	106	0	23
+HSFAU2	514	124	138	146	106	0	25
+HSFAU3	518	125	139	149	105	0	25
+HSFAU4	524	128	142	148	106	0	26
+HSFAU5	518	124	138	147	109	0	25
+total	2589	626	695	736	532	0	124
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/4.bed	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,5 @@
+chr19 50178708 50183708 NM_198318 0 + PRMT1
+chr6 90345174 90350174 NM_020466 0 - LYRM2
+chr16 58495848 58500848 NM_020465 0 + NDRG4
+chr5 180580242 180585242 NM_206880 0 + OR2V2
+chr9 120174017 120179017 NM_014010 0 - ASTN2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/4.tabular	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,3 @@
+#seq	len	A	C	G	T	N	cpg	AA	AC	AG	AT	CA	CC	CG	CT	GA	GC	GG	GT	TA	TC	TG	TT
+total	5178	1158	1431	1431	1158	0	248	360	238	408	142	328	447	248	408	320	426	447	238	150	320	328	360
+prcnt	1.0  	0.2236	0.2764	0.2764	0.2236	0.0000	0.0479	0.0695	0.0460	0.0788	0.0274	0.0633	0.0863	0.0479	0.0788	0.0618	0.0823	0.0863	0.0460	0.0290	0.0618	0.0633	0.0695
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-data/1.fasta	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,50 @@
+>HSFAU1
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggccccctggaggatgaggccactctgggccagtgcggggtggaggccc
+tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
+>HSFAU2
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggcgcgcccctggaggatgcactctgggccagtgcggggtggaggccc
+tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
+>HSFAU3
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
+tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaagggggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
+>HSFAU4
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgaaatagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
+tgactaccctggaagtagcaggccgcatgcttgcccgaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
+>HSFAU5
+ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
+agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
+cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
+tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
+tgactaccctggaagtaggccgcatgctttttggaggtaaagttcatggttccctggccc
+gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
+agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
+cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
+tctaataaaaaagccacttagttcagtcaaaaaaaaaa
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-data/3.tabular	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,7 @@
+#seq	len	A	C	G	T	N	cpg
+HSFAU1	515	125	138	146	106	0	23
+HSFAU2	514	124	138	146	106	0	25
+HSFAU3	518	125	139	149	105	0	25
+HSFAU4	524	128	142	148	106	0	26
+HSFAU5	518	124	138	147	109	0	25
+total	2589	626	695	736	532	0	124
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-data/4.tabular	Tue Sep 09 10:28:01 2014 -0400
@@ -0,0 +1,3 @@
+#seq	len	A	C	G	T	N	cpg	AA	AC	AG	AT	CA	CC	CG	CT	GA	GC	GG	GT	TA	TC	TG	TT
+total	5178	1158	1431	1431	1158	0	248	360	238	408	142	328	447	248	408	320	426	447	238	150	320	328	360
+prcnt	1.0  	0.2236	0.2764	0.2764	0.2236	0.0000	0.0479	0.0695	0.0460	0.0788	0.0274	0.0633	0.0863	0.0479	0.0788	0.0618	0.0823	0.0863	0.0460	0.0290	0.0618	0.0633	0.0695
--- a/tool_dependencies.xml	Tue Sep 09 10:22:40 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,88 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="bigWigSummary" version="1.0">
-        <install version="1.0">
-            <actions>
-                <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/bigWigSummary</action>
-	        <action type="move_directory_files">
-        	    <source_directory>.</source_directory>
-        	    <destination_directory>$INSTALL_DIR</destination_directory>
-        	</action>
-                <action type="chmod"><file mode="755">$INSTALL_DIR/bigWigSummary</file></action>
-		<action type="set_environment">
-                    <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable>
-                </action>
-	    </actions>
-        </install>
-        <readme>
-        </readme>
-    </package>
-    <package name="bedClip" version="1.0">
-        <install version="1.0">
-            <actions>
-                <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/bedClip</action>
-                <action type="move_directory_files">
-                    <source_directory>.</source_directory>
-                    <destination_directory>$INSTALL_DIR</destination_directory>
-                </action>
-                <action type="chmod"><file mode="755">$INSTALL_DIR/bedClip</file></action>
-                <action type="set_environment">
-                    <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable>
-                </action>
-            </actions>
-        </install>
-        <readme>
-        </readme>
-    </package>
-    <package name="bedExtendRanges" version="1.0">
-        <install version="1.0">
-            <actions>
-                <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/bedExtendRanges</action>
-                <action type="move_directory_files">
-                    <source_directory>.</source_directory>
-                    <destination_directory>$INSTALL_DIR</destination_directory>
-                </action>
-                <action type="chmod"><file mode="755">$INSTALL_DIR/bedExtendRanges</file></action>
-                <action type="set_environment">
-                    <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable>
-                </action>
-            </actions>
-        </install>
-        <readme>
-        </readme>
-    </package>
-    <package name="faCount" version="1.0">
-	<install version="1.0">
-	    <actions>
-		<action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/faCount</action>
-		<action type="move_directory_files">
-		    <source_directory>.</source_directory>
-		    <destination_directory>$INSTALL_DIR</destination_directory>
-	        </action>
-		<action type="chmod"><file mode="755">$INSTALL_DIR/faCount</file></action>
-		<action type="set_environment">
-		     <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable>
-                </action>
-	    </actions>
-	</install>
-	<readme>
-	</readme>
-    </package>
-    <package name="fetchChromSizes" version="1.0">
-        <install version="1.0">
-            <actions>
-                <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/fetchChromSizes</action>
-                <action type="move_directory_files">
-                    <source_directory>.</source_directory>
-                    <destination_directory>$INSTALL_DIR</destination_directory>
-                </action>
-		<action type="chmod"><file mode="755">$INSTALL_DIR/fetchChromSizes</file></action>
-                <action type="set_environment">
-                    <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable>
-                </action>
-            </actions>
-        </install>
-        <readme>
-        </readme>
-    </package>
-</tool_dependency>