|
0
|
1 {
|
|
|
2 "a_galaxy_workflow": "true",
|
|
|
3 "annotation": "RNA Probing analysis workflow for paired-end data. RNA Probing suite must be installed in the Galaxy instance you are using in order to run this workflow (https://testtoolshed.g2.bx.psu.edu/view/nikos/rna_probing).",
|
|
|
4 "format-version": "0.1",
|
|
|
5 "name": "HRF-Seq data analysis (Paired-end)",
|
|
|
6 "steps": {
|
|
|
7 "0": {
|
|
|
8 "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
9 "id": 0,
|
|
|
10 "input_connections": {},
|
|
|
11 "inputs": [
|
|
|
12 {
|
|
|
13 "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
14 "name": "Read1 (Treated)"
|
|
|
15 }
|
|
|
16 ],
|
|
|
17 "name": "Input dataset",
|
|
|
18 "outputs": [],
|
|
|
19 "position": {
|
|
|
20 "left": 278.0104374885559,
|
|
|
21 "top": 252.38542222976685
|
|
|
22 },
|
|
|
23 "tool_errors": null,
|
|
|
24 "tool_id": null,
|
|
|
25 "tool_state": "{\"name\": \"Read1 (Treated)\"}",
|
|
|
26 "tool_version": null,
|
|
|
27 "type": "data_input",
|
|
|
28 "user_outputs": []
|
|
|
29 },
|
|
|
30 "1": {
|
|
|
31 "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
32 "id": 1,
|
|
|
33 "input_connections": {},
|
|
|
34 "inputs": [
|
|
|
35 {
|
|
|
36 "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
37 "name": "Read2 (Treated)"
|
|
|
38 }
|
|
|
39 ],
|
|
|
40 "name": "Input dataset",
|
|
|
41 "outputs": [],
|
|
|
42 "position": {
|
|
|
43 "left": 284.93750047683716,
|
|
|
44 "top": 399.29516649246216
|
|
|
45 },
|
|
|
46 "tool_errors": null,
|
|
|
47 "tool_id": null,
|
|
|
48 "tool_state": "{\"name\": \"Read2 (Treated)\"}",
|
|
|
49 "tool_version": null,
|
|
|
50 "type": "data_input",
|
|
|
51 "user_outputs": []
|
|
|
52 },
|
|
|
53 "2": {
|
|
|
54 "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
55 "id": 2,
|
|
|
56 "input_connections": {},
|
|
|
57 "inputs": [
|
|
|
58 {
|
|
|
59 "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
60 "name": "Read1 (Control)"
|
|
|
61 }
|
|
|
62 ],
|
|
|
63 "name": "Input dataset",
|
|
|
64 "outputs": [],
|
|
|
65 "position": {
|
|
|
66 "left": 302.57641649246216,
|
|
|
67 "top": 822.9409794807434
|
|
|
68 },
|
|
|
69 "tool_errors": null,
|
|
|
70 "tool_id": null,
|
|
|
71 "tool_state": "{\"name\": \"Read1 (Control)\"}",
|
|
|
72 "tool_version": null,
|
|
|
73 "type": "data_input",
|
|
|
74 "user_outputs": []
|
|
|
75 },
|
|
|
76 "3": {
|
|
|
77 "annotation": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
78 "id": 3,
|
|
|
79 "input_connections": {},
|
|
|
80 "inputs": [
|
|
|
81 {
|
|
|
82 "description": "Fastqsanger\nUse FastQ Groomer to convert the quality scores to 'Sanger'",
|
|
|
83 "name": "Read2 (Control)"
|
|
|
84 }
|
|
|
85 ],
|
|
|
86 "name": "Input dataset",
|
|
|
87 "outputs": [],
|
|
|
88 "position": {
|
|
|
89 "left": 300.54516649246216,
|
|
|
90 "top": 980.8923954963684
|
|
|
91 },
|
|
|
92 "tool_errors": null,
|
|
|
93 "tool_id": null,
|
|
|
94 "tool_state": "{\"name\": \"Read2 (Control)\"}",
|
|
|
95 "tool_version": null,
|
|
|
96 "type": "data_input",
|
|
|
97 "user_outputs": []
|
|
|
98 },
|
|
|
99 "4": {
|
|
|
100 "annotation": "FASTA format",
|
|
|
101 "id": 4,
|
|
|
102 "input_connections": {},
|
|
|
103 "inputs": [
|
|
|
104 {
|
|
|
105 "description": "FASTA format",
|
|
|
106 "name": "Reference sequence"
|
|
|
107 }
|
|
|
108 ],
|
|
|
109 "name": "Input dataset",
|
|
|
110 "outputs": [],
|
|
|
111 "position": {
|
|
|
112 "left": 863.9132237434387,
|
|
|
113 "top": 664.3125004768372
|
|
|
114 },
|
|
|
115 "tool_errors": null,
|
|
|
116 "tool_id": null,
|
|
|
117 "tool_state": "{\"name\": \"Reference sequence\"}",
|
|
|
118 "tool_version": null,
|
|
|
119 "type": "data_input",
|
|
|
120 "user_outputs": []
|
|
|
121 },
|
|
|
122 "5": {
|
|
|
123 "annotation": "",
|
|
|
124 "id": 5,
|
|
|
125 "input_connections": {
|
|
|
126 "input": {
|
|
|
127 "id": 0,
|
|
|
128 "output_name": "output"
|
|
|
129 }
|
|
|
130 },
|
|
|
131 "inputs": [],
|
|
|
132 "name": "Cutadapt",
|
|
|
133 "outputs": [
|
|
|
134 {
|
|
|
135 "name": "report",
|
|
|
136 "type": "txt"
|
|
|
137 },
|
|
|
138 {
|
|
|
139 "name": "output",
|
|
|
140 "type": "input"
|
|
|
141 },
|
|
|
142 {
|
|
|
143 "name": "rest_output",
|
|
|
144 "type": "input"
|
|
|
145 },
|
|
|
146 {
|
|
|
147 "name": "wild_output",
|
|
|
148 "type": "txt"
|
|
|
149 },
|
|
|
150 {
|
|
|
151 "name": "too_short_output",
|
|
|
152 "type": "input"
|
|
|
153 },
|
|
|
154 {
|
|
|
155 "name": "untrimmed_output",
|
|
|
156 "type": "input"
|
|
|
157 }
|
|
|
158 ],
|
|
|
159 "position": {
|
|
|
160 "left": 574.1041874885559,
|
|
|
161 "top": 198.47916841506958
|
|
|
162 },
|
|
|
163 "post_job_actions": {
|
|
|
164 "HideDatasetActionoutput": {
|
|
|
165 "action_arguments": {},
|
|
|
166 "action_type": "HideDatasetAction",
|
|
|
167 "output_name": "output"
|
|
|
168 },
|
|
|
169 "HideDatasetActionreport": {
|
|
|
170 "action_arguments": {},
|
|
|
171 "action_type": "HideDatasetAction",
|
|
|
172 "output_name": "report"
|
|
|
173 },
|
|
|
174 "HideDatasetActionrest_output": {
|
|
|
175 "action_arguments": {},
|
|
|
176 "action_type": "HideDatasetAction",
|
|
|
177 "output_name": "rest_output"
|
|
|
178 },
|
|
|
179 "HideDatasetActiontoo_short_output": {
|
|
|
180 "action_arguments": {},
|
|
|
181 "action_type": "HideDatasetAction",
|
|
|
182 "output_name": "too_short_output"
|
|
|
183 },
|
|
|
184 "HideDatasetActionuntrimmed_output": {
|
|
|
185 "action_arguments": {},
|
|
|
186 "action_type": "HideDatasetAction",
|
|
|
187 "output_name": "untrimmed_output"
|
|
|
188 },
|
|
|
189 "HideDatasetActionwild_output": {
|
|
|
190 "action_arguments": {},
|
|
|
191 "action_type": "HideDatasetAction",
|
|
|
192 "output_name": "wild_output"
|
|
|
193 }
|
|
|
194 },
|
|
|
195 "tool_errors": null,
|
|
|
196 "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a",
|
|
|
197 "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}",
|
|
|
198 "tool_version": "1.1.a",
|
|
|
199 "type": "tool",
|
|
|
200 "user_outputs": []
|
|
|
201 },
|
|
|
202 "6": {
|
|
|
203 "annotation": "",
|
|
|
204 "id": 6,
|
|
|
205 "input_connections": {
|
|
|
206 "input": {
|
|
|
207 "id": 1,
|
|
|
208 "output_name": "output"
|
|
|
209 }
|
|
|
210 },
|
|
|
211 "inputs": [],
|
|
|
212 "name": "Cutadapt",
|
|
|
213 "outputs": [
|
|
|
214 {
|
|
|
215 "name": "report",
|
|
|
216 "type": "txt"
|
|
|
217 },
|
|
|
218 {
|
|
|
219 "name": "output",
|
|
|
220 "type": "input"
|
|
|
221 },
|
|
|
222 {
|
|
|
223 "name": "rest_output",
|
|
|
224 "type": "input"
|
|
|
225 },
|
|
|
226 {
|
|
|
227 "name": "wild_output",
|
|
|
228 "type": "txt"
|
|
|
229 },
|
|
|
230 {
|
|
|
231 "name": "too_short_output",
|
|
|
232 "type": "input"
|
|
|
233 },
|
|
|
234 {
|
|
|
235 "name": "untrimmed_output",
|
|
|
236 "type": "input"
|
|
|
237 }
|
|
|
238 ],
|
|
|
239 "position": {
|
|
|
240 "left": 569.1041874885559,
|
|
|
241 "top": 507.4722294807434
|
|
|
242 },
|
|
|
243 "post_job_actions": {
|
|
|
244 "HideDatasetActionoutput": {
|
|
|
245 "action_arguments": {},
|
|
|
246 "action_type": "HideDatasetAction",
|
|
|
247 "output_name": "output"
|
|
|
248 },
|
|
|
249 "HideDatasetActionreport": {
|
|
|
250 "action_arguments": {},
|
|
|
251 "action_type": "HideDatasetAction",
|
|
|
252 "output_name": "report"
|
|
|
253 },
|
|
|
254 "HideDatasetActionrest_output": {
|
|
|
255 "action_arguments": {},
|
|
|
256 "action_type": "HideDatasetAction",
|
|
|
257 "output_name": "rest_output"
|
|
|
258 },
|
|
|
259 "HideDatasetActiontoo_short_output": {
|
|
|
260 "action_arguments": {},
|
|
|
261 "action_type": "HideDatasetAction",
|
|
|
262 "output_name": "too_short_output"
|
|
|
263 },
|
|
|
264 "HideDatasetActionuntrimmed_output": {
|
|
|
265 "action_arguments": {},
|
|
|
266 "action_type": "HideDatasetAction",
|
|
|
267 "output_name": "untrimmed_output"
|
|
|
268 },
|
|
|
269 "HideDatasetActionwild_output": {
|
|
|
270 "action_arguments": {},
|
|
|
271 "action_type": "HideDatasetAction",
|
|
|
272 "output_name": "wild_output"
|
|
|
273 }
|
|
|
274 },
|
|
|
275 "tool_errors": null,
|
|
|
276 "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a",
|
|
|
277 "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"quality_cutoff\\\": \\\"17\\\", \\\"suffix\\\": \\\"\\\", \\\"read_modification\\\": \\\"modify\\\", \\\"length_tag\\\": \\\"\\\", \\\"prefix\\\": \\\"\\\", \\\"__current_case__\\\": 1, \\\"zero_cap\\\": \\\"False\\\"}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}",
|
|
|
278 "tool_version": "1.1.a",
|
|
|
279 "type": "tool",
|
|
|
280 "user_outputs": []
|
|
|
281 },
|
|
|
282 "7": {
|
|
|
283 "annotation": "",
|
|
|
284 "id": 7,
|
|
|
285 "input_connections": {
|
|
|
286 "input": {
|
|
|
287 "id": 2,
|
|
|
288 "output_name": "output"
|
|
|
289 }
|
|
|
290 },
|
|
|
291 "inputs": [],
|
|
|
292 "name": "Cutadapt",
|
|
|
293 "outputs": [
|
|
|
294 {
|
|
|
295 "name": "report",
|
|
|
296 "type": "txt"
|
|
|
297 },
|
|
|
298 {
|
|
|
299 "name": "output",
|
|
|
300 "type": "input"
|
|
|
301 },
|
|
|
302 {
|
|
|
303 "name": "rest_output",
|
|
|
304 "type": "input"
|
|
|
305 },
|
|
|
306 {
|
|
|
307 "name": "wild_output",
|
|
|
308 "type": "txt"
|
|
|
309 },
|
|
|
310 {
|
|
|
311 "name": "too_short_output",
|
|
|
312 "type": "input"
|
|
|
313 },
|
|
|
314 {
|
|
|
315 "name": "untrimmed_output",
|
|
|
316 "type": "input"
|
|
|
317 }
|
|
|
318 ],
|
|
|
319 "position": {
|
|
|
320 "left": 577.9236149787903,
|
|
|
321 "top": 798.3923954963684
|
|
|
322 },
|
|
|
323 "post_job_actions": {
|
|
|
324 "HideDatasetActionoutput": {
|
|
|
325 "action_arguments": {},
|
|
|
326 "action_type": "HideDatasetAction",
|
|
|
327 "output_name": "output"
|
|
|
328 },
|
|
|
329 "HideDatasetActionreport": {
|
|
|
330 "action_arguments": {},
|
|
|
331 "action_type": "HideDatasetAction",
|
|
|
332 "output_name": "report"
|
|
|
333 },
|
|
|
334 "HideDatasetActionrest_output": {
|
|
|
335 "action_arguments": {},
|
|
|
336 "action_type": "HideDatasetAction",
|
|
|
337 "output_name": "rest_output"
|
|
|
338 },
|
|
|
339 "HideDatasetActiontoo_short_output": {
|
|
|
340 "action_arguments": {},
|
|
|
341 "action_type": "HideDatasetAction",
|
|
|
342 "output_name": "too_short_output"
|
|
|
343 },
|
|
|
344 "HideDatasetActionuntrimmed_output": {
|
|
|
345 "action_arguments": {},
|
|
|
346 "action_type": "HideDatasetAction",
|
|
|
347 "output_name": "untrimmed_output"
|
|
|
348 },
|
|
|
349 "HideDatasetActionwild_output": {
|
|
|
350 "action_arguments": {},
|
|
|
351 "action_type": "HideDatasetAction",
|
|
|
352 "output_name": "wild_output"
|
|
|
353 }
|
|
|
354 },
|
|
|
355 "tool_errors": null,
|
|
|
356 "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a",
|
|
|
357 "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCACACGTCT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}",
|
|
|
358 "tool_version": "1.1.a",
|
|
|
359 "type": "tool",
|
|
|
360 "user_outputs": []
|
|
|
361 },
|
|
|
362 "8": {
|
|
|
363 "annotation": "",
|
|
|
364 "id": 8,
|
|
|
365 "input_connections": {
|
|
|
366 "input": {
|
|
|
367 "id": 3,
|
|
|
368 "output_name": "output"
|
|
|
369 }
|
|
|
370 },
|
|
|
371 "inputs": [],
|
|
|
372 "name": "Cutadapt",
|
|
|
373 "outputs": [
|
|
|
374 {
|
|
|
375 "name": "report",
|
|
|
376 "type": "txt"
|
|
|
377 },
|
|
|
378 {
|
|
|
379 "name": "output",
|
|
|
380 "type": "input"
|
|
|
381 },
|
|
|
382 {
|
|
|
383 "name": "rest_output",
|
|
|
384 "type": "input"
|
|
|
385 },
|
|
|
386 {
|
|
|
387 "name": "wild_output",
|
|
|
388 "type": "txt"
|
|
|
389 },
|
|
|
390 {
|
|
|
391 "name": "too_short_output",
|
|
|
392 "type": "input"
|
|
|
393 },
|
|
|
394 {
|
|
|
395 "name": "untrimmed_output",
|
|
|
396 "type": "input"
|
|
|
397 }
|
|
|
398 ],
|
|
|
399 "position": {
|
|
|
400 "left": 581.934051990509,
|
|
|
401 "top": 1090.3889164924622
|
|
|
402 },
|
|
|
403 "post_job_actions": {
|
|
|
404 "HideDatasetActionoutput": {
|
|
|
405 "action_arguments": {},
|
|
|
406 "action_type": "HideDatasetAction",
|
|
|
407 "output_name": "output"
|
|
|
408 },
|
|
|
409 "HideDatasetActionreport": {
|
|
|
410 "action_arguments": {},
|
|
|
411 "action_type": "HideDatasetAction",
|
|
|
412 "output_name": "report"
|
|
|
413 },
|
|
|
414 "HideDatasetActionrest_output": {
|
|
|
415 "action_arguments": {},
|
|
|
416 "action_type": "HideDatasetAction",
|
|
|
417 "output_name": "rest_output"
|
|
|
418 },
|
|
|
419 "HideDatasetActiontoo_short_output": {
|
|
|
420 "action_arguments": {},
|
|
|
421 "action_type": "HideDatasetAction",
|
|
|
422 "output_name": "too_short_output"
|
|
|
423 },
|
|
|
424 "HideDatasetActionuntrimmed_output": {
|
|
|
425 "action_arguments": {},
|
|
|
426 "action_type": "HideDatasetAction",
|
|
|
427 "output_name": "untrimmed_output"
|
|
|
428 },
|
|
|
429 "HideDatasetActionwild_output": {
|
|
|
430 "action_arguments": {},
|
|
|
431 "action_type": "HideDatasetAction",
|
|
|
432 "output_name": "wild_output"
|
|
|
433 }
|
|
|
434 },
|
|
|
435 "tool_errors": null,
|
|
|
436 "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/1.1.a",
|
|
|
437 "tool_state": "{\"count\": \"\\\"1\\\"\", \"error_rate\": \"\\\"0.1\\\"\", \"match_read_wildcards\": \"\\\"False\\\"\", \"__page__\": 0, \"output_params\": \"{\\\"output_type\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"overlap\": \"\\\"3\\\"\", \"front_adapters\": \"[]\", \"no_match_adapters_wildcards\": \"\\\"False\\\"\", \"input\": \"null\", \"anywhere_adapters\": \"[]\", \"adapters\": \"[{\\\"__index__\\\": 0, \\\"adapter_source\\\": {\\\"adapter\\\": \\\"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT\\\", \\\"adapter_source_list\\\": \\\"user\\\", \\\"__current_case__\\\": 0}}]\", \"read_modification_params\": \"{\\\"read_modification\\\": \\\"none\\\", \\\"__current_case__\\\": 0}\", \"output_filtering_options\": \"{\\\"output_filtering\\\": \\\"default\\\", \\\"__current_case__\\\": 0}\"}",
|
|
|
438 "tool_version": "1.1.a",
|
|
|
439 "type": "tool",
|
|
|
440 "user_outputs": []
|
|
|
441 },
|
|
|
442 "9": {
|
|
|
443 "annotation": "",
|
|
|
444 "id": 9,
|
|
|
445 "input_connections": {
|
|
|
446 "library|input1": {
|
|
|
447 "id": 5,
|
|
|
448 "output_name": "output"
|
|
|
449 },
|
|
|
450 "library|input2": {
|
|
|
451 "id": 6,
|
|
|
452 "output_name": "output"
|
|
|
453 }
|
|
|
454 },
|
|
|
455 "inputs": [
|
|
|
456 {
|
|
|
457 "description": "runtime parameter for tool Preprocessing",
|
|
|
458 "name": "library"
|
|
|
459 }
|
|
|
460 ],
|
|
|
461 "name": "Preprocessing",
|
|
|
462 "outputs": [
|
|
|
463 {
|
|
|
464 "name": "output1",
|
|
|
465 "type": "fastqsanger"
|
|
|
466 },
|
|
|
467 {
|
|
|
468 "name": "output2",
|
|
|
469 "type": "fastqsanger"
|
|
|
470 },
|
|
|
471 {
|
|
|
472 "name": "barcodes",
|
|
|
473 "type": "tabular"
|
|
|
474 }
|
|
|
475 ],
|
|
|
476 "position": {
|
|
|
477 "left": 875.0243344306946,
|
|
|
478 "top": 252.333336353302
|
|
|
479 },
|
|
|
480 "post_job_actions": {
|
|
|
481 "HideDatasetActionbarcodes": {
|
|
|
482 "action_arguments": {},
|
|
|
483 "action_type": "HideDatasetAction",
|
|
|
484 "output_name": "barcodes"
|
|
|
485 },
|
|
|
486 "HideDatasetActionoutput1": {
|
|
|
487 "action_arguments": {},
|
|
|
488 "action_type": "HideDatasetAction",
|
|
|
489 "output_name": "output1"
|
|
|
490 },
|
|
|
491 "HideDatasetActionoutput2": {
|
|
|
492 "action_arguments": {},
|
|
|
493 "action_type": "HideDatasetAction",
|
|
|
494 "output_name": "output2"
|
|
|
495 }
|
|
|
496 },
|
|
|
497 "tool_errors": null,
|
|
|
498 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0",
|
|
|
499 "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"input2\\\": null, \\\"input1\\\": null, \\\"type\\\": \\\"paired\\\", \\\"__current_case__\\\": 1, \\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}",
|
|
|
500 "tool_version": "1.0.0",
|
|
|
501 "type": "tool",
|
|
|
502 "user_outputs": []
|
|
|
503 },
|
|
|
504 "10": {
|
|
|
505 "annotation": "",
|
|
|
506 "id": 10,
|
|
|
507 "input_connections": {
|
|
|
508 "library|input1": {
|
|
|
509 "id": 7,
|
|
|
510 "output_name": "output"
|
|
|
511 },
|
|
|
512 "library|input2": {
|
|
|
513 "id": 8,
|
|
|
514 "output_name": "output"
|
|
|
515 }
|
|
|
516 },
|
|
|
517 "inputs": [
|
|
|
518 {
|
|
|
519 "description": "runtime parameter for tool Preprocessing",
|
|
|
520 "name": "library"
|
|
|
521 }
|
|
|
522 ],
|
|
|
523 "name": "Preprocessing",
|
|
|
524 "outputs": [
|
|
|
525 {
|
|
|
526 "name": "output1",
|
|
|
527 "type": "fastqsanger"
|
|
|
528 },
|
|
|
529 {
|
|
|
530 "name": "output2",
|
|
|
531 "type": "fastqsanger"
|
|
|
532 },
|
|
|
533 {
|
|
|
534 "name": "barcodes",
|
|
|
535 "type": "tabular"
|
|
|
536 }
|
|
|
537 ],
|
|
|
538 "position": {
|
|
|
539 "left": 897.159752368927,
|
|
|
540 "top": 945.5972905158997
|
|
|
541 },
|
|
|
542 "post_job_actions": {
|
|
|
543 "HideDatasetActionbarcodes": {
|
|
|
544 "action_arguments": {},
|
|
|
545 "action_type": "HideDatasetAction",
|
|
|
546 "output_name": "barcodes"
|
|
|
547 },
|
|
|
548 "HideDatasetActionoutput1": {
|
|
|
549 "action_arguments": {},
|
|
|
550 "action_type": "HideDatasetAction",
|
|
|
551 "output_name": "output1"
|
|
|
552 },
|
|
|
553 "HideDatasetActionoutput2": {
|
|
|
554 "action_arguments": {},
|
|
|
555 "action_type": "HideDatasetAction",
|
|
|
556 "output_name": "output2"
|
|
|
557 }
|
|
|
558 },
|
|
|
559 "tool_errors": null,
|
|
|
560 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_preprocessing/1.0.0",
|
|
|
561 "tool_state": "{\"trim\": \"\\\"15\\\"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"library\": \"{\\\"input2\\\": null, \\\"input1\\\": null, \\\"type\\\": \\\"paired\\\", \\\"__current_case__\\\": 1, \\\"barcode_seq\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}",
|
|
|
562 "tool_version": "1.0.0",
|
|
|
563 "type": "tool",
|
|
|
564 "user_outputs": []
|
|
|
565 },
|
|
|
566 "11": {
|
|
|
567 "annotation": "",
|
|
|
568 "id": 11,
|
|
|
569 "input_connections": {
|
|
|
570 "library|input_1": {
|
|
|
571 "id": 9,
|
|
|
572 "output_name": "output1"
|
|
|
573 },
|
|
|
574 "library|input_2": {
|
|
|
575 "id": 9,
|
|
|
576 "output_name": "output2"
|
|
|
577 },
|
|
|
578 "reference_genome|own_file": {
|
|
|
579 "id": 4,
|
|
|
580 "output_name": "output"
|
|
|
581 }
|
|
|
582 },
|
|
|
583 "inputs": [],
|
|
|
584 "name": "Bowtie2",
|
|
|
585 "outputs": [
|
|
|
586 {
|
|
|
587 "name": "output_unaligned_reads_l",
|
|
|
588 "type": "fastqsanger"
|
|
|
589 },
|
|
|
590 {
|
|
|
591 "name": "output_unaligned_reads_r",
|
|
|
592 "type": "fastqsanger"
|
|
|
593 },
|
|
|
594 {
|
|
|
595 "name": "output",
|
|
|
596 "type": "bam"
|
|
|
597 }
|
|
|
598 ],
|
|
|
599 "position": {
|
|
|
600 "left": 1197.2986454963684,
|
|
|
601 "top": 263.63542222976685
|
|
|
602 },
|
|
|
603 "post_job_actions": {
|
|
|
604 "HideDatasetActionoutput": {
|
|
|
605 "action_arguments": {},
|
|
|
606 "action_type": "HideDatasetAction",
|
|
|
607 "output_name": "output"
|
|
|
608 },
|
|
|
609 "HideDatasetActionoutput_unaligned_reads_l": {
|
|
|
610 "action_arguments": {},
|
|
|
611 "action_type": "HideDatasetAction",
|
|
|
612 "output_name": "output_unaligned_reads_l"
|
|
|
613 },
|
|
|
614 "HideDatasetActionoutput_unaligned_reads_r": {
|
|
|
615 "action_arguments": {},
|
|
|
616 "action_type": "HideDatasetAction",
|
|
|
617 "output_name": "output_unaligned_reads_r"
|
|
|
618 }
|
|
|
619 },
|
|
|
620 "tool_errors": null,
|
|
|
621 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2",
|
|
|
622 "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"min_insert\\\": \\\"0\\\", \\\"type\\\": \\\"paired\\\", \\\"input_2\\\": null, \\\"__current_case__\\\": 1, \\\"input_1\\\": null, \\\"max_insert\\\": \\\"700\\\"}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}",
|
|
|
623 "tool_version": "0.2",
|
|
|
624 "type": "tool",
|
|
|
625 "user_outputs": []
|
|
|
626 },
|
|
|
627 "12": {
|
|
|
628 "annotation": "",
|
|
|
629 "id": 12,
|
|
|
630 "input_connections": {
|
|
|
631 "library|input_1": {
|
|
|
632 "id": 10,
|
|
|
633 "output_name": "output1"
|
|
|
634 },
|
|
|
635 "library|input_2": {
|
|
|
636 "id": 10,
|
|
|
637 "output_name": "output2"
|
|
|
638 },
|
|
|
639 "reference_genome|own_file": {
|
|
|
640 "id": 4,
|
|
|
641 "output_name": "output"
|
|
|
642 }
|
|
|
643 },
|
|
|
644 "inputs": [],
|
|
|
645 "name": "Bowtie2",
|
|
|
646 "outputs": [
|
|
|
647 {
|
|
|
648 "name": "output_unaligned_reads_l",
|
|
|
649 "type": "fastqsanger"
|
|
|
650 },
|
|
|
651 {
|
|
|
652 "name": "output_unaligned_reads_r",
|
|
|
653 "type": "fastqsanger"
|
|
|
654 },
|
|
|
655 {
|
|
|
656 "name": "output",
|
|
|
657 "type": "bam"
|
|
|
658 }
|
|
|
659 ],
|
|
|
660 "position": {
|
|
|
661 "left": 1201.2222599983215,
|
|
|
662 "top": 905.6666874885559
|
|
|
663 },
|
|
|
664 "post_job_actions": {
|
|
|
665 "HideDatasetActionoutput": {
|
|
|
666 "action_arguments": {},
|
|
|
667 "action_type": "HideDatasetAction",
|
|
|
668 "output_name": "output"
|
|
|
669 },
|
|
|
670 "HideDatasetActionoutput_unaligned_reads_l": {
|
|
|
671 "action_arguments": {},
|
|
|
672 "action_type": "HideDatasetAction",
|
|
|
673 "output_name": "output_unaligned_reads_l"
|
|
|
674 },
|
|
|
675 "HideDatasetActionoutput_unaligned_reads_r": {
|
|
|
676 "action_arguments": {},
|
|
|
677 "action_type": "HideDatasetAction",
|
|
|
678 "output_name": "output_unaligned_reads_r"
|
|
|
679 }
|
|
|
680 },
|
|
|
681 "tool_errors": null,
|
|
|
682 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/0.2",
|
|
|
683 "tool_state": "{\"__page__\": 0, \"read_group\": \"{\\\"selection\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"unaligned_file\": \"\\\"False\\\"\", \"library\": \"{\\\"min_insert\\\": \\\"0\\\", \\\"type\\\": \\\"paired\\\", \\\"input_2\\\": null, \\\"__current_case__\\\": 1, \\\"input_1\\\": null, \\\"max_insert\\\": \\\"700\\\"}\", \"reference_genome\": \"{\\\"source\\\": \\\"history\\\", \\\"__current_case__\\\": 1, \\\"own_file\\\": null}\", \"params\": \"{\\\"upto\\\": \\\"0\\\", \\\"full\\\": \\\"yes\\\", \\\"nofw_norc\\\": \\\"--norc\\\", \\\"align_type\\\": \\\"\\\", \\\"skip\\\": \\\"0\\\", \\\"__current_case__\\\": 0, \\\"time\\\": \\\"\\\", \\\"performance\\\": \\\"--sensitive\\\", \\\"gbar\\\": \\\"4\\\", \\\"trim5\\\": \\\"0\\\", \\\"trim3\\\": \\\"0\\\"}\"}",
|
|
|
684 "tool_version": "0.2",
|
|
|
685 "type": "tool",
|
|
|
686 "user_outputs": []
|
|
|
687 },
|
|
|
688 "13": {
|
|
|
689 "annotation": "",
|
|
|
690 "id": 13,
|
|
|
691 "input_connections": {
|
|
|
692 "input1": {
|
|
|
693 "id": 11,
|
|
|
694 "output_name": "output"
|
|
|
695 },
|
|
|
696 "input2": {
|
|
|
697 "id": 9,
|
|
|
698 "output_name": "barcodes"
|
|
|
699 }
|
|
|
700 },
|
|
|
701 "inputs": [],
|
|
|
702 "name": "Summarize Unique Barcodes",
|
|
|
703 "outputs": [
|
|
|
704 {
|
|
|
705 "name": "trimming_stats",
|
|
|
706 "type": "tabular"
|
|
|
707 },
|
|
|
708 {
|
|
|
709 "name": "unique_barcodes",
|
|
|
710 "type": "tabular"
|
|
|
711 },
|
|
|
712 {
|
|
|
713 "name": "read_counts",
|
|
|
714 "type": "tabular"
|
|
|
715 },
|
|
|
716 {
|
|
|
717 "name": "k2n_file",
|
|
|
718 "type": "txt"
|
|
|
719 }
|
|
|
720 ],
|
|
|
721 "position": {
|
|
|
722 "left": 1550.9965825080872,
|
|
|
723 "top": 396.30905199050903
|
|
|
724 },
|
|
|
725 "post_job_actions": {
|
|
|
726 "HideDatasetActionread_counts": {
|
|
|
727 "action_arguments": {},
|
|
|
728 "action_type": "HideDatasetAction",
|
|
|
729 "output_name": "read_counts"
|
|
|
730 },
|
|
|
731 "HideDatasetActiontrimming_stats": {
|
|
|
732 "action_arguments": {},
|
|
|
733 "action_type": "HideDatasetAction",
|
|
|
734 "output_name": "trimming_stats"
|
|
|
735 },
|
|
|
736 "RenameDatasetActionk2n_file": {
|
|
|
737 "action_arguments": {
|
|
|
738 "newname": "k2n file (Treated)"
|
|
|
739 },
|
|
|
740 "action_type": "RenameDatasetAction",
|
|
|
741 "output_name": "k2n_file"
|
|
|
742 },
|
|
|
743 "RenameDatasetActionunique_barcodes": {
|
|
|
744 "action_arguments": {
|
|
|
745 "newname": "Unique Barcodes (Treated)"
|
|
|
746 },
|
|
|
747 "action_type": "RenameDatasetAction",
|
|
|
748 "output_name": "unique_barcodes"
|
|
|
749 }
|
|
|
750 },
|
|
|
751 "tool_errors": null,
|
|
|
752 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0",
|
|
|
753 "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}",
|
|
|
754 "tool_version": "1.0.0",
|
|
|
755 "type": "tool",
|
|
|
756 "user_outputs": []
|
|
|
757 },
|
|
|
758 "14": {
|
|
|
759 "annotation": "",
|
|
|
760 "id": 14,
|
|
|
761 "input_connections": {
|
|
|
762 "input1": {
|
|
|
763 "id": 12,
|
|
|
764 "output_name": "output"
|
|
|
765 },
|
|
|
766 "input2": {
|
|
|
767 "id": 10,
|
|
|
768 "output_name": "barcodes"
|
|
|
769 }
|
|
|
770 },
|
|
|
771 "inputs": [],
|
|
|
772 "name": "Summarize Unique Barcodes",
|
|
|
773 "outputs": [
|
|
|
774 {
|
|
|
775 "name": "trimming_stats",
|
|
|
776 "type": "tabular"
|
|
|
777 },
|
|
|
778 {
|
|
|
779 "name": "unique_barcodes",
|
|
|
780 "type": "tabular"
|
|
|
781 },
|
|
|
782 {
|
|
|
783 "name": "read_counts",
|
|
|
784 "type": "tabular"
|
|
|
785 },
|
|
|
786 {
|
|
|
787 "name": "k2n_file",
|
|
|
788 "type": "txt"
|
|
|
789 }
|
|
|
790 ],
|
|
|
791 "position": {
|
|
|
792 "left": 1569.3646245002747,
|
|
|
793 "top": 835.7882084846497
|
|
|
794 },
|
|
|
795 "post_job_actions": {
|
|
|
796 "HideDatasetActionread_counts": {
|
|
|
797 "action_arguments": {},
|
|
|
798 "action_type": "HideDatasetAction",
|
|
|
799 "output_name": "read_counts"
|
|
|
800 },
|
|
|
801 "HideDatasetActiontrimming_stats": {
|
|
|
802 "action_arguments": {},
|
|
|
803 "action_type": "HideDatasetAction",
|
|
|
804 "output_name": "trimming_stats"
|
|
|
805 },
|
|
|
806 "RenameDatasetActionk2n_file": {
|
|
|
807 "action_arguments": {
|
|
|
808 "newname": "k2n file (Control)"
|
|
|
809 },
|
|
|
810 "action_type": "RenameDatasetAction",
|
|
|
811 "output_name": "k2n_file"
|
|
|
812 },
|
|
|
813 "RenameDatasetActionunique_barcodes": {
|
|
|
814 "action_arguments": {
|
|
|
815 "newname": "Unique Barcodes (Control)"
|
|
|
816 },
|
|
|
817 "action_type": "RenameDatasetAction",
|
|
|
818 "output_name": "unique_barcodes"
|
|
|
819 }
|
|
|
820 },
|
|
|
821 "tool_errors": null,
|
|
|
822 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_summarize/1.0.0",
|
|
|
823 "tool_state": "{\"input2\": \"null\", \"__page__\": 0, \"input1\": \"null\", \"__rerun_remap_job_id__\": null, \"k2n\": \"\\\"True\\\"\", \"priming\": \"{\\\"flag\\\": \\\"False\\\", \\\"__current_case__\\\": 1}\", \"trimming\": \"\\\"True\\\"\"}",
|
|
|
824 "tool_version": "1.0.0",
|
|
|
825 "type": "tool",
|
|
|
826 "user_outputs": []
|
|
|
827 },
|
|
|
828 "15": {
|
|
|
829 "annotation": "",
|
|
|
830 "id": 15,
|
|
|
831 "input_connections": {
|
|
|
832 "control": {
|
|
|
833 "id": 14,
|
|
|
834 "output_name": "unique_barcodes"
|
|
|
835 },
|
|
|
836 "euc_method|k2n_control": {
|
|
|
837 "id": 14,
|
|
|
838 "output_name": "k2n_file"
|
|
|
839 },
|
|
|
840 "euc_method|k2n_treated": {
|
|
|
841 "id": 13,
|
|
|
842 "output_name": "k2n_file"
|
|
|
843 },
|
|
|
844 "fasta": {
|
|
|
845 "id": 4,
|
|
|
846 "output_name": "output"
|
|
|
847 },
|
|
|
848 "treated": {
|
|
|
849 "id": 13,
|
|
|
850 "output_name": "unique_barcodes"
|
|
|
851 }
|
|
|
852 },
|
|
|
853 "inputs": [],
|
|
|
854 "name": "Normalize",
|
|
|
855 "outputs": [
|
|
|
856 {
|
|
|
857 "name": "normalized",
|
|
|
858 "type": "tabular"
|
|
|
859 },
|
|
|
860 {
|
|
|
861 "name": "bedgraph_dtcr",
|
|
|
862 "type": "bedgraph"
|
|
|
863 },
|
|
|
864 {
|
|
|
865 "name": "bedgraph_slograt",
|
|
|
866 "type": "bedgraph"
|
|
|
867 },
|
|
|
868 {
|
|
|
869 "name": "bedgraph_swinsor",
|
|
|
870 "type": "bedgraph"
|
|
|
871 }
|
|
|
872 ],
|
|
|
873 "position": {
|
|
|
874 "left": 1942.9097900390625,
|
|
|
875 "top": 576.2430725097656
|
|
|
876 },
|
|
|
877 "post_job_actions": {
|
|
|
878 "HideDatasetActionbedgraph_dtcr": {
|
|
|
879 "action_arguments": {},
|
|
|
880 "action_type": "HideDatasetAction",
|
|
|
881 "output_name": "bedgraph_dtcr"
|
|
|
882 },
|
|
|
883 "HideDatasetActionbedgraph_slograt": {
|
|
|
884 "action_arguments": {},
|
|
|
885 "action_type": "HideDatasetAction",
|
|
|
886 "output_name": "bedgraph_slograt"
|
|
|
887 },
|
|
|
888 "HideDatasetActionbedgraph_swinsor": {
|
|
|
889 "action_arguments": {},
|
|
|
890 "action_type": "HideDatasetAction",
|
|
|
891 "output_name": "bedgraph_swinsor"
|
|
|
892 }
|
|
|
893 },
|
|
|
894 "tool_errors": null,
|
|
|
895 "tool_id": "testtoolshed.g2.bx.psu.edu/repos/nikos/rna_probing/rna_probing_normalize/1.0.0",
|
|
|
896 "tool_state": "{\"control\": \"null\", \"cutoff\": \"\\\"101\\\"\", \"swinsor\": \"{\\\"wsize\\\": \\\"71\\\", \\\"only_top\\\": \\\"False\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"winsor_level\\\": \\\"0.9\\\"}\", \"nt_offset\": \"\\\"1\\\"\", \"__page__\": 0, \"euc_method\": \"{\\\"k2n_treated\\\": null, \\\"k2n_control\\\": null, \\\"euc\\\": \\\"HRF-Seq\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null, \"compdata\": \"\\\"True\\\"\", \"dtcr\": \"{\\\"wsize\\\": \\\"3\\\", \\\"zero\\\": \\\"True\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"fasta\": \"null\", \"slograt\": \"{\\\"wsize\\\": \\\"5\\\", \\\"depth_cor\\\": \\\"RNA\\\", \\\"pseudocount\\\": \\\"5\\\", \\\"check\\\": \\\"yes\\\", \\\"__current_case__\\\": 1}\", \"treated\": \"null\", \"bedgraph\": \"{\\\"check\\\": \\\"no\\\", \\\"__current_case__\\\": 1}\"}",
|
|
|
897 "tool_version": "1.0.0",
|
|
|
898 "type": "tool",
|
|
|
899 "user_outputs": []
|
|
|
900 }
|
|
|
901 },
|
|
|
902 "uuid": "07942ce7-0206-47c6-a1e0-5848a1b5d96a"
|
|
|
903 } |
