changeset 0:b75ea9927793

Uploaded
author jjohnson
date Fri, 04 Jan 2013 11:53:33 -0500
parents
children 6ee9d8b45113
files README defuse.xml tool-data/defuse.loc.sample tool_dependencies.xml
diffstat 4 files changed, 790 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README	Fri Jan 04 11:53:33 2013 -0500
@@ -0,0 +1,35 @@
+The DeFuse galaxy tool is based on DeFuse_Version_0.5.0
+http://sourceforge.net/apps/mediawiki/defuse/index.php?title=Main_Page
+
+DeFuse is a software package for gene fusion discovery using RNA-Seq data. The software uses clusters of discordant paired end alignments to inform a split read alignment analysis for finding fusion boundaries. The software also employs a number of heuristic filters in an attempt to reduce the number of false positives and produces a fully annotated output for each predicted fusion.
+
+
+Manual:
+http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2
+
+The included tool_dependencies.xml will download and install the defuse code.  
+It will set the environment variable: "DEFUSE_PATH" to the location of the defuse install.  
+
+
+The defuse.pl command relies on a configuration file to specifiy options, the location of reference data, and other applications that it depends upon: bowtie, bowtie-build, samtools, blat, fatotwobit, R, and Rscript.
+
+The DeFuse galaxy tool can either construct the config.txt file that is mentioned in the defuse manual, or select an existing config.txt file in the users history.   
+When constructing the config.txt file, the DeFuse tool uses the values selected in: tool-data/defuse.loc    
+The dictionary field in the tool-data/defuse.loc can be used to set fields in the config.txt file, including the site specific location of reference data and the paths to the other application binaries.  
+The "Defuse parameter settings" are used to alter options in the config.txt file.
+
+The DeFuse galaxy tool also generates a bash script to run defuse.  
+That script will attempt to edit the config.txt file to specifiy any unset paths to applications that defuse relies upon:
+bowtie, bowtie-build, samtools, blat, fatotwobit, R, and Rscript
+The script uses the using the shell "which" command to discover the application path, so the required applications should in PATH environment variable.
+
+
+Generate Reference Datasets as described in the Manual: 
+
+The manual has detailed instructions on how to set up reference datasets for Human hg19 and hg18. 
+We were able to follow the same basic procedures to set up a reference for Mouse mm9.
+
+These datasets should be referenced in the tool-data/defuse.loc file. 
+
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/defuse.xml	Fri Jan 04 11:53:33 2013 -0500
@@ -0,0 +1,723 @@
+<tool id="defuse" name="DeFuse" version="1.5">
+ <description>identify fusion transcripts</description>
+ <requirements>
+  <requirement type="package" version="0.5.0">defuse</requirement>
+  <requirement type="package">bowtie</requirement>
+  <requirement type="package">blat</requirement>
+  <requirement type="package">fatotwobit</requirement>
+ </requirements>
+  <command interpreter="command"> /bin/bash $shscript </command>
+ <inputs>
+  <param name="left_pairendreads" type="data" format="fastq" label="left part of read pairs" help="The left and right reads pairs must be in the same order, and not have any unpaired reads.  (FASTQ interlacer will pair reads and remove the unpaired.   FASTQ de-interlacer will separate the result into left and right reads.)"/>
+  <param name="right_pairendreads" type="data" format="fastq" label="right part of read pairs" help="In the same order as the left reads"/>
+  <conditional name="refGenomeSource">
+      <param name="genomeSource" type="select" label="Will you select a built-in DeFuse Reference Dataset, or supply a configuration from your history" help="">
+        <option value="indexed">Use a built-in DeFuse Reference Dataset</option>
+        <option value="history">Use a configuration from your history that specifies the DeFuse Reference Dataset</option>
+      </param>
+      <when value="indexed">
+        <param name="index" type="select" label="Select a Reference Dataset" help="if your genome of interest is not listed - contact Galaxy team">
+          <options from_file="defuse.loc">
+            <column name="name" index="1"/>
+            <column name="value" index="2"/>
+            <filter type="sort_by" column="0" />
+            <validator type="no_options" message="No indexes are available" />
+          </options>
+        </param>
+        <conditional name="defuse_param">
+          <param name="settings" type="select" label="Defuse parameter settings" help="">
+            <option value="preSet">Default settings</option>
+            <option value="full">Full parameter list</option>
+          </param>
+          <when value="preSet" />
+          <when value="full">
+            <param name="max_insert_size" type="integer" value="500" optional="true" label="Bowtie max_insert_size" />
+            <param name="dna_concordant_length" type="integer" value="2000" optional="true" label="Minimum gene fusion range dna_concordant_length" />
+            <param name="discord_read_trim" type="integer" value="50" optional="true" label="Trim length for discordant reads discord_read_trim" help="(split reads are not trimmed)" />
+            <param name="clustering_precision" type="float" value=".95" optional="true" label="Filter clustering_precision">
+              <validator type="in_range" message="Choose a value between .1 and 1.0" min=".1" max="1"/>
+            </param>
+            <param name="span_count_threshold" type="integer" value="5" optional="true" label="Filter span_count_threshold" />
+            <param name="split_count_threshold" type="integer" value="3" optional="true" label="Filter split_count_threshold" />
+            <param name="percent_identity_threshold" type="float" value=".90" optional="true" label="Filter percent_identity_threshold">
+              <validator type="in_range" message="Choose a value between .1 and 1.0" min=".1" max="1"/>
+            </param>
+            <param name="max_dist_pos" type="integer" value="600" optional="true" label="Filter max_dist_pos" />
+            <param name="num_dist_genes" type="integer" value="500" optional="true" label="Filter num_dist_genes" />
+            <param name="split_min_anchor" type="integer" value="4" optional="true" label="Filter split_min_anchor" />
+            <param name="max_concordant_ratio" type="float" value="0.1" optional="true" label="Filter max_concordant_ratio">
+              <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/>
+            </param>
+            <param name="splice_bias" type="integer" value="10" optional="true" label="Filter splice_bias" />
+            <param name="probability_threshold" type="float" value="0.50" optional="true" label="Filter probability_threshold">
+              <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/>
+            </param>
+            <param name="covariance_sampling_density" type="float" value="0.01" optional="true" label="covariance_sampling_density">
+              <help>Position density when calculating covariance</help>
+              <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/>
+            </param>
+            <param name="denovo_assembly" type="select" label="denovo_assembly" help="">
+              <option value="">Use Default</option>
+              <option value="no">no</option>
+              <option value="yes">yes</option>
+            </param>
+            <!--
+              <param name="positive_controls" type="data" format="txt" optional=true label="Defuse positive_controls" help=""/>
+            -->
+          </when> <!-- full -->
+        </conditional>  <!-- defuse_param -->
+      </when>
+      <when value="history">
+        <param name="config" type="data" format="txt" label="Defuse Config file" help=""/>
+      </when>  <!-- history -->
+  </conditional>  <!-- refGenomeSource -->
+  <param name="keep_output" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Save DeFuse working directory files"/>
+  <param name="do_get_reads" type="boolean" checked="false" truevalue="yes" falsevalue="no" label="Run get_reads on each cluster"/>
+ </inputs>
+ <configfiles>
+  <configfile name="defuse_config">
+#import ast
+#if $refGenomeSource.genomeSource == "history":
+#include raw $refGenomeSource.config.__str__
+#else 
+#set $ref_dict = dict($ast.literal_eval($refGenomeSource.index.value))
+#
+# Configuration file for defuse
+#
+# At a minimum, change all values enclused by []
+#
+
+# Directory where the defuse code was unpacked
+## Default location in the tool/defuse directory  
+# source_directory = ${__root_dir__}/tools/defuse
+source_directory = #slurp
+#try
+$ref_dict['source_directory']
+#except
+__DEFUSE_PATH__
+#end try
+
+# Directory where you want your dataset
+dataset_directory = #slurp
+#try
+$ref_dict['dataset_directory']
+#except
+/project/db/genomes/Hsapiens/hg19/defuse
+#end try
+
+# Input genome and gene models
+gene_models = #slurp
+#try
+$ref_dict['gene_models']
+#except
+\$(dataset_directory)/Homo_sapiens.GRCh37.62.gtf
+#end try
+genome_fasta = #slurp
+#try
+$ref_dict['genome_fasta']
+#except
+\$(dataset_directory)/Homo_sapiens.GRCh37.62.dna.chromosome.fa
+#end try
+
+# Repeat table from ucsc genome browser
+repeats_filename = #slurp
+#try
+$ref_dict['repeats_filename']
+#except
+\$(dataset_directory)/rmsk.txt
+#end try
+
+# EST info downloaded from ucsc genome browser
+est_fasta = #slurp
+#try
+$ref_dict['est_fasta']
+#except
+\$(dataset_directory)/est.fa
+#end try
+est_alignments = #slurp
+#try
+$ref_dict['est_alignments']
+#except
+\$(dataset_directory)/intronEst.txt
+#end try
+
+# Unigene clusters downloaded from ncbi
+unigene_fasta = #slurp
+#try
+$ref_dict['unigene_fasta']
+#except
+\$(dataset_directory)/Hs.seq.uniq
+#end try
+
+# Paths to external tools
+bowtie_bin = #slurp
+#try
+$ref_dict['bowtie_bin']
+#except
+__BOWTIE_BIN__
+#end try
+bowtie_build_bin = #slurp
+#try
+$ref_dict['bowtie_build_bin']
+#except
+__BOWTIE_BUILD_BIN__
+#end try
+blat_bin = #slurp
+#try
+$ref_dict['blat_bin']
+#except
+__BLAT_BIN__
+#end try
+fatotwobit_bin = #slurp
+#try
+$ref_dict['fatotwobit_bin']
+#except
+__FATOTWOBIT_BIN__
+#end try
+r_bin = #slurp
+#try
+$ref_dict['r_bin']
+#except
+__R_BIN__
+#end try
+rscript_bin = #slurp
+#try
+$ref_dict['rscript_bin']
+#except
+__RSCRIPT_BIN__
+#end try
+
+#raw
+# Dataset files
+dataset_prefix       = $(dataset_directory)/defuse
+chromosome_prefix    = $(dataset_prefix).dna.chromosomes
+exons_fasta          = $(dataset_prefix).exons.fa
+cds_fasta            = $(dataset_prefix).cds.fa
+cdna_regions         = $(dataset_prefix).cdna.regions
+cdna_fasta           = $(dataset_prefix).cdna.fa
+reference_fasta      = $(dataset_prefix).reference.fa
+rrna_fasta           = $(dataset_prefix).rrna.fa
+ig_gene_list         = $(dataset_prefix).ig.gene.list
+repeats_regions      = $(dataset_directory)/repeats.regions
+est_split_fasta1     = $(dataset_directory)/est.1.fa
+est_split_fasta2     = $(dataset_directory)/est.2.fa
+est_split_fasta3     = $(dataset_directory)/est.3.fa
+est_split_fasta4     = $(dataset_directory)/est.4.fa
+est_split_fasta5     = $(dataset_directory)/est.5.fa
+est_split_fasta6     = $(dataset_directory)/est.6.fa
+est_split_fasta7     = $(dataset_directory)/est.7.fa
+est_split_fasta8     = $(dataset_directory)/est.8.fa
+est_split_fasta9     = $(dataset_directory)/est.9.fa
+
+# Fasta files with bowtie indices for prefiltering reads for concordantly mapping pairs
+prefilter1           = $(unigene_fasta)
+
+# deFuse scripts and tools
+scripts_directory    = $(source_directory)/scripts
+tools_directory      = $(source_directory)/tools
+data_directory       = $(source_directory)/data
+#end raw
+
+# Path to samtools, 0.1.8 is compiled for you, use other versions at your own risk
+samtools_bin = #slurp 
+#try
+$ref_dict['samtools_bin']
+#except
+\$(source_directory)/external/samtools-0.1.8/samtools
+#end try
+
+# Bowtie parameters
+bowtie_threads = #slurp
+#try
+$ref_dict['bowtie_threads']
+#except
+4
+#end try
+bowtie_quals = #slurp
+#try
+$ref_dict['bowtie_quals']
+#except
+--phred33-quals
+#end try
+max_insert_size = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_insert_size.__str__ != "":
+$refGenomeSource.defuse_param.max_insert_size
+#else
+#try
+$ref_dict['max_insert_size']
+#except
+500
+#end try
+#end if
+
+# Parameters for building the dataset
+chromosomes = #slurp
+#try 
+$ref_dict.chromosomes
+#except
+1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,X,Y,MT
+#end try
+mt_chromosome = #slurp
+#try 
+$ref_dict['mt_chromosome']
+#except
+MT
+#end try
+gene_sources = #slurp
+#try 
+$ref_dict['gene_sources']
+#except
+IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding
+#end try
+ig_gene_sources = #slurp
+#try 
+$ref_dict['ig_gene_sources']
+#except
+IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene
+#end try
+rrna_gene_sources = #slurp
+#try 
+$ref_dict['rrna_gene_sources']
+#except
+Mt_rRNA,rRNA,rRNA_pseudogene
+#end try
+
+# Blat sequences per job
+num_blat_sequences = #slurp
+#try
+$ref_dict['num_blat_sequences']
+#except
+10000
+#end try
+
+# Minimum gene fusion range
+dna_concordant_length = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.dna_concordant_length.__str__ != "":
+$refGenomeSource.defuse_param.dna_concordant_length
+#else
+#try
+$ref_dict['dna_concordant_length']
+#except
+2000
+#end try
+#end if
+
+# Trim length for discordant reads (split reads are not trimmed)
+discord_read_trim = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.discord_read_trim.__str__ != "":
+$refGenomeSource.defuse_param.discord_read_trim
+#else
+#try
+$ref_dict['discord_read_trim']
+#except
+50
+#end try
+#end if
+
+# Filtering parameters
+clustering_precision = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.clustering_precision.__str__ != ""
+$refGenomeSource.defuse_param.clustering_precision
+#else
+#try
+$ref_dict['clustering_precision']
+#except
+0.95
+#end try
+#end if
+span_count_threshold = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.span_count_threshold.__str__ != ""
+$refGenomeSource.defuse_param.span_count_threshold
+#else
+#try
+$ref_dict['span_count_threshold']
+#except
+5
+#end try
+#end if
+split_count_threshold = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_count_threshold.__str__ != ""
+$refGenomeSource.defuse_param.split_count_threshold
+#else
+#try
+$ref_dict['split_count_threshold']
+#except
+3
+#end try
+#end if
+percent_identity_threshold = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.percent_identity_threshold.__str__ != ""
+$refGenomeSource.defuse_param.percent_identity_threshold
+#else
+#try
+$ref_dict['percent_identity_threshold']
+#except
+0.90
+#end try
+#end if
+max_dist_pos = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_dist_pos.__str__ != ""
+$refGenomeSource.defuse_param.max_dist_pos
+#else
+#try
+$ref_dict['max_dist_pos']
+#except
+600
+#end try
+#end if
+num_dist_genes = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.num_dist_genes.__str__ != ""
+$refGenomeSource.defuse_param.num_dist_genes
+#else
+#try
+$ref_dict['num_dist_genes']
+#except
+500
+#end try
+#end if
+split_min_anchor = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_min_anchor.__str__ != ""
+$refGenomeSource.defuse_param.split_min_anchor
+#else
+#try
+$ref_dict['split_min_anchor']
+#except
+4
+#end try
+#end if
+max_concordant_ratio = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_concordant_ratio.__str__ != ""
+$refGenomeSource.defuse_param.max_concordant_ratio
+#else
+#try
+$ref_dict['max_concordant_ratio']
+#except
+0.1
+#end try
+#end if
+splice_bias = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.splice_bias.__str__ != ""
+$refGenomeSource.defuse_param.splice_bias
+#else
+#try
+$ref_dict['splice_bias']
+#except
+10
+#end try
+#end if
+denovo_assembly = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.denovo_assembly.__str__ != ""
+$refGenomeSource.defuse_param.denovo_assembly
+#else
+#try
+$ref_dict['denovo_assembly']
+#except
+no
+#end try
+#end if
+probability_threshold = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.probability_threshold.__str__ != ""
+$refGenomeSource.defuse_param.probability_threshold
+#else
+#try
+$ref_dict['probability_threshold']
+#except
+0.50
+#end try
+#end if
+positive_controls                           = \$(data_directory)/controls.txt
+
+# Position density when calculating covariance
+covariance_sampling_density = #slurp
+#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.covariance_sampling_density.__str__ != ""
+$refGenomeSource.defuse_param.covariance_sampling_density
+#else
+#try
+$ref_dict['covariance_sampling_density']
+#except
+0.01
+#end try
+#end if
+
+
+# Number of reads for each job in split
+reads_per_job                               = 1000000
+
+# Number of regions for each breakpoint sequence job in split
+regions_per_job                             = 20
+
+#raw
+# If you have command line 'mail' and wish to be notified
+# mailto                                      = andrew.mcpherson@gmail.com
+
+# Remove temp files
+remove_job_files                            = yes
+remove_job_temp_files                       = yes
+
+# Converting to fastq
+# Fastq converter config format 1 for reads stored in separate files for each end
+#  data_lane_rexex_N is a perl regex which stores the lane id in $1
+#  data_end_regex_N is a perl regex which stores the end, 1 or 2, in $1
+#  data_compress_regex_N is a perl regex which stores the compression extension in $1
+#  data_convert_N is the associated conversion utility that takes data at stdin and outputs fastq at stdout
+# Fastq converter config format 2 for reads stored in separate files for each end
+#  data_lane_regex_N is a perl regex which stores the lane id in $1
+#  data_compress_regex_N is a perl regex which stores the compression extension in $1
+#  data_end1_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 1 at stdout
+#  data_end2_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 2 at stdout
+
+data_lane_regex_1                           = ^(.+)_[12]_export\.txt.*$
+data_end_regex_1                            = ^.+_([12])_export\.txt.*$
+data_compress_regex_1                       = ^.+_[12]_export\.txt(.*)$
+data_converter_1                            = $(scripts_directory)/fq_all2std.pl export2std
+
+data_lane_regex_2                           = ^(.+)_[12]_concat_qseq\.txt.*$
+data_end_regex_2                            = ^.+_([12])_concat_qseq\.txt.*$
+data_compress_regex_2                       = ^.+_[12]_concat_qseq\.txt(.*)$
+data_converter_2                            = $(scripts_directory)/qseq2fastq.pl
+
+data_lane_regex_3                           = ^(.+)\.bam.*$
+data_compress_regex_3                       = ^.+\.bam(.*)$
+data_end1_converter_3                       = samtools view - | filter_sam_mate.pl 1 | sam_to_fastq.pl
+data_end2_converter_3                       = samtools view - | filter_sam_mate.pl 2 | sam_to_fastq.pl
+
+data_lane_regex_4                           = ^(.+).[12].fastq.*$
+data_end_regex_4                            = ^.+.([12]).fastq.*$
+data_compress_regex_4                       = ^.+.[12].fastq(.*)$
+data_converter_4                            = cat
+#end raw
+
+#end if
+
+  </configfile>
+  <configfile name="shscript">
+#!/bin/bash
+## define some things for cheetah proccessing
+#set $ds = chr(36)
+#set $amp = chr(38)
+#set $gt = chr(62)
+#set $lt = chr(60)
+#set $echo_cmd = 'echo'
+## Find the defuse.pl in the galaxy tool path
+#import Cheetah.FileUtils
+## declare a bash function for converting a results tsv into html with links to the get_reads output files
+results2html() {
+  rlts=${ds}1
+  rslt_name=`basename ${ds}rlts`
+  html=${ds}2
+  echo '${lt}html${gt}${lt}head${gt}${lt}title${gt}Defuse '${ds}rslt_name'${lt}/title${gt}${lt}/head${gt}${lt}body${gt}' ${gt}  ${ds}html
+  echo '${lt}h2${gt}Defuse '${ds}rslt_name'${lt}/h2${gt}${lt}table${gt}' ${gt}${gt}  ${ds}html
+  if [ -z "${ds}3" ]  
+  then
+    awk '${ds}1 ~ /cluster_id/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}th${gt}%s${lt}/th${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}\
+         ${ds}1 ~ /[1-9][0-9]*/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}td${gt}%s${lt}/td${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}' ${ds}rlts ${gt}${gt} ${ds}html
+    echo '${lt}/table${gt}' ${gt}${gt} ${ds}html
+    echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt}  ${ds}html
+  else
+    export _EFP=${ds}3
+    mkdir -p ${ds}_EFP
+    awk '${ds}1 ~ /cluster_id/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}th${gt}%s${lt}/th${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}\
+         ${ds}1 ~ /[1-9][0-9]*/{fn="cluster_"${ds}1"_reads.txt"; \
+          printf("${lt}tr${gt}${lt}td${gt}${lt}a href=\"%s\"${gt}%s${lt}/a${gt}${lt}/td${gt}",fn, ${ds}1);for (i = 2; i ${lt}= NF; i++) {printf("${lt}td${gt}%s${lt}/td${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}' ${ds}rlts ${gt}${gt} ${ds}html
+    echo '${lt}/table${gt}' ${gt}${gt} ${ds}html
+    echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt}  ${ds}html
+    for i in `awk '${ds}1 ~ /[1-9][0-9]*/{print ${ds}1}' ${ds}rlts`;
+      do fn=cluster_${ds}{i}_reads.txt;
+      pn=${ds}_EFP/${ds}fn;
+      perl \${DEFUSE_PATH}/scripts/get_reads.pl -c $defuse_config -o output_dir -i ${ds}i ${gt} ${ds}pn;
+    done
+  fi
+}
+## substitute pathnames into config file
+if `grep __DEFUSE_PATH__ $defuse_config ${gt} /dev/null`;then sed -i '.tmp' "s#__DEFUSE_PATH__#\${DEFUSE_PATH}#" $defuse_config; fi
+if `grep __SAMTOOLS_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} SAMTOOLS_BIN=`which samtools`;then sed -i '.tmp' "s#__SAMTOOLS_BIN__#\${SAMTOOLS_BIN}#" $defuse_config; fi
+if `grep __BOWTIE_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BOWTIE_BIN=`which bowtie`;then sed -i '.tmp' "s#__BOWTIE_BIN__#\${BOWTIE_BIN}#" $defuse_config; fi
+if `grep __BOWTIE_BUILD_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BOWTIE_BUILD_BIN=`which bowtie-build`;then sed -i '.tmp' "s#__BOWTIE_BUILD_BIN__#\${BOWTIE_BUILD_BIN}#" $defuse_config; fi
+if `grep __BLAT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BLAT_BIN=`which blat`;then sed -i '.tmp' "s#__BLAT_BIN__#\${BLAT_BIN}#" $defuse_config; fi
+if `grep __FATOTWOBIT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} FATOTWOBIT_BIN=`which fatotwobit`;then sed -i '.tmp' "s#__FATOTWOBIT_BIN__#\${FATOTWOBIT_BIN}#" $defuse_config; fi
+if `grep __R_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} R_BIN=`which R`;then sed -i '.tmp' "s#__R_BIN__#\${R_BIN}#" $defuse_config; fi
+if `grep __RSCRIPT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} RSCRIPT_BIN=`which Rscript`;then sed -i '.tmp' "s#__RSCRIPT_BIN__#\${RSCRIPT_BIN}#" $defuse_config; fi
+
+
+## copy config to output
+cp $defuse_config $config_txt
+## make a data_dir  and ln -s the input fastq
+mkdir -p data_dir
+ln -s $left_pairendreads data_dir/reads_1.fastq
+ln -s $right_pairendreads data_dir/reads_2.fastq
+## ln to output_dir in from_work_dir
+#if $defuse_out.__str__ != 'None':
+mkdir -p $defuse_out.extra_files_path
+ln -s $defuse_out.extra_files_path  output_dir
+#else
+mkdir -p output_dir
+#end if
+## run defuse.pl
+perl \${DEFUSE_PATH}/scripts/defuse.pl -c $defuse_config -d data_dir -o output_dir  -p 8
+## copy primary results to output datasets
+if [ -e output_dir/log/defuse.log ]; then cp output_dir/log/defuse.log $defuse_log; fi
+if [ -e output_dir/results.tsv ]; then cp output_dir/results.tsv $results_tsv; fi
+if [ -e output_dir/results.filtered.tsv ]; then cp output_dir/results.filtered.tsv $results_filtered_tsv; fi
+if [ -e output_dir/results.classify.tsv ]; then cp output_dir/results.classify.tsv $results_classify_tsv; fi
+## create html with links for output_dir
+#if $defuse_out.__str__ != 'None':
+if [ -e $defuse_out ]
+then
+  echo '${lt}html${gt}${lt}head${gt}${lt}title${gt}Defuse Output${lt}/title${gt}${lt}/head${gt}${lt}body${gt}' ${gt} $defuse_out
+  echo '${lt}h2${gt}Defuse Output Files${lt}/h2${gt}${lt}ul${gt}' ${gt}${gt}  $defuse_out
+  pushd $defuse_out.extra_files_path
+  for f in `find -L . -maxdepth 1 -type f`; 
+   do fn=`basename ${ds}f`; echo '${lt}li${gt}${lt}a href="'${ds}fn'"${gt}'${ds}fn'${lt}/a${gt}${lt}/li${gt}' ${gt}${gt}  $defuse_out; 
+  done
+  popd
+  echo '${lt}/ul${gt}' ${gt}${gt} $defuse_out
+  echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt}  $defuse_out
+fi
+#end if
+## run get_reads.pl on each cluster
+#if $fusion_reads.__str__ != 'None':
+if [ -e output_dir/results.filtered.tsv -a -e $fusion_reads ] 
+then
+  mkdir -p $fusion_reads.extra_files_path
+  results2html output_dir/results.filtered.tsv $fusion_reads $fusion_reads.extra_files_path
+fi
+#end if
+  </configfile>
+ </configfiles>
+ <outputs>
+  <data format="txt" name="config_txt" label="${tool.name} on ${on_string}: config.txt"/>
+  <data format="txt" name="defuse_log" label="${tool.name} on ${on_string}: defuse.log" />
+  <data format="html" name="defuse_out" label="${tool.name} on ${on_string}: defuse_output">
+    <filter>keep_output == True</filter>
+  </data>
+  <data format="html" name="fusion_reads" label="${tool.name} on ${on_string}: fusion_reads">
+    <filter>do_get_reads == True</filter>
+  </data>
+  <data format="tabular" name="results_tsv" label="${tool.name} on ${on_string}: results.tsv" />
+  <data format="tabular" name="results_filtered_tsv" label="${tool.name} on ${on_string}: results.filtered.tsv" />
+  <data format="tabular" name="results_classify_tsv" label="${tool.name} on ${on_string}: results.classify.tsv" />
+ </outputs>
+ <tests>
+ </tests>
+ <help>
+**DeFuse**
+
+DeFuse_ is a software package for gene fusion discovery using RNA-Seq data. The software uses clusters of discordant paired end alignments to inform a split read alignment analysis for finding fusion boundaries. The software also employs a number of heuristic filters in an attempt to reduce the number of false positives and produces a fully annotated output for each predicted fusion.  
+
+Journal reference: http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1001138
+
+.. _DeFuse: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=Main_Page
+
+------
+
+**Inputs**
+
+DeFuse requires 2 fastq files for paried reads, one with the left mate of the paired reads, and a second fastq with the the right mate of the paired reads (**with reads in the same order as in the first fastq dataset**).   
+
+If your fastq files have reads in different orders or include unpaired reads,  you can preprocess them with **FASTQ interlacer** to create a single interlaced fastq dataset with only the paired reads and input that to **FASTQ de-interlacer** to separate the reads into a left fastq and right fastq.
+
+DeFuse uses a Reference Dataset to search for gene fusions.  The Reference Dataset is generated from the following sources in DeFuse_Version_0.4_:
+    - genome_fasta from Ensembl 
+    - gene_models from Ensembl 
+    - repeats_filename from UCSC RepeatMasker rmsk.txt
+    - est_fasta from UCSC
+    - est_alignments from UCSC intronEst.txt
+    - unigene_fasta from NCBI
+
+.. _DeFuse_Version_0.4: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2
+
+------
+
+**Outputs**
+
+The galaxy history will contain 5 outputs: the config.txt file that provides DeFuse with its parameters,  the defuse.log which details what DeFuse has done and can be useful in determining any errors, and the 3 results files that defuse generates.  
+
+DeFuse generates 3 results files: results.txt, results.filtered.txt, and results.classify.txt. All three files have the same format, though results.classify.txt has a probability column from the application of the classifier to results.txt, and results.filtered.txt has been filtered according to the threshold probability as set in config.txt. 
+
+The file format is tab delimited with one prediction per line, and the following fields per prediction (not necessarily in this order):
+
+ - **Identification**
+    - cluster_id : random identifier assigned to each prediction
+    - library_name : library name given on the command line of defuse
+    - gene1 : ensembl id of gene 1
+    - gene2 : ensembl id of gene 2
+    - gene_name1 : name of gene 1
+    - gene_name2 : name of gene 2
+ - **Evidence**
+    - break_predict : breakpoint prediction method, denovo or splitr, that is considered most reliable
+    - concordant_ratio : proportion of spanning reads considered concordant by blat
+    - denovo_min_count : minimum kmer count across denovo assembled sequence
+    - denovo_sequence : fusion sequence predicted by debruijn based denovo sequence assembly
+    - denovo_span_pvalue : p-value, lower values are evidence the prediction is a false positive
+    - gene_align_strand1 : alignment strand for spanning read alignments to gene 1
+    - gene_align_strand2 : alignment strand for spanning read alignments to gene 2
+    - min_map_count : minimum of the number of genomic mappings for each spanning read
+    - max_map_count : maximum of the number of genomic mappings for each spanning read
+    - mean_map_count : average of the number of genomic mappings for each spanning read
+    - num_multi_map : number of spanning reads that map to more than one genomic location
+    - span_count : number of spanning reads supporting the fusion
+    - span_coverage1 : coverage of spanning reads aligned to gene 1 as a proportion of expected coverage
+    - span_coverage2 : coverage of spanning reads aligned to gene 2 as a proportion of expected coverage
+    - span_coverage_min : minimum of span_coverage1 and span_coverage2
+    - span_coverage_max : maximum of span_coverage1 and span_coverage2
+    - splitr_count : number of split reads supporting the prediction
+    - splitr_min_pvalue : p-value, lower values are evidence the prediction is a false positive
+    - splitr_pos_pvalue : p-value, lower values are evidence the prediction is a false positive
+    - splitr_sequence : fusion sequence predicted by split reads
+    - splitr_span_pvalue : p-value, lower values are evidence the prediction is a false positive
+ - **Annotation**
+    - adjacent : fusion between adjacent genes
+    - altsplice : fusion likely the product of alternative splicing between adjacent genes
+    - break_adj_entropy1 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 1
+    - break_adj_entropy2 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 2
+    - break_adj_entropy_min : minimum of break_adj_entropy1 and break_adj_entropy2
+    - breakpoint_homology : number of nucleotides at the fusion splice that align equally well to gene 1 or gene 2
+    - breakseqs_estislands_percident : maximum percent identity of fusion sequence alignments to est islands
+    - cdna_breakseqs_percident : maximum percent identity of fusion sequence alignments to cdna
+    - deletion : fusion produced by a genomic deletion
+    - est_breakseqs_percident : maximum percent identity of fusion sequence alignments to est
+    - eversion : fusion produced by a genomic eversion
+    - exonboundaries : fusion splice at exon boundaries
+    - expression1 : expression of gene 1 as number of concordant pairs aligned to exons
+    - expression2 : expression of gene 2 as number of concordant pairs aligned to exons
+    - gene_chromosome1 : chromosome of gene 1
+    - gene_chromosome2 : chromosome of gene 2
+    - gene_end1 : end position for gene 1
+    - gene_end2 : end position for gene 2
+    - gene_location1 : location of breakpoint in gene 1
+    - gene_location2 : location of breakpoint in gene 2
+    - gene_start1 : start of gene 1
+    - gene_start2 : start of gene 2
+    - gene_strand1 : strand of gene 1
+    - gene_strand2 : strand of gene 2
+    - genome_breakseqs_percident : maximum percent identity of fusion sequence alignments to genome
+    - genomic_break_pos1 : genomic position in gene 1 of fusion splice / breakpoint
+    - genomic_break_pos2 : genomic position in gene 2 of fusion splice / breakpoint
+    - genomic_strand1 : genomic strand in gene 1 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream
+    - genomic_strand2 : genomic strand in gene 2 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream
+    - interchromosomal : fusion produced by an interchromosomal translocation
+    - interrupted_index1 : ratio of coverage before and after the fusion splice / breakpoint in gene 1
+    - interrupted_index2 : ratio of coverage before and after the fusion splice / breakpoint in gene 2
+    - inversion : fusion produced by genomic inversion
+    - orf : fusion combines genes in a way that preserves a reading frame
+    - probability : probability produced by classification using adaboost and example positives/negatives (only given in results.classified.txt)
+    - read_through : fusion involving adjacent potentially resulting from co-transcription rather than genome rearrangement
+    - repeat_proportion1 : proportion of the spanning reads in gene 1 that span a repeat region
+    - repeat_proportion2 : proportion of the spanning reads in gene 2 that span a repeat region
+    - max_repeat_proportion : max of repeat_proportion1 and repeat_proportion2
+    - splice_score : number of nucleotides similar to GTAG at fusion splice
+    - num_splice_variants : number of potential splice variants for this gene pair
+    - splicing_index1 : number of concordant pairs in gene 1 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 2
+    - splicing_index2 : number of concordant pairs in gene 2 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 1
+
+
+**Example**
+
+results.tsv::
+
+  cluster_id	splitr_sequence	splitr_count	splitr_span_pvalue	splitr_pos_pvalue	splitr_min_pvalue	adjacent	altsplice	break_adj_entropy1	break_adj_entropy2	break_adj_entropy_min	break_predict	breakpoint_homology	breakseqs_estislands_percident	cdna_breakseqs_percident	concordant_ratio	deletion	est_breakseqs_percident	eversion	exonboundaries	expression1	expression2	gene1	gene2	gene_align_strand1	gene_align_strand2	gene_chromosome1	gene_chromosome2	gene_end1	gene_end2	gene_location1	gene_location2	gene_name1	gene_name2	gene_start1	gene_start2	gene_strand1	gene_strand2	genome_breakseqs_percident	genomic_break_pos1	genomic_break_pos2	genomic_strand1	genomic_strand2	interchromosomal	interrupted_index1	interrupted_index2	inversion	library_name	max_map_count	max_repeat_proportion	mean_map_count	min_map_count	num_multi_map	num_splice_variants	orf	read_through	repeat_proportion1	repeat_proportion2	span_count	span_coverage1	span_coverage2	span_coverage_max	span_coverage_min	splice_score	splicing_index1	splicing_index2	
+  1169	GCTTACTGTATGCCAGGCCCCAGAGGGGCAACCACCCTCTAAAGAGAGCGGCTCCTGCCTCCCAGAAAGCTCACAGACTGTGGGAGGGAAACAGGCAGCAGGTGAAGATGCCAAATGCCAGGATATCTGCCCTGTCCTTGCTTGATGCAGCTGCTGGCTCCCACGTTCTCCCCAGAATCCCCTCACACTCCTGCTGTTTTCTCTGCAGGTTGGCAGAGCCCCATGAGGGCAGGGCAGCCACTTTGTTCTTGGGCGGCAAACCTCCCTGGGCGGCACGGAAACCACGGTGAGAAGGGGGCAGGTCGGGCACGTGCAGGGACCACGCTGCAGG|TGTACCCAACAGCTCCGAAGAGACAGCGACCATCGAGAACGGGCCATGATGACGATGGCGGTTTTGTCGAAAAGAAAAGGGGGAAATGTGGGGAAAAGCAAGAGAGATCAGATTGTTACTGTGTCTGTGTAGAAAGAAGTAGACATGGGAGACTCCATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGAGATTCGGTGACCCCACCCCCAACCCCGTGCTCTCTGAAACATGTGCTGTGTCCACTCAGGGTTGAATGGATTAAGGGCGGTGCGAGACGTGCTTT	2	0.000436307890680442	0.110748295953850	0.0880671602973091	N	Y	3.19872427442695	3.48337348351473	3.19872427442695	splitr	0	0	0	0	Y	0	N	N	0	0	ENSG00000105549	ENSG00000213753	+	-	19	19	376013	59111168	intron	upstream	THEG	AC016629.2	361750	59084870	-	+	0	375099	386594	+	-	N	8.34107429512245	-	N	output_dir	82	0.677852348993289	40.6666666666667	1	11	1	N	N	0.361271676300578	0.677852348993289	12	0.758602776578432	0.569678713445872	0.758602776578432	0.569678713445872	2	0.416666666666667	-	
+  3596	TGGGGGTTGAGGCTTCTGTTCCCAGGTTCCATGACCTCAGAGGTGGCTGGTGAGGTTATGACCTTTGCCCTCCAGCCCTGGCTTAAAACCTCAGCCCTAGGACCTGGTTAAAGGAAGGGGAGATGGAGCTTTGCCCCGACCCCCCCCCGTTCCCCTCACCTGTCAGCCCGAGCTGGGCCAGGGCCCCTAGGTGGGGAACTGGGCCGGGGGGCGGGCACAAGCGGAGGTGGTGCCCCCAAAAGGGCTCCCGGTGGGGTCTTGCTGAGAAGGTGAGGGGTTCCCGGGGCCGCAGCAGGTGGTGGTGGAGGAGCCAAGCGGCTGTAGAGCAAGGGGTGAGCAGGTTCCAGACCGTAGAGGCGGGCAGCGGCCACGGCCCCGGGTCCAGTTAGCTCCTCACCCGCCTCATAGAAGCGGGGTGGCCTTGCCAGGCGTGGGGGTGCTGCC|TTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCAGCCCGAGGTTATCTAGAGTCACCAAAGCCGCCGGCGCCCGCCCCCCGGCCGGGGCCGGAGAGGGGCTGACCGGGTTGGTTTTGATCTGATAAATGCACGCATCCCCCCCGCGAAGGGGGTCAGCGCCCGTCGGCATGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAGGAGAGGAGCGAGCGACCAAAGGAACCATAACTGATTTAATGAGCCATTCGCAGTTTCACTGTACCGGCCGTGCGTACTTAGACATGCATGGCTTAATCTTTGAGACAAGCATATGCTACTGGCAGG	250	7.00711162298275e-72	0.00912124762512338	0.00684237452309549	N	N	3.31745197152461	3.47233119514066	3.31745197152461	splitr	7	0.0157657657657656	0	0	N	0.0135135135135136	N	N	0	0	ENSG00000156860	ENSG00000212932	-	+	16	21	30682131	48111157	coding	upstream	FBRS	RPL23AP4	30670289	48110676	+	+	0.0157657657657656	30680678	9827473	-	+	Y	-	-	N	output_dir	2	1	1.11111111111111	1	1	1	N	N	0	1	9	0.325530693397641	0.296465452915709	0.325530693397641	0.296465452915709	2	-	-	
+
+ </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/defuse.loc.sample	Fri Jan 04 11:53:33 2013 -0500
@@ -0,0 +1,11 @@
+## Configurstion info for prepared data references for DeFuse
+## http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2
+## 3 columns separated by the TAB character
+## The 3rd column has dictionary values that will be substituted in the config file for defuse
+## It should likely contain keys:   dataset_directory gene_models genome_fasta repeats_filename est_fasta est_alignments unigene_fasta
+## If this is not a Homo_sapiens reference also need keys:  gene_id_pattern transcript_id_pattern chromosomes
+
+#db_key	name	{'config_key':'config_value'}
+#hg19	GRCh37(hg19)	{'gene_id_pattern':'ENSG\d+', 'transcript_id_pattern':'ENST\d+', 'dataset_directory':'/data/genomes/Hsapiens/hg19/defuse', 'gene_models':'$(dataset_directory)/Homo_sapiens.GRCh37.62.gtf', 'genome_fasta':'$(dataset_directory)/Homo_sapiens.GRCh37.62.dna.chromosome.fa', 'repeats_filename':'$(dataset_directory)/rmsk.txt', 'est_fasta':'$(dataset_directory)/est.fa', 'est_alignments':'$(dataset_directory)/intronEst.txt', 'unigene_fasta':'$(dataset_directory)/Hs.seq.uniq', 'chromosomes':'1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,X,Y,MT', 'mt_chromosome':'MT', 'gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding', 'ig_gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene', 'rrna_gene_sources':'Mt_rRNA,rRNA,rRNA_pseudogene'}
+#mm9	NCBIM37(mm9)	{'gene_id_pattern':'ENSMUSG\d+', 'transcript_id_pattern':'ENSMUST\d+', 'dataset_directory':'/data/genomes/Mmusculus/mm9/defuse', 'gene_models':'$(dataset_directory)/Mus_musculus.NCBIM37.63.gtf', 'genome_fasta':'$(dataset_directory)/Mus_musculus.NCBIM37.63.dna.chromosome.fa', 'repeats_filename':'$(dataset_directory)/rmsk.txt', 'est_fasta':'$(dataset_directory)/est.fa', 'est_alignments':'$(dataset_directory)/intronEst.txt', 'unigene_fasta':'$(dataset_directory)/Mm.seq.uniq', 'chromosomes':'1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,X,Y,MT', 'mt_chromosome':'MT', 'gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding', 'ig_gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene', 'rrna_gene_sources':'Mt_rRNA,rRNA,rRNA_pseudogene'}
+#mm8	NCBIM36(mm8)	{'gene_id_pattern':'ENSMUSG\d+', 'transcript_id_pattern':'ENSMUST\d+', 'dataset_directory':'/data/genomes/Mmusculus/mm9/defuse', 'gene_models':'$(dataset_directory)/Mus_musculus.NCBIM36.46.gtf', 'genome_fasta':'$(dataset_directory)/Mus_musculus.NCBIM36.46.dna.chromosome.fa', 'repeats_filename':'$(dataset_directory)/rmsk.txt', 'est_fasta':'$(dataset_directory)/est.fa', 'est_alignments':'$(dataset_directory)/intronEst.txt', 'unigene_fasta':'$(dataset_directory)/Mm.seq.uniq', 'mt_chromosome':'MT', 'gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding', 'ig_gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene', 'rrna_gene_sources':'Mt_rRNA,rRNA,rRNA_pseudogene'}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Fri Jan 04 11:53:33 2013 -0500
@@ -0,0 +1,21 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="defuse" version="0.5.0">
+        <install version="1.0">
+            <actions>
+                <action type="download_by_url">http://sourceforge.net/projects/defuse/files/defuse/0.5/defuse-0.5.0.tar.gz</action>
+                <action type="shell_command">cd tools &amp;&amp; make</action>
+                <action type="move_directory_files">
+                    <source_directory>.</source_directory>
+                    <destination_directory>$INSTALL_DIR</destination_directory>
+                </action>
+                <action type="set_environment">
+                    <environment_variable name="DEFUSE_PATH" action="set_to">$INSTALL_DIR</environment_variable>
+                </action>
+            </actions>
+        </install>
+        <readme>
+        </readme>
+    </package>
+
+</tool_dependency>