Mercurial > repos > nikos > rna_probing_workflows
view HRF-Seq_workflow_paired-end.ga @ 4:bd833f4b9f1a draft default tip
Deleted selected files
author | nikos |
---|---|
date | Thu, 06 Nov 2014 05:53:46 -0500 |
parents | 608dbf6d6196 |
children |
line wrap: on
line source
{ "a_galaxy_workflow": "true", "annotation": "RNA Probing analysis workflow for paired-end data. RNA Probing suite must be installed in the Galaxy instance you are using in order to run this workflow (https://testtoolshed.g2.bx.psu.edu/view/nikos/rna_probing).", "format-version": "0.1", "name": "HRF-Seq data analysis (Paired-end)", "steps": { "0": { "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", "id": 0, "input_connections": {}, "inputs": [ { "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", "name": "Read1 (Treated)" } ], "name": "Input dataset", "outputs": [], "position": { "left": 278.0104374885559, "top": 252.38542222976685 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"name\": \"Read1 (Treated)\"}", "tool_version": null, "type": "data_input", "user_outputs": [] }, "1": { "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", "id": 1, "input_connections": {}, "inputs": [ { "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", "name": "Read2 (Treated)" } ], "name": "Input dataset", "outputs": [], "position": { "left": 284.93750047683716, "top": 399.29516649246216 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"name\": \"Read2 (Treated)\"}", "tool_version": null, "type": "data_input", "user_outputs": [] }, "2": { "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", "id": 2, "input_connections": {}, "inputs": [ { "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", "name": "Read1 (Control)" } ], "name": "Input dataset", "outputs": [], "position": { "left": 302.57641649246216, "top": 822.9409794807434 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"name\": \"Read1 (Control)\"}", "tool_version": null, "type": "data_input", "user_outputs": [] }, "3": { "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", "id": 3, "input_connections": {}, "inputs": [ { "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'", "name": "Read2 (Control)" } ], "name": "Input dataset", "outputs": [], "position": { "left": 300.54516649246216, "top": 980.8923954963684 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"name\": \"Read2 (Control)\"}", "tool_version": null, "type": "data_input", "user_outputs": [] }, "4": { "annotation": "FASTA format", "id": 4, "input_connections": {}, "inputs": [ { "description": "FASTA format", "name": "Reference sequence" } ], "name": "Input dataset", "outputs": [], "position": { "left": 863.9132237434387, "top": 664.3125004768372 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"name\": \"Reference sequence\"}", "tool_version": null, "type": "data_input", "user_outputs": [] }, "5": { "annotation": "", "id": 5, "input_connections": { "input": { "id": 0, "output_name": "output" } }, "inputs": [], "name": "Cutadapt", "outputs": [ { "name": "report", "type": "txt" }, { "name": "output", "type": "input" }, { "name": "rest_output", "type": "input" }, { "name": "wild_output", "type": "txt" }, { "name": "too_short_output", "type": "input" }, { "name": "untrimmed_output", "type": "input" } ], "position": { "left": 574.1041874885559, "top": 198.47916841506958 }, "post_job_actions": { "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" }, "HideDatasetActionreport": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "report" }, "HideDatasetActionrest_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "rest_output" }, "HideDatasetActiontoo_short_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "too_short_output" }, "HideDatasetActionuntrimmed_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "untrimmed_output" }, "HideDatasetActionwild_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "wild_output" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", "tool_version": "1.1.a", "type": "tool", "user_outputs": [] }, "6": { "annotation": "", "id": 6, "input_connections": { "input": { "id": 1, "output_name": "output" } }, "inputs": [], "name": "Cutadapt", "outputs": [ { "name": "report", "type": "txt" }, { "name": "output", "type": "input" }, { "name": "rest_output", "type": "input" }, { "name": "wild_output", "type": "txt" }, { "name": "too_short_output", "type": "input" }, { "name": "untrimmed_output", "type": "input" } ], "position": { "left": 569.1041874885559, "top": 507.4722294807434 }, "post_job_actions": { "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" }, "HideDatasetActionreport": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "report" }, "HideDatasetActionrest_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "rest_output" }, "HideDatasetActiontoo_short_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "too_short_output" }, "HideDatasetActionuntrimmed_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "untrimmed_output" }, "HideDatasetActionwild_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "wild_output" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", "tool_version": "1.1.a", "type": "tool", "user_outputs": [] }, "7": { "annotation": "", "id": 7, "input_connections": { "input": { "id": 2, "output_name": "output" } }, "inputs": [], "name": "Cutadapt", "outputs": [ { "name": "report", "type": "txt" }, { "name": "output", "type": "input" }, { "name": "rest_output", "type": "input" }, { "name": "wild_output", "type": "txt" }, { "name": "too_short_output", "type": "input" }, { "name": "untrimmed_output", "type": "input" } ], "position": { "left": 577.9236149787903, "top": 798.3923954963684 }, "post_job_actions": { "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" }, "HideDatasetActionreport": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "report" }, "HideDatasetActionrest_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "rest_output" }, "HideDatasetActiontoo_short_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "too_short_output" }, "HideDatasetActionuntrimmed_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "untrimmed_output" }, "HideDatasetActionwild_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "wild_output" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", "tool_version": "1.1.a", "type": "tool", "user_outputs": [] }, "8": { "annotation": "", "id": 8, "input_connections": { "input": { "id": 3, "output_name": "output" } }, "inputs": [], "name": "Cutadapt", "outputs": [ { "name": "report", "type": "txt" }, { "name": "output", "type": "input" }, { "name": "rest_output", "type": "input" }, { "name": "wild_output", "type": "txt" }, { "name": "too_short_output", "type": "input" }, { "name": "untrimmed_output", "type": "input" } ], "position": { "left": 581.934051990509, "top": 1090.3889164924622 }, "post_job_actions": { "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" }, "HideDatasetActionreport": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "report" }, "HideDatasetActionrest_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "rest_output" }, "HideDatasetActiontoo_short_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "too_short_output" }, "HideDatasetActionuntrimmed_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "untrimmed_output" }, "HideDatasetActionwild_output": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "wild_output" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a", "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}", "tool_version": "1.1.a", "type": "tool", "user_outputs": [] }, "9": { "annotation": "", "id": 9, "input_connections": { "library|input1": { "id": 5, "output_name": "output" }, "library|input2": { "id": 6, "output_name": "output" } }, "inputs": [ { "description": "runtime parameter for tool Preprocessing", "name": "library" } ], "name": "Preprocessing", "outputs": [ { "name": "output1", "type": "fastqsanger" }, { "name": "output2", "type": "fastqsanger" }, { "name": "barcodes", "type": "tabular" } ], "position": { "left": 875.0243344306946, "top": 252.333336353302 }, "post_job_actions": { "HideDatasetActionbarcodes": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "barcodes" }, "HideDatasetActionoutput1": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output1" }, "HideDatasetActionoutput2": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output2" } }, "tool_errors": null, "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0", "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"input2\\\": null, \\\"input1\\\": null, \\\"type\\\": \\\"paired\\\", \\\"__current_case__\\\": 1, \\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", "tool_version": "1.0.0", "type": "tool", "user_outputs": [] }, "10": { "annotation": "", "id": 10, "input_connections": { "library|input1": { "id": 7, "output_name": "output" }, "library|input2": { "id": 8, "output_name": "output" } }, "inputs": [ { "description": "runtime parameter for tool Preprocessing", "name": "library" } ], "name": "Preprocessing", "outputs": [ { "name": "output1", "type": "fastqsanger" }, { "name": "output2", "type": "fastqsanger" }, { "name": "barcodes", "type": "tabular" } ], "position": { "left": 897.159752368927, "top": 945.5972905158997 }, "post_job_actions": { "HideDatasetActionbarcodes": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "barcodes" }, "HideDatasetActionoutput1": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output1" }, "HideDatasetActionoutput2": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output2" } }, "tool_errors": null, "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0", "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"input2\\\": null, \\\"input1\\\": null, \\\"type\\\": \\\"paired\\\", \\\"__current_case__\\\": 1, \\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", "tool_version": "1.0.0", "type": "tool", "user_outputs": [] }, "11": { "annotation": "", "id": 11, "input_connections": { "library|input_1": { "id": 9, "output_name": "output1" }, "library|input_2": { "id": 9, "output_name": "output2" }, "reference_genome|own_file": { "id": 4, "output_name": "output" } }, "inputs": [], "name": "Bowtie2", "outputs": [ { "name": "output_unaligned_reads_l", "type": "fastqsanger" }, { "name": "output_unaligned_reads_r", "type": "fastqsanger" }, { "name": "output", "type": "bam" } ], "position": { "left": 1197.2986454963684, "top": 263.63542222976685 }, "post_job_actions": { "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" }, "HideDatasetActionoutput_unaligned_reads_l": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output_unaligned_reads_l" }, "HideDatasetActionoutput_unaligned_reads_r": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output_unaligned_reads_r" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2", "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"min_insert\\\": \\\"0\\\", \\\"type\\\": \\\"paired\\\", \\\"input_2\\\": null, \\\"__current_case__\\\": 1, \\\"input_1\\\": null, \\\"max_insert\\\": \\\"700\\\"}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}", "tool_version": "0.2", "type": "tool", "user_outputs": [] }, "12": { "annotation": "", "id": 12, "input_connections": { "library|input_1": { "id": 10, "output_name": "output1" }, "library|input_2": { "id": 10, "output_name": "output2" }, "reference_genome|own_file": { "id": 4, "output_name": "output" } }, "inputs": [], "name": "Bowtie2", "outputs": [ { "name": "output_unaligned_reads_l", "type": "fastqsanger" }, { "name": "output_unaligned_reads_r", "type": "fastqsanger" }, { "name": "output", "type": "bam" } ], "position": { "left": 1201.2222599983215, "top": 905.6666874885559 }, "post_job_actions": { "HideDatasetActionoutput": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output" }, "HideDatasetActionoutput_unaligned_reads_l": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output_unaligned_reads_l" }, "HideDatasetActionoutput_unaligned_reads_r": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "output_unaligned_reads_r" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2", "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"min_insert\\\": \\\"0\\\", \\\"type\\\": \\\"paired\\\", \\\"input_2\\\": null, \\\"__current_case__\\\": 1, \\\"input_1\\\": null, \\\"max_insert\\\": \\\"700\\\"}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}", "tool_version": "0.2", "type": "tool", "user_outputs": [] }, "13": { "annotation": "", "id": 13, "input_connections": { "input1": { "id": 11, "output_name": "output" }, "input2": { "id": 9, "output_name": "barcodes" } }, "inputs": [], "name": "Summarize Unique Barcodes", "outputs": [ { "name": "trimming_stats", "type": "tabular" }, { "name": "unique_barcodes", "type": "tabular" }, { "name": "read_counts", "type": "tabular" }, { "name": "k2n_file", "type": "txt" } ], "position": { "left": 1550.9965825080872, "top": 396.30905199050903 }, "post_job_actions": { "HideDatasetActionread_counts": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "read_counts" }, "HideDatasetActiontrimming_stats": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "trimming_stats" }, "RenameDatasetActionk2n_file": { "action_arguments": { "newname": "k2n file (Treated)" }, "action_type": "RenameDatasetAction", "output_name": "k2n_file" }, "RenameDatasetActionunique_barcodes": { "action_arguments": { "newname": "Unique Barcodes (Treated)" }, "action_type": "RenameDatasetAction", "output_name": "unique_barcodes" } }, "tool_errors": null, "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0", "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}", "tool_version": "1.0.0", "type": "tool", "user_outputs": [] }, "14": { "annotation": "", "id": 14, "input_connections": { "input1": { "id": 12, "output_name": "output" }, "input2": { "id": 10, "output_name": "barcodes" } }, "inputs": [], "name": "Summarize Unique Barcodes", "outputs": [ { "name": "trimming_stats", "type": "tabular" }, { "name": "unique_barcodes", "type": "tabular" }, { "name": "read_counts", "type": "tabular" }, { "name": "k2n_file", "type": "txt" } ], "position": { "left": 1569.3646245002747, "top": 835.7882084846497 }, "post_job_actions": { "HideDatasetActionread_counts": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "read_counts" }, "HideDatasetActiontrimming_stats": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "trimming_stats" }, "RenameDatasetActionk2n_file": { "action_arguments": { "newname": "k2n file (Control)" }, "action_type": "RenameDatasetAction", "output_name": "k2n_file" }, "RenameDatasetActionunique_barcodes": { "action_arguments": { "newname": "Unique Barcodes (Control)" }, "action_type": "RenameDatasetAction", "output_name": "unique_barcodes" } }, "tool_errors": null, "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0", "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}", "tool_version": "1.0.0", "type": "tool", "user_outputs": [] }, "15": { "annotation": "", "id": 15, "input_connections": { "control": { "id": 14, "output_name": "unique_barcodes" }, "euc_method|k2n_control": { "id": 14, "output_name": "k2n_file" }, "euc_method|k2n_treated": { "id": 13, "output_name": "k2n_file" }, "fasta": { "id": 4, "output_name": "output" }, "treated": { "id": 13, "output_name": "unique_barcodes" } }, "inputs": [], "name": "Normalize", "outputs": [ { "name": "normalized", "type": "tabular" }, { "name": "bedgraph_dtcr", "type": "bedgraph" }, { "name": "bedgraph_slograt", "type": "bedgraph" }, { "name": "bedgraph_swinsor", "type": "bedgraph" } ], "position": { "left": 1942.9097900390625, "top": 576.2430725097656 }, "post_job_actions": { "HideDatasetActionbedgraph_dtcr": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "bedgraph_dtcr" }, "HideDatasetActionbedgraph_slograt": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "bedgraph_slograt" }, "HideDatasetActionbedgraph_swinsor": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "bedgraph_swinsor" } }, "tool_errors": null, "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_normalize/1.0.0", "tool_state": "{\"control\": \"null\", \"cutoff\": \"\\\"101\\\"\", \"swinsor\": \"{\\\"wsize\\\": \\\"71\\\", \\\"only_top\\\": \\\"False\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"winsor_level\\\": \\\"0.9\\\"}\", \"nt_offset\": \"\\\"1\\\"\", \"__page__\": 0, \"euc_method\": \"{\\\"k2n_treated\\\": null, \\\"k2n_control\\\": null, \\\"euc\\\": \\\"HRF-Seq\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null, \"compdata\": \"\\\"True\\\"\", \"dtcr\": \"{\\\"wsize\\\": \\\"3\\\", \\\"zero\\\": \\\"True\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"fasta\": \"null\", \"slograt\": \"{\\\"wsize\\\": \\\"5\\\", \\\"depth_cor\\\": \\\"RNA\\\", \\\"pseudocount\\\": \\\"5\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"treated\": \"null\", \"bedgraph\": \"{\\\"check\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\"}", "tool_version": "1.0.0", "type": "tool", "user_outputs": [] } }, "uuid": "07942ce7-0206-47c6-a1e0-5848a1b5d96a" }