Mercurial > repos > nikos > ucsc_tools
changeset 20:3dede45026d7 draft
Uploaded
author | nikos |
---|---|
date | Tue, 09 Sep 2014 10:32:57 -0400 |
parents | fc7f090fd00b |
children | 15c7edb1a451 |
files | bedClip.sh bedClip.xml bedExtendRanges.xml bigWigSummary.xml bigwig2summary.sh bigwig2summary.xml faCount.xml test-data/1.bed test-data/1.bigwig test-data/1.fasta test-data/1.tabular test-data/1.txt test-data/2.bed test-data/2.tabular test-data/3.bed test-data/3.tabular test-data/4.bed test-data/4.tabular tool_dependencies.xml |
diffstat | 19 files changed, 685 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bedClip.sh Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,3 @@ +#!/bin/bash + +bedClip $1 <(fetchChromSizes $2 2> /dev/null) $3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bedClip.xml Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,65 @@ +<tool id="bedClip" name="bedClip"> + <description> Remove lines from bed file that refer to off-chromosome places.</description> + <requirements> + <requirement type="package" version="1.0">fetchChromSizes</requirement> + <requirement type="package" version="1.0">bedClip</requirement> + </requirements> + <command interpreter="bash"> + ## Set genome assembly + + #set $Genome = str( $genome_cond.genome ) + #if str( $genome_cond ) == 'OTHER': + #set $Genome = str( $genome_cond.genome_other ) + #end if + + bedClip.sh $input $Genome $output + </command> + <inputs> + <param name="input" type="data" format="bed" label="Input"/> + <conditional name="genome_cond"> + <param name="genome" type="select" label="Genome Assembly"> + <option value="hg19">Human (Homo sapiens): hg19</option> + <option value="hg18">Human (Homo sapiens): hg18</option> + <option value="mm10">Mouse (Mus musculus): mm10</option> + <option value="mm9">Mouse (Mus musculus): mm9</option> + <option value="ce10">C. elegans: ce10</option> + <option value="ce6">C. elegans: ce6</option> + <option value="dm3">D. melanogaster: dm3</option> + <option value="OTHER">Other</option> + </param> + <when value="OTHER"> + <param name="genome_other" type="text" label="Other genome assemly"/> + </when> + <when value="hg19" type="text" /> + <when value="hg18" type="text" /> + <when value="mm10" type="text" /> + <when value="mm9" type="text" /> + <when value="ce10" type="text" /> + <when value="ce6" type="text" /> + <when value="dm3" type="text" /> + </conditional> + + </inputs> + + <outputs> + <data format="input" name="output"/> + </outputs> + + <tests> + <test> + <param name="input" value="3.bed" /> + <param name="genome" value="hg19" /> + <output name="output" file="1.bed" /> + </test> + </tests> + + <help> +**What it does** +bedClip - Remove lines from bed file that refer to off-chromosome places. + +**Usage** + + bedClip input.bed chrom.sizes output.bed + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bedExtendRanges.xml Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,82 @@ +<tool id="bedExtendRanges" name="bedExtendRanges"> + <description> Extend length of entries in bed 6+. </description> + <requirements> + <requirement type="package" version="1.0">bedExtendRanges</requirement> + </requirements> + <command> + ## Set genome assembly + + #set $Genome = str( $genome_cond.genome ) + #if str( $genome_cond ) == 'OTHER': + #set $Genome = str( $genome_cond.genome_other ) + #end if + + bedExtendRanges -user=genome -host=genome-mysql.cse.ucsc.edu $Genome $length $input 2> /dev/null > $output + </command> + <inputs> + <param name="input" type="data" format="bed" label="Input"/> + <conditional name="genome_cond"> + <param name="genome" type="select" label="Genome Assembly (-g)"> + <option value="hg19">Human (Homo sapiens): hg19</option> + <option value="hg18">Human (Homo sapiens): hg18</option> + <option value="mm10">Mouse (Mus musculus): mm10</option> + <option value="mm9">Mouse (Mus musculus): mm9</option> + <option value="ce10">C. elegans: ce10</option> + <option value="ce6">C. elegans: ce6</option> + <option value="dm3">D. melanogaster: dm3</option> + <option value="OTHER">Other</option> + </param> + <when value="OTHER"> + <param name="genome_other" type="text" label="Other genome assemly"/> + </when> + <when value="hg19" type="text" /> + <when value="hg18" type="text" /> + <when value="mm10" type="text" /> + <when value="mm9" type="text" /> + <when value="ce10" type="text" /> + <when value="ce6" type="text" /> + <when value="dm3" type="text" /> + </conditional> + <param name="length" type="integer" value="0" label="Length extension (base-pairs)" /> + + </inputs> + + <outputs> + <data format="input" name="output"/> + </outputs> + + <tests> + <test> + <param name="input" value="2.bed" /> + <param name="genome" value="hg19" /> + <param name="length" value="5000" /> + <output name="output" file="4.bed" /> + </test> + </tests> + + <help> + +**What it does** + +bedExtendRanges_ - extend length of entries in bed 6+ data to be at least the given length, +taking strand directionality into account. + +.. _bedExtendRanges: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bedExtendRanges + +**Usage** + + bedExtendRanges database length files(s) + +**Example** + + * bedExtendRanges -user=genome -host=genome-mysql.cse.ucsc.edu hg18 250 stdin + + will transform: + chr1 500 525 . 100 + + chr1 1000 1025 . 100 - + to: + chr1 500 750 . 100 + + chr1 775 1025 . 100 - + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bigWigSummary.xml Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,43 @@ +<tool id="bigWigSummary" name="bigWigSummary"> + <description> Extract summary information from a bigWig file. </description> + <command> + bigWigSummary $input $chrom $start $end $dataPoints -type=$type> $output + </command> + <inputs> + <param name="input" type="data" format="bigwig" label="Input"/> + <param name="chrom" type="text" value="chr" label="Chromosome" help="E.g. 'chr7'"/> + <param name="start" type="integer" value="" label="Start coordinate" help="BED format (0-based)."/> + <param name="end" type="integer" value="" label="End coordinate" help="BED format (0-based)."/> + <param name="dataPoints" type="integer" value="1" label="Number of (equal) parts to break down the selected region." help="Choose 1 for simple summary."/> + <param name="type" type="select" label="Operation"> + <option value="mean">Average value in region (default)</option> + <option value="min">Minimum value in region</option> + <option value="max">Maximum value in region</option> + <option value="std">Standard deviation in region</option> + <option value="coverage">Percentage of region that is covered</option> + </param> + </inputs> + + <outputs> + <data format="text" name="output"/> + </outputs> + + <tests> + <test> + <param name="input" value="1.bigwig" /> + <param name="chrom" value="chr21" /> + <param name="start" value="10000000" /> + <param name="end" value="50000000" /> + <param name="dataPoints" value="3" /> + <param name="type" value="std" /> + <output name="output" value="1.txt" /> + </test> + </tests> + <help> + +**Usage** + * bigWigSummary file.bigWig chrom start end dataPoints + * Get summary data from bigWig for indicated region, broken into dataPoints equal parts. (Use dataPoints=1 for simple summary.) + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bigwig2summary.sh Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,131 @@ +#!/bin/bash +# $Id: bigwig2summary_stdout 34 2014-02-20 08:31:20Z jens $ + +#USE IN GALAXY +#This script extract summary values (mean, min, max, std or coverage) from a bigwig file for a number of equal sized bins across genomic regions given in bed file. +#If the bed file contains 6 columns (or more), column 6 is expected to contain strand information. Summary values from a negative strand will be reversed. + +######################################## +#bigwigSummary has 3 non-standard outputs: +#1) n/a #(no data in bin) +#2) no data #(no data in entire region) +#3) <number> is not a valid option (typically if negative coordinate) + +#Default settings & input parsing. "" indicates required user input. +nbins=1 +rm_header_line=0 +summary_type=mean + +#parse input +while getopts hef:b:o:n:t: myarg +do case "$myarg" in + h) echo "Usage: bigwig2summary_stdout -f <BIGWIG_FILE> -b <BED_FILE> -o <ASSEMBLY> -n <NUMBER OF BINS> -t <SUMMARY TYPE> -e" + echo "Corrects for strand if bed-file has 6 columns or more. Col 6 assumed to contain strand infomation" + exit ;; + f) bigwig_file="$OPTARG" ;; + b) bed_file="$OPTARG" ;; #must be tab separated without header + o) org_assembly="$OPTARG" ;; + n) nbins="$OPTARG" ;; + t) summary_type="$OPTARG" ;; + e) rm_header_line=2 ;; #flag. if -e then first line is removed + [?]) echo "Usage: bigwig2summary_stdout -f <BIGWIG_FILE> -b <BED_FILE> -o <ASSEMBLY> -n <NUMBER OF BINS> -t <SUMMARY TYPE> -e" + echo "Corrects for strand if bed-file has 6 columns or more. Col 6 assumed to contain strand infomation" + exit 1 ;; + esac +done + +################################################### +###VALIDATE INPUT +################################################### + +#get chromosome sizes from bigwig file. bigwig file does not contain name of genome assembly. +org_assembly_file=`mktemp -u` +fetchChromSizes $org_assembly 2>/dev/null > $org_assembly_file +if [ $? -ne 0 ]; then + echo "ERROR: Organism genome assembly does not exist" + rm $org_assembly_file + exit +fi + +#check input bed_file. bedClip only checks first 3 columns! +if [ `bedClip -verbose=2 <(tail -n +${rm_header_line} $bed_file) $org_assembly_file /dev/null 2>&1 | wc -l` -gt 0 ]; then + echo -e "ERROR: Input bed file is not in proper format!\nTry 'bedClip' to find lines causing error" + echo "Make sure that bigwig and bed files are using the same genome assembly" + exit 1 +fi + +#make string of "nbins" 0's to insert in regions, where no reads are found +if [ $nbins -gt 1 ]; then + seq_string=`seq 1 $nbins` + zero_string=`printf "0\t%.s" {$seq_string} | perl -pe "s/\t$//"` +fi + +#make sure the given summary type exists +if [ `echo $summary_type | egrep "(mean|max|min|std|coverage)" | wc -l` -ne 1 ]; then + echo "ERROR: Summary type must be: mean, max, min, std or coverage. Default is 'mean'" + exit 1 +fi + +#determine number of fields in bed_file +if [ `tail -n +${rm_header_line} $bed_file | awk '{print NF}' | uniq | wc -l` -eq 1 ]; then + nfields_bed=`tail -n +${rm_header_line} $bed_file | awk '{print NF}' | uniq` +else + echo "ERROR: Bed file does not have constant number of line columns" + exit 1 +fi + +if [[ $nbins -gt 1 && $nfields_bed -ge 6 ]]; then + strand_uniq_chars=`tail -n +${rm_header_line} $bed_file | cut -f6 | sort -u | perl -pe "s/\n//"` + if [[ $strand_uniq_chars != "+-" && $strand_uniq_chars != "-+" ]] ; then + echo "ERROR: Column 6 in bed file must only contain '+' or '-' characters" + exit 1 + fi +fi + +################################################### +###EXTRACT DENSITIES FROM NORMALIZED BIGWIG FILE +################################################### + + +#if more than 1 bin AND >= 6 fields (i.e. has strand column) +if [[ $nbins -gt 1 && $nfields_bed -ge 6 ]]; then + + #cut columns 1-3+6 | rm header if flag set + cut -f1-3,6 $bed_file | tail -n +${rm_header_line} | while read -r line; do + + #read 4 fields into variables + read -r cur_chr cur_start cur_end cur_strand <<<"$line" + #run bigWigSummary. Combine stdout and stderr | treat exceptions and errors after 'done' + bigWigSummary $bigwig_file $cur_chr $cur_start $cur_end $nbins -type=${summary_type} 2>&1 | perl -pe "s/no data.+$/${zero_string}/" | awk 'BEGIN{OFS="\t"}{ if("'"$cur_strand"'"=="-") { for (i=NF; i>0; i--) { printf("%s\t",$i) } printf("\n") } else { print $0 } }' + done | perl -pe "s/n\/a/0/g" | perl -pe "s/^\t?0\t?$/${zero_string}/" | perl -pe "s/ +/\t/g" | perl -pe "s/\t$//" | sed '/^$/d' + +#if more than 1 bin AND less than 6 fields (i.e. no strand column) +elif [[ $nbins -gt 1 && $nfields_bed -lt 6 ]]; then + + #cut columns 1-3 | rm header if flag set + cut -f1-3 $bed_file | tail -n +${rm_header_line} | while read -r line; do + + #read 3 fields into variables + read -r cur_chr cur_start cur_end <<<"$line" + #run bigWigSummary. Combine stdout and stderr | treat exceptions and errors after 'done' + bigWigSummary $bigwig_file $cur_chr $cur_start $cur_end $nbins -type=${summary_type} 2>&1 + + done | perl -pe "s/n\/a/0/g" | perl -pe "s/no data.+$/${zero_string}/" | perl -pe "s/^\t?0\t?$/${zero_string}/" | perl -pe "s/ +/\t/g" | sed '/^$/d' + + +#if 1 bin. Strand column irrelevant +else + + cut -f1-3 $bed_file | tail -n +${rm_header_line} | while read -r line; do + + read -r cur_chr cur_start cur_end <<<"$line" + bigWigSummary $bigwig_file $cur_chr $cur_start $cur_end 1 -type=${summary_type} 2>&1 + + done | perl -pe "s/no data.+$/0/" | perl -pe "s/n\/a/0/g" | sed '/^$/d' + +fi + + + + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bigwig2summary.xml Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,104 @@ +<tool id="bigwig2_summary" name="bigWig2Summary"> + <description> Extract summary information from a bigWig file across multiple genomic regions specified by the user. </description> + <requirements> + <requirement type="package" version="1.0">bigWigSummary</requirement> + <requirement type="package" version="1.0">fetchChromSizes</requirement> + <requirement type="package" version="1.0">bedClip</requirement> + </requirements> + <command interpreter="bash"> + bigwig2summary.sh -f $input_bw -b $input_bed -n $bins -o $assembly -t $type $header > $output + </command> + <inputs> + <param name="input_bw" type="data" format="bigwig" label="Extract summary from" help="bigWig format."/> + <param name="input_bed" type="data" format="tabular" label="using genomic regions in" help="TAB delimited BED-like file."/> + <param name="bins" type="integer" value="1" label="Number of bins" help="Postitive integer"/> + <param name="assembly" type="text" label="Orgamism assembly" help="E.g. hg19" /> + <param name="header" type="boolean" checked="False" truevalue="-e" falsevalue=" " label="Does the genomic region file contain a header?" /> + <param name="type" type="select" label="Operation" help=""> + <option value="mean">Average value in region (default)</option> + <option value="min">Minimum value in region</option> + <option value="max">Maximum value in region</option> + <option value="std">Standard deviation in region</option> + <option value="coverage">Percentage of region that is covered</option> + </param> + </inputs> + + <outputs> + <data format="tabular" name="output"/> + </outputs> + + <tests> + <test> + <param name="input_bw" value="1.bigwig" /> + <param name="input_bed" value="1.bed" /> + <param name="bins" value="3" /> + <param name="assembly" value="hg19" /> + <output name="output" file="1.tabular" /> + </test> + <test> + <param name="input_bw" value="1.bigwig" /> + <param name="input_bed" value="2.bed" /> + <param name="bins" value="5" /> + <param name="assembly" value="hg19" /> + <output name="output" file="2.tabular" /> + </test> + </tests> + + <help> + +This tool extracts summary values (mean, min, max, std or coverage) from a **bigWig** file for a number of equal sized bins across genomic regions given in an a "BED-like" file. + +The script this tool is based on is written by Jens Vilstrup Johansen and uses bigWigSummary_, bedClip_ and fetchChromSizes_. + +.. _bigWigSummary: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigSummary + +.. _bedClip: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bedClip + +-- _fetchChromSizes: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/fetchChromSizes + +----- + +.. class:: infomark + +The file contaning the genomic region must be TAB-delimited with at list 3 columns representing Chromosome, ChrStart and ChrEnd. If the file contains 6 columns (or more), column 6 is expected to contain strand information. Summary values from a negative strand will be reversed. + +----- + +**Example 1** + +Input BED file:: + + chr19 50178708 50180708 + chr6 90348174 90350174 + chr16 58495848 58497848 + chr5 180580242 180582242 + chr9 120177017 120179017 + +Extract summary (*#* of bins = 3):: + + 0 0 0 + 0.144886 0 0 + 0.507327 1.14649 1.38456 + 0.221471 0.144886 0.309857 + 0.348944 0.426638 0.244495 + +**Example 2** + +Input BED file (with strand information):: + + chr19 50178708 50180708 NM_198318 0 + PRMT1 + chr6 90348174 90350174 NM_020466 0 - LYRM2 + chr16 58495848 58497848 NM_020465 0 + NDRG4 + chr5 180580242 180582242 NM_206880 0 + OR2V2 + chr9 120177017 120179017 NM_014010 0 - ASTN2 + +Extract summary (*#* of bins = 3):: + + 0 0 0 + 0 0 0.144886 + 0.507327 1.14649 1.38456 + 0.221471 0.144886 0.309857 + 0.244495 0.426638 0.348944 + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/faCount.xml Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,78 @@ +<tool id="faCount" name="faCount"> + <description> Count base statistics and CpGs in FASTA files.</description> + <requirements> + <requirement type="package" version="1.0">faCount</requirement> + </requirements> + <command> + faCount $summary $dinuc $strands $input > $output + </command> + + <inputs> + <param name="input" type="data" format="fasta" label="FASTA file" /> + <param name="summary" type="boolean" checked="false" falsevalue="" truevalue="-summary" label="Show only summary statistics" /> + <param name="dinuc" type="boolean" checked="false" falsevalue="" truevalue="-dinuc" label="Include statistics on dinucletoide frequencies" /> + <param name="strands" type="boolean" checked="false" falsevalue="" truevalue="-strands" label="Count bases on both strands" /> + </inputs> + + <outputs> + <data format="tabular" name="output" /> + </outputs> + + <tests> + <test> + <param name="input" value="1.fasta" /> + <output name="output" file="3.tabular" /> + </test> + <test> + <param name="input" value="1.fasta" /> + <param name="summary" value="true" /> + <param name="dinuc" value="true" /> + <param name="strands" value="true" /> + <output name="output" file="4.tabular" /> + </test> + </tests> + + <help> +**What it does** + +faCount_ - Count base statistics and CpGs in FA files. + +.. _faCount: http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/faCount + +**Usage** + +faCount file(s).fa -summary -dinuc -strands + +**Examples** + +Example 1:: + + faCount 1.fasta + + #seq len A C G T N cpg + HSFAU1 515 125 138 146 106 0 23 + HSFAU2 514 124 138 146 106 0 25 + HSFAU3 518 125 139 149 105 0 25 + HSFAU4 524 128 142 148 106 0 26 + HSFAU5 518 124 138 147 109 0 25 + total 2589 626 695 736 532 0 124 + +Example 2:: + + faCount 1.fasta -summary + + #seq len A C G T N cpg + total 2589 626 695 736 532 0 124 + prcnt 1.0 0.2418 0.2684 0.2843 0.2055 0.0000 0.0479 + +Example 3:: + + faCount 1.fasta -summary -strands + + #seq len A C G T N cpg + total 5178 1158 1431 1431 1158 0 248 + prcnt 1.0 0.2236 0.2764 0.2764 0.2236 0.0000 0.0479 + + </help> + +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1.bed Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,5 @@ +chr19 50178708 50180708 +chr6 90348174 90350174 +chr16 58495848 58497848 +chr5 180580242 180582242 +chr9 120177017 120179017
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1.fasta Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,50 @@ +>HSFAU1 +ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc +agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg +cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc +tcctggcaggccccctggaggatgaggccactctgggccagtgcggggtggaggccc +tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc +gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga +agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca +cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc +tctaataaaaaagccacttagttcagtcaaaaaaaaaa +>HSFAU2 +ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc +agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg +cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc +tcctggcaggcgcgcccctggaggatgcactctgggccagtgcggggtggaggccc +tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc +gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga +agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca +cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc +tctaataaaaaagccacttagttcagtcaaaaaaaaaa +>HSFAU3 +ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc +agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg +cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc +tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc +tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc +gtgctggaaaagtgagaggtcagactcctaagggggccaaacaggagaagaagaagaaga +agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca +cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc +tctaataaaaaagccacttagttcagtcaaaaaaaaaa +>HSFAU4 +ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc +agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg +cccagatcaaggctcatgaaatagcctcactggagggcattgccccggaagatcaagtcgtgc +tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc +tgactaccctggaagtagcaggccgcatgcttgcccgaggtaaagttcatggttccctggccc +gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga +agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca +cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc +tctaataaaaaagccacttagttcagtcaaaaaaaaaa +>HSFAU5 +ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc +agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg +cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc +tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc +tgactaccctggaagtaggccgcatgctttttggaggtaaagttcatggttccctggccc +gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga +agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca +cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc +tctaataaaaaagccacttagttcagtcaaaaaaaaaa \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1.tabular Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,4 @@ +0.144886 0 0 +0.507327 1.14649 1.38456 +0.221471 0.144886 0.309857 +0.348944 0.426638 0.244495
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1.txt Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,1 @@ +0.796113 0.273952 0.437672
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/2.bed Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,5 @@ +chr19 50178708 50180708 NM_198318 0 + PRMT1 +chr6 90348174 90350174 NM_020466 0 - LYRM2 +chr16 58495848 58497848 NM_020465 0 + NDRG4 +chr5 180580242 180582242 NM_206880 0 + OR2V2 +chr9 120177017 120179017 NM_014010 0 - ASTN2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/2.tabular Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,4 @@ +0 0 0 0.144886 0 +0.396878 0.970009 1.1091 1.17538 1.40612 +0.203829 0.21262 0.144886 0.409996 0.274558 +0.180424 0.430989 0.458898 0.35171 0.307157
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/3.bed Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,7 @@ +chr19 50178708 50180708 +chr21 48119895 48139895 +chr6 90348174 90350174 +chr16 58495848 58497848 +chr5 180580242 180582242 +chr17 81194210 81196210 +chr9 120177017 120179017
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/3.tabular Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,7 @@ +#seq len A C G T N cpg +HSFAU1 515 125 138 146 106 0 23 +HSFAU2 514 124 138 146 106 0 25 +HSFAU3 518 125 139 149 105 0 25 +HSFAU4 524 128 142 148 106 0 26 +HSFAU5 518 124 138 147 109 0 25 +total 2589 626 695 736 532 0 124
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/4.bed Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,5 @@ +chr19 50178708 50183708 NM_198318 0 + PRMT1 +chr6 90345174 90350174 NM_020466 0 - LYRM2 +chr16 58495848 58500848 NM_020465 0 + NDRG4 +chr5 180580242 180585242 NM_206880 0 + OR2V2 +chr9 120174017 120179017 NM_014010 0 - ASTN2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/4.tabular Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,3 @@ +#seq len A C G T N cpg AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT +total 5178 1158 1431 1431 1158 0 248 360 238 408 142 328 447 248 408 320 426 447 238 150 320 328 360 +prcnt 1.0 0.2236 0.2764 0.2764 0.2236 0.0000 0.0479 0.0695 0.0460 0.0788 0.0274 0.0633 0.0863 0.0479 0.0788 0.0618 0.0823 0.0863 0.0460 0.0290 0.0618 0.0633 0.0695
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Tue Sep 09 10:32:57 2014 -0400 @@ -0,0 +1,88 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="bigWigSummary" version="1.0"> + <install version="1.0"> + <actions> + <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/bigWigSummary</action> + <action type="move_directory_files"> + <source_directory>.</source_directory> + <destination_directory>$INSTALL_DIR</destination_directory> + </action> + <action type="chmod"><file mode="755">$INSTALL_DIR/bigWigSummary</file></action> + <action type="set_environment"> + <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable> + </action> + </actions> + </install> + <readme> + </readme> + </package> + <package name="bedClip" version="1.0"> + <install version="1.0"> + <actions> + <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/bedClip</action> + <action type="move_directory_files"> + <source_directory>.</source_directory> + <destination_directory>$INSTALL_DIR</destination_directory> + </action> + <action type="chmod"><file mode="755">$INSTALL_DIR/bedClip</file></action> + <action type="set_environment"> + <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable> + </action> + </actions> + </install> + <readme> + </readme> + </package> + <package name="bedExtendRanges" version="1.0"> + <install version="1.0"> + <actions> + <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/bedExtendRanges</action> + <action type="move_directory_files"> + <source_directory>.</source_directory> + <destination_directory>$INSTALL_DIR</destination_directory> + </action> + <action type="chmod"><file mode="755">$INSTALL_DIR/bedExtendRanges</file></action> + <action type="set_environment"> + <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable> + </action> + </actions> + </install> + <readme> + </readme> + </package> + <package name="faCount" version="1.0"> + <install version="1.0"> + <actions> + <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/faCount</action> + <action type="move_directory_files"> + <source_directory>.</source_directory> + <destination_directory>$INSTALL_DIR</destination_directory> + </action> + <action type="chmod"><file mode="755">$INSTALL_DIR/faCount</file></action> + <action type="set_environment"> + <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable> + </action> + </actions> + </install> + <readme> + </readme> + </package> + <package name="fetchChromSizes" version="1.0"> + <install version="1.0"> + <actions> + <action type="download_by_url">http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64/fetchChromSizes</action> + <action type="move_directory_files"> + <source_directory>.</source_directory> + <destination_directory>$INSTALL_DIR</destination_directory> + </action> + <action type="chmod"><file mode="755">$INSTALL_DIR/fetchChromSizes</file></action> + <action type="set_environment"> + <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable> + </action> + </actions> + </install> + <readme> + </readme> + </package> +</tool_dependency>