# HG changeset patch # User jjohnson # Date 1357318413 18000 # Node ID b75ea9927793349b57ab92385d81fc5ecec8107a Uploaded diff -r 000000000000 -r b75ea9927793 README --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/README Fri Jan 04 11:53:33 2013 -0500 @@ -0,0 +1,35 @@ +The DeFuse galaxy tool is based on DeFuse_Version_0.5.0 +http://sourceforge.net/apps/mediawiki/defuse/index.php?title=Main_Page + +DeFuse is a software package for gene fusion discovery using RNA-Seq data. The software uses clusters of discordant paired end alignments to inform a split read alignment analysis for finding fusion boundaries. The software also employs a number of heuristic filters in an attempt to reduce the number of false positives and produces a fully annotated output for each predicted fusion. + + +Manual: +http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2 + +The included tool_dependencies.xml will download and install the defuse code. +It will set the environment variable: "DEFUSE_PATH" to the location of the defuse install. + + +The defuse.pl command relies on a configuration file to specifiy options, the location of reference data, and other applications that it depends upon: bowtie, bowtie-build, samtools, blat, fatotwobit, R, and Rscript. + +The DeFuse galaxy tool can either construct the config.txt file that is mentioned in the defuse manual, or select an existing config.txt file in the users history. +When constructing the config.txt file, the DeFuse tool uses the values selected in: tool-data/defuse.loc +The dictionary field in the tool-data/defuse.loc can be used to set fields in the config.txt file, including the site specific location of reference data and the paths to the other application binaries. +The "Defuse parameter settings" are used to alter options in the config.txt file. + +The DeFuse galaxy tool also generates a bash script to run defuse. +That script will attempt to edit the config.txt file to specifiy any unset paths to applications that defuse relies upon: +bowtie, bowtie-build, samtools, blat, fatotwobit, R, and Rscript +The script uses the using the shell "which" command to discover the application path, so the required applications should in PATH environment variable. + + +Generate Reference Datasets as described in the Manual: + +The manual has detailed instructions on how to set up reference datasets for Human hg19 and hg18. +We were able to follow the same basic procedures to set up a reference for Mouse mm9. + +These datasets should be referenced in the tool-data/defuse.loc file. + + + diff -r 000000000000 -r b75ea9927793 defuse.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/defuse.xml Fri Jan 04 11:53:33 2013 -0500 @@ -0,0 +1,723 @@ + + identify fusion transcripts + + defuse + bowtie + blat + fatotwobit + + /bin/bash $shscript + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + Position density when calculating covariance + + + + + + + + + + + + + + + + + + + + +#import ast +#if $refGenomeSource.genomeSource == "history": +#include raw $refGenomeSource.config.__str__ +#else +#set $ref_dict = dict($ast.literal_eval($refGenomeSource.index.value)) +# +# Configuration file for defuse +# +# At a minimum, change all values enclused by [] +# + +# Directory where the defuse code was unpacked +## Default location in the tool/defuse directory +# source_directory = ${__root_dir__}/tools/defuse +source_directory = #slurp +#try +$ref_dict['source_directory'] +#except +__DEFUSE_PATH__ +#end try + +# Directory where you want your dataset +dataset_directory = #slurp +#try +$ref_dict['dataset_directory'] +#except +/project/db/genomes/Hsapiens/hg19/defuse +#end try + +# Input genome and gene models +gene_models = #slurp +#try +$ref_dict['gene_models'] +#except +\$(dataset_directory)/Homo_sapiens.GRCh37.62.gtf +#end try +genome_fasta = #slurp +#try +$ref_dict['genome_fasta'] +#except +\$(dataset_directory)/Homo_sapiens.GRCh37.62.dna.chromosome.fa +#end try + +# Repeat table from ucsc genome browser +repeats_filename = #slurp +#try +$ref_dict['repeats_filename'] +#except +\$(dataset_directory)/rmsk.txt +#end try + +# EST info downloaded from ucsc genome browser +est_fasta = #slurp +#try +$ref_dict['est_fasta'] +#except +\$(dataset_directory)/est.fa +#end try +est_alignments = #slurp +#try +$ref_dict['est_alignments'] +#except +\$(dataset_directory)/intronEst.txt +#end try + +# Unigene clusters downloaded from ncbi +unigene_fasta = #slurp +#try +$ref_dict['unigene_fasta'] +#except +\$(dataset_directory)/Hs.seq.uniq +#end try + +# Paths to external tools +bowtie_bin = #slurp +#try +$ref_dict['bowtie_bin'] +#except +__BOWTIE_BIN__ +#end try +bowtie_build_bin = #slurp +#try +$ref_dict['bowtie_build_bin'] +#except +__BOWTIE_BUILD_BIN__ +#end try +blat_bin = #slurp +#try +$ref_dict['blat_bin'] +#except +__BLAT_BIN__ +#end try +fatotwobit_bin = #slurp +#try +$ref_dict['fatotwobit_bin'] +#except +__FATOTWOBIT_BIN__ +#end try +r_bin = #slurp +#try +$ref_dict['r_bin'] +#except +__R_BIN__ +#end try +rscript_bin = #slurp +#try +$ref_dict['rscript_bin'] +#except +__RSCRIPT_BIN__ +#end try + +#raw +# Dataset files +dataset_prefix = $(dataset_directory)/defuse +chromosome_prefix = $(dataset_prefix).dna.chromosomes +exons_fasta = $(dataset_prefix).exons.fa +cds_fasta = $(dataset_prefix).cds.fa +cdna_regions = $(dataset_prefix).cdna.regions +cdna_fasta = $(dataset_prefix).cdna.fa +reference_fasta = $(dataset_prefix).reference.fa +rrna_fasta = $(dataset_prefix).rrna.fa +ig_gene_list = $(dataset_prefix).ig.gene.list +repeats_regions = $(dataset_directory)/repeats.regions +est_split_fasta1 = $(dataset_directory)/est.1.fa +est_split_fasta2 = $(dataset_directory)/est.2.fa +est_split_fasta3 = $(dataset_directory)/est.3.fa +est_split_fasta4 = $(dataset_directory)/est.4.fa +est_split_fasta5 = $(dataset_directory)/est.5.fa +est_split_fasta6 = $(dataset_directory)/est.6.fa +est_split_fasta7 = $(dataset_directory)/est.7.fa +est_split_fasta8 = $(dataset_directory)/est.8.fa +est_split_fasta9 = $(dataset_directory)/est.9.fa + +# Fasta files with bowtie indices for prefiltering reads for concordantly mapping pairs +prefilter1 = $(unigene_fasta) + +# deFuse scripts and tools +scripts_directory = $(source_directory)/scripts +tools_directory = $(source_directory)/tools +data_directory = $(source_directory)/data +#end raw + +# Path to samtools, 0.1.8 is compiled for you, use other versions at your own risk +samtools_bin = #slurp +#try +$ref_dict['samtools_bin'] +#except +\$(source_directory)/external/samtools-0.1.8/samtools +#end try + +# Bowtie parameters +bowtie_threads = #slurp +#try +$ref_dict['bowtie_threads'] +#except +4 +#end try +bowtie_quals = #slurp +#try +$ref_dict['bowtie_quals'] +#except +--phred33-quals +#end try +max_insert_size = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_insert_size.__str__ != "": +$refGenomeSource.defuse_param.max_insert_size +#else +#try +$ref_dict['max_insert_size'] +#except +500 +#end try +#end if + +# Parameters for building the dataset +chromosomes = #slurp +#try +$ref_dict.chromosomes +#except +1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,X,Y,MT +#end try +mt_chromosome = #slurp +#try +$ref_dict['mt_chromosome'] +#except +MT +#end try +gene_sources = #slurp +#try +$ref_dict['gene_sources'] +#except +IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding +#end try +ig_gene_sources = #slurp +#try +$ref_dict['ig_gene_sources'] +#except +IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene +#end try +rrna_gene_sources = #slurp +#try +$ref_dict['rrna_gene_sources'] +#except +Mt_rRNA,rRNA,rRNA_pseudogene +#end try + +# Blat sequences per job +num_blat_sequences = #slurp +#try +$ref_dict['num_blat_sequences'] +#except +10000 +#end try + +# Minimum gene fusion range +dna_concordant_length = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.dna_concordant_length.__str__ != "": +$refGenomeSource.defuse_param.dna_concordant_length +#else +#try +$ref_dict['dna_concordant_length'] +#except +2000 +#end try +#end if + +# Trim length for discordant reads (split reads are not trimmed) +discord_read_trim = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.discord_read_trim.__str__ != "": +$refGenomeSource.defuse_param.discord_read_trim +#else +#try +$ref_dict['discord_read_trim'] +#except +50 +#end try +#end if + +# Filtering parameters +clustering_precision = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.clustering_precision.__str__ != "" +$refGenomeSource.defuse_param.clustering_precision +#else +#try +$ref_dict['clustering_precision'] +#except +0.95 +#end try +#end if +span_count_threshold = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.span_count_threshold.__str__ != "" +$refGenomeSource.defuse_param.span_count_threshold +#else +#try +$ref_dict['span_count_threshold'] +#except +5 +#end try +#end if +split_count_threshold = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_count_threshold.__str__ != "" +$refGenomeSource.defuse_param.split_count_threshold +#else +#try +$ref_dict['split_count_threshold'] +#except +3 +#end try +#end if +percent_identity_threshold = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.percent_identity_threshold.__str__ != "" +$refGenomeSource.defuse_param.percent_identity_threshold +#else +#try +$ref_dict['percent_identity_threshold'] +#except +0.90 +#end try +#end if +max_dist_pos = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_dist_pos.__str__ != "" +$refGenomeSource.defuse_param.max_dist_pos +#else +#try +$ref_dict['max_dist_pos'] +#except +600 +#end try +#end if +num_dist_genes = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.num_dist_genes.__str__ != "" +$refGenomeSource.defuse_param.num_dist_genes +#else +#try +$ref_dict['num_dist_genes'] +#except +500 +#end try +#end if +split_min_anchor = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_min_anchor.__str__ != "" +$refGenomeSource.defuse_param.split_min_anchor +#else +#try +$ref_dict['split_min_anchor'] +#except +4 +#end try +#end if +max_concordant_ratio = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_concordant_ratio.__str__ != "" +$refGenomeSource.defuse_param.max_concordant_ratio +#else +#try +$ref_dict['max_concordant_ratio'] +#except +0.1 +#end try +#end if +splice_bias = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.splice_bias.__str__ != "" +$refGenomeSource.defuse_param.splice_bias +#else +#try +$ref_dict['splice_bias'] +#except +10 +#end try +#end if +denovo_assembly = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.denovo_assembly.__str__ != "" +$refGenomeSource.defuse_param.denovo_assembly +#else +#try +$ref_dict['denovo_assembly'] +#except +no +#end try +#end if +probability_threshold = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.probability_threshold.__str__ != "" +$refGenomeSource.defuse_param.probability_threshold +#else +#try +$ref_dict['probability_threshold'] +#except +0.50 +#end try +#end if +positive_controls = \$(data_directory)/controls.txt + +# Position density when calculating covariance +covariance_sampling_density = #slurp +#if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.covariance_sampling_density.__str__ != "" +$refGenomeSource.defuse_param.covariance_sampling_density +#else +#try +$ref_dict['covariance_sampling_density'] +#except +0.01 +#end try +#end if + + +# Number of reads for each job in split +reads_per_job = 1000000 + +# Number of regions for each breakpoint sequence job in split +regions_per_job = 20 + +#raw +# If you have command line 'mail' and wish to be notified +# mailto = andrew.mcpherson@gmail.com + +# Remove temp files +remove_job_files = yes +remove_job_temp_files = yes + +# Converting to fastq +# Fastq converter config format 1 for reads stored in separate files for each end +# data_lane_rexex_N is a perl regex which stores the lane id in $1 +# data_end_regex_N is a perl regex which stores the end, 1 or 2, in $1 +# data_compress_regex_N is a perl regex which stores the compression extension in $1 +# data_convert_N is the associated conversion utility that takes data at stdin and outputs fastq at stdout +# Fastq converter config format 2 for reads stored in separate files for each end +# data_lane_regex_N is a perl regex which stores the lane id in $1 +# data_compress_regex_N is a perl regex which stores the compression extension in $1 +# data_end1_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 1 at stdout +# data_end2_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 2 at stdout + +data_lane_regex_1 = ^(.+)_[12]_export\.txt.*$ +data_end_regex_1 = ^.+_([12])_export\.txt.*$ +data_compress_regex_1 = ^.+_[12]_export\.txt(.*)$ +data_converter_1 = $(scripts_directory)/fq_all2std.pl export2std + +data_lane_regex_2 = ^(.+)_[12]_concat_qseq\.txt.*$ +data_end_regex_2 = ^.+_([12])_concat_qseq\.txt.*$ +data_compress_regex_2 = ^.+_[12]_concat_qseq\.txt(.*)$ +data_converter_2 = $(scripts_directory)/qseq2fastq.pl + +data_lane_regex_3 = ^(.+)\.bam.*$ +data_compress_regex_3 = ^.+\.bam(.*)$ +data_end1_converter_3 = samtools view - | filter_sam_mate.pl 1 | sam_to_fastq.pl +data_end2_converter_3 = samtools view - | filter_sam_mate.pl 2 | sam_to_fastq.pl + +data_lane_regex_4 = ^(.+).[12].fastq.*$ +data_end_regex_4 = ^.+.([12]).fastq.*$ +data_compress_regex_4 = ^.+.[12].fastq(.*)$ +data_converter_4 = cat +#end raw + +#end if + + + +#!/bin/bash +## define some things for cheetah proccessing +#set $ds = chr(36) +#set $amp = chr(38) +#set $gt = chr(62) +#set $lt = chr(60) +#set $echo_cmd = 'echo' +## Find the defuse.pl in the galaxy tool path +#import Cheetah.FileUtils +## declare a bash function for converting a results tsv into html with links to the get_reads output files +results2html() { + rlts=${ds}1 + rslt_name=`basename ${ds}rlts` + html=${ds}2 + echo '${lt}html${gt}${lt}head${gt}${lt}title${gt}Defuse '${ds}rslt_name'${lt}/title${gt}${lt}/head${gt}${lt}body${gt}' ${gt} ${ds}html + echo '${lt}h2${gt}Defuse '${ds}rslt_name'${lt}/h2${gt}${lt}table${gt}' ${gt}${gt} ${ds}html + if [ -z "${ds}3" ] + then + awk '${ds}1 ~ /cluster_id/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}th${gt}%s${lt}/th${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}\ + ${ds}1 ~ /[1-9][0-9]*/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}td${gt}%s${lt}/td${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}' ${ds}rlts ${gt}${gt} ${ds}html + echo '${lt}/table${gt}' ${gt}${gt} ${ds}html + echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt} ${ds}html + else + export _EFP=${ds}3 + mkdir -p ${ds}_EFP + awk '${ds}1 ~ /cluster_id/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}th${gt}%s${lt}/th${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}\ + ${ds}1 ~ /[1-9][0-9]*/{fn="cluster_"${ds}1"_reads.txt"; \ + printf("${lt}tr${gt}${lt}td${gt}${lt}a href=\"%s\"${gt}%s${lt}/a${gt}${lt}/td${gt}",fn, ${ds}1);for (i = 2; i ${lt}= NF; i++) {printf("${lt}td${gt}%s${lt}/td${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}' ${ds}rlts ${gt}${gt} ${ds}html + echo '${lt}/table${gt}' ${gt}${gt} ${ds}html + echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt} ${ds}html + for i in `awk '${ds}1 ~ /[1-9][0-9]*/{print ${ds}1}' ${ds}rlts`; + do fn=cluster_${ds}{i}_reads.txt; + pn=${ds}_EFP/${ds}fn; + perl \${DEFUSE_PATH}/scripts/get_reads.pl -c $defuse_config -o output_dir -i ${ds}i ${gt} ${ds}pn; + done + fi +} +## substitute pathnames into config file +if `grep __DEFUSE_PATH__ $defuse_config ${gt} /dev/null`;then sed -i '.tmp' "s#__DEFUSE_PATH__#\${DEFUSE_PATH}#" $defuse_config; fi +if `grep __SAMTOOLS_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} SAMTOOLS_BIN=`which samtools`;then sed -i '.tmp' "s#__SAMTOOLS_BIN__#\${SAMTOOLS_BIN}#" $defuse_config; fi +if `grep __BOWTIE_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BOWTIE_BIN=`which bowtie`;then sed -i '.tmp' "s#__BOWTIE_BIN__#\${BOWTIE_BIN}#" $defuse_config; fi +if `grep __BOWTIE_BUILD_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BOWTIE_BUILD_BIN=`which bowtie-build`;then sed -i '.tmp' "s#__BOWTIE_BUILD_BIN__#\${BOWTIE_BUILD_BIN}#" $defuse_config; fi +if `grep __BLAT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BLAT_BIN=`which blat`;then sed -i '.tmp' "s#__BLAT_BIN__#\${BLAT_BIN}#" $defuse_config; fi +if `grep __FATOTWOBIT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} FATOTWOBIT_BIN=`which fatotwobit`;then sed -i '.tmp' "s#__FATOTWOBIT_BIN__#\${FATOTWOBIT_BIN}#" $defuse_config; fi +if `grep __R_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} R_BIN=`which R`;then sed -i '.tmp' "s#__R_BIN__#\${R_BIN}#" $defuse_config; fi +if `grep __RSCRIPT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} RSCRIPT_BIN=`which Rscript`;then sed -i '.tmp' "s#__RSCRIPT_BIN__#\${RSCRIPT_BIN}#" $defuse_config; fi + + +## copy config to output +cp $defuse_config $config_txt +## make a data_dir and ln -s the input fastq +mkdir -p data_dir +ln -s $left_pairendreads data_dir/reads_1.fastq +ln -s $right_pairendreads data_dir/reads_2.fastq +## ln to output_dir in from_work_dir +#if $defuse_out.__str__ != 'None': +mkdir -p $defuse_out.extra_files_path +ln -s $defuse_out.extra_files_path output_dir +#else +mkdir -p output_dir +#end if +## run defuse.pl +perl \${DEFUSE_PATH}/scripts/defuse.pl -c $defuse_config -d data_dir -o output_dir -p 8 +## copy primary results to output datasets +if [ -e output_dir/log/defuse.log ]; then cp output_dir/log/defuse.log $defuse_log; fi +if [ -e output_dir/results.tsv ]; then cp output_dir/results.tsv $results_tsv; fi +if [ -e output_dir/results.filtered.tsv ]; then cp output_dir/results.filtered.tsv $results_filtered_tsv; fi +if [ -e output_dir/results.classify.tsv ]; then cp output_dir/results.classify.tsv $results_classify_tsv; fi +## create html with links for output_dir +#if $defuse_out.__str__ != 'None': +if [ -e $defuse_out ] +then + echo '${lt}html${gt}${lt}head${gt}${lt}title${gt}Defuse Output${lt}/title${gt}${lt}/head${gt}${lt}body${gt}' ${gt} $defuse_out + echo '${lt}h2${gt}Defuse Output Files${lt}/h2${gt}${lt}ul${gt}' ${gt}${gt} $defuse_out + pushd $defuse_out.extra_files_path + for f in `find -L . -maxdepth 1 -type f`; + do fn=`basename ${ds}f`; echo '${lt}li${gt}${lt}a href="'${ds}fn'"${gt}'${ds}fn'${lt}/a${gt}${lt}/li${gt}' ${gt}${gt} $defuse_out; + done + popd + echo '${lt}/ul${gt}' ${gt}${gt} $defuse_out + echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt} $defuse_out +fi +#end if +## run get_reads.pl on each cluster +#if $fusion_reads.__str__ != 'None': +if [ -e output_dir/results.filtered.tsv -a -e $fusion_reads ] +then + mkdir -p $fusion_reads.extra_files_path + results2html output_dir/results.filtered.tsv $fusion_reads $fusion_reads.extra_files_path +fi +#end if + + + + + + + keep_output == True + + + do_get_reads == True + + + + + + + + +**DeFuse** + +DeFuse_ is a software package for gene fusion discovery using RNA-Seq data. The software uses clusters of discordant paired end alignments to inform a split read alignment analysis for finding fusion boundaries. The software also employs a number of heuristic filters in an attempt to reduce the number of false positives and produces a fully annotated output for each predicted fusion. + +Journal reference: http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1001138 + +.. _DeFuse: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=Main_Page + +------ + +**Inputs** + +DeFuse requires 2 fastq files for paried reads, one with the left mate of the paired reads, and a second fastq with the the right mate of the paired reads (**with reads in the same order as in the first fastq dataset**). + +If your fastq files have reads in different orders or include unpaired reads, you can preprocess them with **FASTQ interlacer** to create a single interlaced fastq dataset with only the paired reads and input that to **FASTQ de-interlacer** to separate the reads into a left fastq and right fastq. + +DeFuse uses a Reference Dataset to search for gene fusions. The Reference Dataset is generated from the following sources in DeFuse_Version_0.4_: + - genome_fasta from Ensembl + - gene_models from Ensembl + - repeats_filename from UCSC RepeatMasker rmsk.txt + - est_fasta from UCSC + - est_alignments from UCSC intronEst.txt + - unigene_fasta from NCBI + +.. _DeFuse_Version_0.4: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2 + +------ + +**Outputs** + +The galaxy history will contain 5 outputs: the config.txt file that provides DeFuse with its parameters, the defuse.log which details what DeFuse has done and can be useful in determining any errors, and the 3 results files that defuse generates. + +DeFuse generates 3 results files: results.txt, results.filtered.txt, and results.classify.txt. All three files have the same format, though results.classify.txt has a probability column from the application of the classifier to results.txt, and results.filtered.txt has been filtered according to the threshold probability as set in config.txt. + +The file format is tab delimited with one prediction per line, and the following fields per prediction (not necessarily in this order): + + - **Identification** + - cluster_id : random identifier assigned to each prediction + - library_name : library name given on the command line of defuse + - gene1 : ensembl id of gene 1 + - gene2 : ensembl id of gene 2 + - gene_name1 : name of gene 1 + - gene_name2 : name of gene 2 + - **Evidence** + - break_predict : breakpoint prediction method, denovo or splitr, that is considered most reliable + - concordant_ratio : proportion of spanning reads considered concordant by blat + - denovo_min_count : minimum kmer count across denovo assembled sequence + - denovo_sequence : fusion sequence predicted by debruijn based denovo sequence assembly + - denovo_span_pvalue : p-value, lower values are evidence the prediction is a false positive + - gene_align_strand1 : alignment strand for spanning read alignments to gene 1 + - gene_align_strand2 : alignment strand for spanning read alignments to gene 2 + - min_map_count : minimum of the number of genomic mappings for each spanning read + - max_map_count : maximum of the number of genomic mappings for each spanning read + - mean_map_count : average of the number of genomic mappings for each spanning read + - num_multi_map : number of spanning reads that map to more than one genomic location + - span_count : number of spanning reads supporting the fusion + - span_coverage1 : coverage of spanning reads aligned to gene 1 as a proportion of expected coverage + - span_coverage2 : coverage of spanning reads aligned to gene 2 as a proportion of expected coverage + - span_coverage_min : minimum of span_coverage1 and span_coverage2 + - span_coverage_max : maximum of span_coverage1 and span_coverage2 + - splitr_count : number of split reads supporting the prediction + - splitr_min_pvalue : p-value, lower values are evidence the prediction is a false positive + - splitr_pos_pvalue : p-value, lower values are evidence the prediction is a false positive + - splitr_sequence : fusion sequence predicted by split reads + - splitr_span_pvalue : p-value, lower values are evidence the prediction is a false positive + - **Annotation** + - adjacent : fusion between adjacent genes + - altsplice : fusion likely the product of alternative splicing between adjacent genes + - break_adj_entropy1 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 1 + - break_adj_entropy2 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 2 + - break_adj_entropy_min : minimum of break_adj_entropy1 and break_adj_entropy2 + - breakpoint_homology : number of nucleotides at the fusion splice that align equally well to gene 1 or gene 2 + - breakseqs_estislands_percident : maximum percent identity of fusion sequence alignments to est islands + - cdna_breakseqs_percident : maximum percent identity of fusion sequence alignments to cdna + - deletion : fusion produced by a genomic deletion + - est_breakseqs_percident : maximum percent identity of fusion sequence alignments to est + - eversion : fusion produced by a genomic eversion + - exonboundaries : fusion splice at exon boundaries + - expression1 : expression of gene 1 as number of concordant pairs aligned to exons + - expression2 : expression of gene 2 as number of concordant pairs aligned to exons + - gene_chromosome1 : chromosome of gene 1 + - gene_chromosome2 : chromosome of gene 2 + - gene_end1 : end position for gene 1 + - gene_end2 : end position for gene 2 + - gene_location1 : location of breakpoint in gene 1 + - gene_location2 : location of breakpoint in gene 2 + - gene_start1 : start of gene 1 + - gene_start2 : start of gene 2 + - gene_strand1 : strand of gene 1 + - gene_strand2 : strand of gene 2 + - genome_breakseqs_percident : maximum percent identity of fusion sequence alignments to genome + - genomic_break_pos1 : genomic position in gene 1 of fusion splice / breakpoint + - genomic_break_pos2 : genomic position in gene 2 of fusion splice / breakpoint + - genomic_strand1 : genomic strand in gene 1 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream + - genomic_strand2 : genomic strand in gene 2 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream + - interchromosomal : fusion produced by an interchromosomal translocation + - interrupted_index1 : ratio of coverage before and after the fusion splice / breakpoint in gene 1 + - interrupted_index2 : ratio of coverage before and after the fusion splice / breakpoint in gene 2 + - inversion : fusion produced by genomic inversion + - orf : fusion combines genes in a way that preserves a reading frame + - probability : probability produced by classification using adaboost and example positives/negatives (only given in results.classified.txt) + - read_through : fusion involving adjacent potentially resulting from co-transcription rather than genome rearrangement + - repeat_proportion1 : proportion of the spanning reads in gene 1 that span a repeat region + - repeat_proportion2 : proportion of the spanning reads in gene 2 that span a repeat region + - max_repeat_proportion : max of repeat_proportion1 and repeat_proportion2 + - splice_score : number of nucleotides similar to GTAG at fusion splice + - num_splice_variants : number of potential splice variants for this gene pair + - splicing_index1 : number of concordant pairs in gene 1 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 2 + - splicing_index2 : number of concordant pairs in gene 2 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 1 + + +**Example** + +results.tsv:: + + cluster_id splitr_sequence splitr_count splitr_span_pvalue splitr_pos_pvalue splitr_min_pvalue adjacent altsplice break_adj_entropy1 break_adj_entropy2 break_adj_entropy_min break_predict breakpoint_homology breakseqs_estislands_percident cdna_breakseqs_percident concordant_ratio deletion est_breakseqs_percident eversion exonboundaries expression1 expression2 gene1 gene2 gene_align_strand1 gene_align_strand2 gene_chromosome1 gene_chromosome2 gene_end1 gene_end2 gene_location1 gene_location2 gene_name1 gene_name2 gene_start1 gene_start2 gene_strand1 gene_strand2 genome_breakseqs_percident genomic_break_pos1 genomic_break_pos2 genomic_strand1 genomic_strand2 interchromosomal interrupted_index1 interrupted_index2 inversion library_name max_map_count max_repeat_proportion mean_map_count min_map_count num_multi_map num_splice_variants orf read_through repeat_proportion1 repeat_proportion2 span_count span_coverage1 span_coverage2 span_coverage_max span_coverage_min splice_score splicing_index1 splicing_index2 + 1169 GCTTACTGTATGCCAGGCCCCAGAGGGGCAACCACCCTCTAAAGAGAGCGGCTCCTGCCTCCCAGAAAGCTCACAGACTGTGGGAGGGAAACAGGCAGCAGGTGAAGATGCCAAATGCCAGGATATCTGCCCTGTCCTTGCTTGATGCAGCTGCTGGCTCCCACGTTCTCCCCAGAATCCCCTCACACTCCTGCTGTTTTCTCTGCAGGTTGGCAGAGCCCCATGAGGGCAGGGCAGCCACTTTGTTCTTGGGCGGCAAACCTCCCTGGGCGGCACGGAAACCACGGTGAGAAGGGGGCAGGTCGGGCACGTGCAGGGACCACGCTGCAGG|TGTACCCAACAGCTCCGAAGAGACAGCGACCATCGAGAACGGGCCATGATGACGATGGCGGTTTTGTCGAAAAGAAAAGGGGGAAATGTGGGGAAAAGCAAGAGAGATCAGATTGTTACTGTGTCTGTGTAGAAAGAAGTAGACATGGGAGACTCCATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGAGATTCGGTGACCCCACCCCCAACCCCGTGCTCTCTGAAACATGTGCTGTGTCCACTCAGGGTTGAATGGATTAAGGGCGGTGCGAGACGTGCTTT 2 0.000436307890680442 0.110748295953850 0.0880671602973091 N Y 3.19872427442695 3.48337348351473 3.19872427442695 splitr 0 0 0 0 Y 0 N N 0 0 ENSG00000105549 ENSG00000213753 + - 19 19 376013 59111168 intron upstream THEG AC016629.2 361750 59084870 - + 0 375099 386594 + - N 8.34107429512245 - N output_dir 82 0.677852348993289 40.6666666666667 1 11 1 N N 0.361271676300578 0.677852348993289 12 0.758602776578432 0.569678713445872 0.758602776578432 0.569678713445872 2 0.416666666666667 - + 3596 TGGGGGTTGAGGCTTCTGTTCCCAGGTTCCATGACCTCAGAGGTGGCTGGTGAGGTTATGACCTTTGCCCTCCAGCCCTGGCTTAAAACCTCAGCCCTAGGACCTGGTTAAAGGAAGGGGAGATGGAGCTTTGCCCCGACCCCCCCCCGTTCCCCTCACCTGTCAGCCCGAGCTGGGCCAGGGCCCCTAGGTGGGGAACTGGGCCGGGGGGCGGGCACAAGCGGAGGTGGTGCCCCCAAAAGGGCTCCCGGTGGGGTCTTGCTGAGAAGGTGAGGGGTTCCCGGGGCCGCAGCAGGTGGTGGTGGAGGAGCCAAGCGGCTGTAGAGCAAGGGGTGAGCAGGTTCCAGACCGTAGAGGCGGGCAGCGGCCACGGCCCCGGGTCCAGTTAGCTCCTCACCCGCCTCATAGAAGCGGGGTGGCCTTGCCAGGCGTGGGGGTGCTGCC|TTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCAGCCCGAGGTTATCTAGAGTCACCAAAGCCGCCGGCGCCCGCCCCCCGGCCGGGGCCGGAGAGGGGCTGACCGGGTTGGTTTTGATCTGATAAATGCACGCATCCCCCCCGCGAAGGGGGTCAGCGCCCGTCGGCATGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAGGAGAGGAGCGAGCGACCAAAGGAACCATAACTGATTTAATGAGCCATTCGCAGTTTCACTGTACCGGCCGTGCGTACTTAGACATGCATGGCTTAATCTTTGAGACAAGCATATGCTACTGGCAGG 250 7.00711162298275e-72 0.00912124762512338 0.00684237452309549 N N 3.31745197152461 3.47233119514066 3.31745197152461 splitr 7 0.0157657657657656 0 0 N 0.0135135135135136 N N 0 0 ENSG00000156860 ENSG00000212932 - + 16 21 30682131 48111157 coding upstream FBRS RPL23AP4 30670289 48110676 + + 0.0157657657657656 30680678 9827473 - + Y - - N output_dir 2 1 1.11111111111111 1 1 1 N N 0 1 9 0.325530693397641 0.296465452915709 0.325530693397641 0.296465452915709 2 - - + + + diff -r 000000000000 -r b75ea9927793 tool-data/defuse.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/defuse.loc.sample Fri Jan 04 11:53:33 2013 -0500 @@ -0,0 +1,11 @@ +## Configurstion info for prepared data references for DeFuse +## http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2 +## 3 columns separated by the TAB character +## The 3rd column has dictionary values that will be substituted in the config file for defuse +## It should likely contain keys: dataset_directory gene_models genome_fasta repeats_filename est_fasta est_alignments unigene_fasta +## If this is not a Homo_sapiens reference also need keys: gene_id_pattern transcript_id_pattern chromosomes + +#db_key name {'config_key':'config_value'} +#hg19 GRCh37(hg19) {'gene_id_pattern':'ENSG\d+', 'transcript_id_pattern':'ENST\d+', 'dataset_directory':'/data/genomes/Hsapiens/hg19/defuse', 'gene_models':'$(dataset_directory)/Homo_sapiens.GRCh37.62.gtf', 'genome_fasta':'$(dataset_directory)/Homo_sapiens.GRCh37.62.dna.chromosome.fa', 'repeats_filename':'$(dataset_directory)/rmsk.txt', 'est_fasta':'$(dataset_directory)/est.fa', 'est_alignments':'$(dataset_directory)/intronEst.txt', 'unigene_fasta':'$(dataset_directory)/Hs.seq.uniq', 'chromosomes':'1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,X,Y,MT', 'mt_chromosome':'MT', 'gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding', 'ig_gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene', 'rrna_gene_sources':'Mt_rRNA,rRNA,rRNA_pseudogene'} +#mm9 NCBIM37(mm9) {'gene_id_pattern':'ENSMUSG\d+', 'transcript_id_pattern':'ENSMUST\d+', 'dataset_directory':'/data/genomes/Mmusculus/mm9/defuse', 'gene_models':'$(dataset_directory)/Mus_musculus.NCBIM37.63.gtf', 'genome_fasta':'$(dataset_directory)/Mus_musculus.NCBIM37.63.dna.chromosome.fa', 'repeats_filename':'$(dataset_directory)/rmsk.txt', 'est_fasta':'$(dataset_directory)/est.fa', 'est_alignments':'$(dataset_directory)/intronEst.txt', 'unigene_fasta':'$(dataset_directory)/Mm.seq.uniq', 'chromosomes':'1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,X,Y,MT', 'mt_chromosome':'MT', 'gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding', 'ig_gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene', 'rrna_gene_sources':'Mt_rRNA,rRNA,rRNA_pseudogene'} +#mm8 NCBIM36(mm8) {'gene_id_pattern':'ENSMUSG\d+', 'transcript_id_pattern':'ENSMUST\d+', 'dataset_directory':'/data/genomes/Mmusculus/mm9/defuse', 'gene_models':'$(dataset_directory)/Mus_musculus.NCBIM36.46.gtf', 'genome_fasta':'$(dataset_directory)/Mus_musculus.NCBIM36.46.dna.chromosome.fa', 'repeats_filename':'$(dataset_directory)/rmsk.txt', 'est_fasta':'$(dataset_directory)/est.fa', 'est_alignments':'$(dataset_directory)/intronEst.txt', 'unigene_fasta':'$(dataset_directory)/Mm.seq.uniq', 'mt_chromosome':'MT', 'gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding', 'ig_gene_sources':'IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene', 'rrna_gene_sources':'Mt_rRNA,rRNA,rRNA_pseudogene'} diff -r 000000000000 -r b75ea9927793 tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Fri Jan 04 11:53:33 2013 -0500 @@ -0,0 +1,21 @@ + + + + + + http://sourceforge.net/projects/defuse/files/defuse/0.5/defuse-0.5.0.tar.gz + cd tools && make + + . + $INSTALL_DIR + + + $INSTALL_DIR + + + + + + + +