Mercurial > repos > jjohnson > defuse
annotate defuse.xml @ 4:ffc5e442c1ca
Add dependecies for bowtie, blat, and faToTwoBit
| author | Jim Johnson <jj@umn.edu> |
|---|---|
| date | Fri, 04 Jan 2013 14:59:03 -0600 |
| parents | 802a3c154da0 |
| children | 87033f379b99 |
| rev | line source |
|---|---|
| 0 | 1 <tool id="defuse" name="DeFuse" version="1.5"> |
| 2 <description>identify fusion transcripts</description> | |
| 3 <requirements> | |
| 4 <requirement type="package" version="0.5.0">defuse</requirement> | |
|
4
ffc5e442c1ca
Add dependecies for bowtie, blat, and faToTwoBit
Jim Johnson <jj@umn.edu>
parents:
3
diff
changeset
|
5 <requirement type="package" version="0.12.7">bowtie</requirement> |
|
ffc5e442c1ca
Add dependecies for bowtie, blat, and faToTwoBit
Jim Johnson <jj@umn.edu>
parents:
3
diff
changeset
|
6 <requirement type="package" version="34x10">blat</requirement> |
|
ffc5e442c1ca
Add dependecies for bowtie, blat, and faToTwoBit
Jim Johnson <jj@umn.edu>
parents:
3
diff
changeset
|
7 <requirement type="package" version="34x10">fatotwobit</requirement> |
| 0 | 8 </requirements> |
| 9 <command interpreter="command"> /bin/bash $shscript </command> | |
| 10 <inputs> | |
| 11 <param name="left_pairendreads" type="data" format="fastq" label="left part of read pairs" help="The left and right reads pairs must be in the same order, and not have any unpaired reads. (FASTQ interlacer will pair reads and remove the unpaired. FASTQ de-interlacer will separate the result into left and right reads.)"/> | |
| 12 <param name="right_pairendreads" type="data" format="fastq" label="right part of read pairs" help="In the same order as the left reads"/> | |
| 13 <conditional name="refGenomeSource"> | |
| 14 <param name="genomeSource" type="select" label="Will you select a built-in DeFuse Reference Dataset, or supply a configuration from your history" help=""> | |
| 15 <option value="indexed">Use a built-in DeFuse Reference Dataset</option> | |
| 16 <option value="history">Use a configuration from your history that specifies the DeFuse Reference Dataset</option> | |
| 17 </param> | |
| 18 <when value="indexed"> | |
| 19 <param name="index" type="select" label="Select a Reference Dataset" help="if your genome of interest is not listed - contact Galaxy team"> | |
| 20 <options from_file="defuse.loc"> | |
| 21 <column name="name" index="1"/> | |
| 22 <column name="value" index="2"/> | |
| 23 <filter type="sort_by" column="0" /> | |
| 24 <validator type="no_options" message="No indexes are available" /> | |
| 25 </options> | |
| 26 </param> | |
| 27 <conditional name="defuse_param"> | |
| 28 <param name="settings" type="select" label="Defuse parameter settings" help=""> | |
| 29 <option value="preSet">Default settings</option> | |
| 30 <option value="full">Full parameter list</option> | |
| 31 </param> | |
| 32 <when value="preSet" /> | |
| 33 <when value="full"> | |
| 34 <param name="max_insert_size" type="integer" value="500" optional="true" label="Bowtie max_insert_size" /> | |
| 35 <param name="dna_concordant_length" type="integer" value="2000" optional="true" label="Minimum gene fusion range dna_concordant_length" /> | |
| 36 <param name="discord_read_trim" type="integer" value="50" optional="true" label="Trim length for discordant reads discord_read_trim" help="(split reads are not trimmed)" /> | |
| 37 <param name="clustering_precision" type="float" value=".95" optional="true" label="Filter clustering_precision"> | |
| 38 <validator type="in_range" message="Choose a value between .1 and 1.0" min=".1" max="1"/> | |
| 39 </param> | |
| 40 <param name="span_count_threshold" type="integer" value="5" optional="true" label="Filter span_count_threshold" /> | |
| 41 <param name="split_count_threshold" type="integer" value="3" optional="true" label="Filter split_count_threshold" /> | |
| 42 <param name="percent_identity_threshold" type="float" value=".90" optional="true" label="Filter percent_identity_threshold"> | |
| 43 <validator type="in_range" message="Choose a value between .1 and 1.0" min=".1" max="1"/> | |
| 44 </param> | |
| 45 <param name="max_dist_pos" type="integer" value="600" optional="true" label="Filter max_dist_pos" /> | |
| 46 <param name="num_dist_genes" type="integer" value="500" optional="true" label="Filter num_dist_genes" /> | |
| 47 <param name="split_min_anchor" type="integer" value="4" optional="true" label="Filter split_min_anchor" /> | |
| 48 <param name="max_concordant_ratio" type="float" value="0.1" optional="true" label="Filter max_concordant_ratio"> | |
| 49 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
| 50 </param> | |
| 51 <param name="splice_bias" type="integer" value="10" optional="true" label="Filter splice_bias" /> | |
| 52 <param name="probability_threshold" type="float" value="0.50" optional="true" label="Filter probability_threshold"> | |
| 53 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
| 54 </param> | |
| 55 <param name="covariance_sampling_density" type="float" value="0.01" optional="true" label="covariance_sampling_density"> | |
| 56 <help>Position density when calculating covariance</help> | |
| 57 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
| 58 </param> | |
| 59 <param name="denovo_assembly" type="select" label="denovo_assembly" help=""> | |
| 60 <option value="">Use Default</option> | |
| 61 <option value="no">no</option> | |
| 62 <option value="yes">yes</option> | |
| 63 </param> | |
| 64 <!-- | |
| 65 <param name="positive_controls" type="data" format="txt" optional=true label="Defuse positive_controls" help=""/> | |
| 66 --> | |
| 67 </when> <!-- full --> | |
| 68 </conditional> <!-- defuse_param --> | |
| 69 </when> | |
| 70 <when value="history"> | |
| 71 <param name="config" type="data" format="txt" label="Defuse Config file" help=""/> | |
| 72 </when> <!-- history --> | |
| 73 </conditional> <!-- refGenomeSource --> | |
| 74 <param name="keep_output" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Save DeFuse working directory files"/> | |
| 3 | 75 <param name="do_get_reads" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Run get_reads on each cluster"/> |
| 0 | 76 </inputs> |
| 77 <configfiles> | |
| 78 <configfile name="defuse_config"> | |
| 79 #import ast | |
| 80 #if $refGenomeSource.genomeSource == "history": | |
| 81 #include raw $refGenomeSource.config.__str__ | |
| 82 #else | |
| 83 #set $ref_dict = dict($ast.literal_eval($refGenomeSource.index.value)) | |
| 84 # | |
| 85 # Configuration file for defuse | |
| 86 # | |
| 87 # At a minimum, change all values enclused by [] | |
| 88 # | |
| 89 | |
| 90 # Directory where the defuse code was unpacked | |
| 91 ## Default location in the tool/defuse directory | |
| 92 # source_directory = ${__root_dir__}/tools/defuse | |
| 93 source_directory = #slurp | |
| 94 #try | |
| 95 $ref_dict['source_directory'] | |
| 96 #except | |
| 97 __DEFUSE_PATH__ | |
| 98 #end try | |
| 99 | |
| 100 # Directory where you want your dataset | |
| 101 dataset_directory = #slurp | |
| 102 #try | |
| 103 $ref_dict['dataset_directory'] | |
| 104 #except | |
| 105 /project/db/genomes/Hsapiens/hg19/defuse | |
| 106 #end try | |
| 107 | |
| 108 # Input genome and gene models | |
| 109 gene_models = #slurp | |
| 110 #try | |
| 111 $ref_dict['gene_models'] | |
| 112 #except | |
| 113 \$(dataset_directory)/Homo_sapiens.GRCh37.62.gtf | |
| 114 #end try | |
| 115 genome_fasta = #slurp | |
| 116 #try | |
| 117 $ref_dict['genome_fasta'] | |
| 118 #except | |
| 119 \$(dataset_directory)/Homo_sapiens.GRCh37.62.dna.chromosome.fa | |
| 120 #end try | |
| 121 | |
| 122 # Repeat table from ucsc genome browser | |
| 123 repeats_filename = #slurp | |
| 124 #try | |
| 125 $ref_dict['repeats_filename'] | |
| 126 #except | |
| 127 \$(dataset_directory)/rmsk.txt | |
| 128 #end try | |
| 129 | |
| 130 # EST info downloaded from ucsc genome browser | |
| 131 est_fasta = #slurp | |
| 132 #try | |
| 133 $ref_dict['est_fasta'] | |
| 134 #except | |
| 135 \$(dataset_directory)/est.fa | |
| 136 #end try | |
| 137 est_alignments = #slurp | |
| 138 #try | |
| 139 $ref_dict['est_alignments'] | |
| 140 #except | |
| 141 \$(dataset_directory)/intronEst.txt | |
| 142 #end try | |
| 143 | |
| 144 # Unigene clusters downloaded from ncbi | |
| 145 unigene_fasta = #slurp | |
| 146 #try | |
| 147 $ref_dict['unigene_fasta'] | |
| 148 #except | |
| 149 \$(dataset_directory)/Hs.seq.uniq | |
| 150 #end try | |
| 151 | |
| 152 # Paths to external tools | |
| 153 bowtie_bin = #slurp | |
| 154 #try | |
| 155 $ref_dict['bowtie_bin'] | |
| 156 #except | |
| 157 __BOWTIE_BIN__ | |
| 158 #end try | |
| 159 bowtie_build_bin = #slurp | |
| 160 #try | |
| 161 $ref_dict['bowtie_build_bin'] | |
| 162 #except | |
| 163 __BOWTIE_BUILD_BIN__ | |
| 164 #end try | |
| 165 blat_bin = #slurp | |
| 166 #try | |
| 167 $ref_dict['blat_bin'] | |
| 168 #except | |
| 169 __BLAT_BIN__ | |
| 170 #end try | |
| 171 fatotwobit_bin = #slurp | |
| 172 #try | |
| 173 $ref_dict['fatotwobit_bin'] | |
| 174 #except | |
| 175 __FATOTWOBIT_BIN__ | |
| 176 #end try | |
| 177 r_bin = #slurp | |
| 178 #try | |
| 179 $ref_dict['r_bin'] | |
| 180 #except | |
| 181 __R_BIN__ | |
| 182 #end try | |
| 183 rscript_bin = #slurp | |
| 184 #try | |
| 185 $ref_dict['rscript_bin'] | |
| 186 #except | |
| 187 __RSCRIPT_BIN__ | |
| 188 #end try | |
| 189 | |
| 190 #raw | |
| 191 # Dataset files | |
| 192 dataset_prefix = $(dataset_directory)/defuse | |
| 193 chromosome_prefix = $(dataset_prefix).dna.chromosomes | |
| 194 exons_fasta = $(dataset_prefix).exons.fa | |
| 195 cds_fasta = $(dataset_prefix).cds.fa | |
| 196 cdna_regions = $(dataset_prefix).cdna.regions | |
| 197 cdna_fasta = $(dataset_prefix).cdna.fa | |
| 198 reference_fasta = $(dataset_prefix).reference.fa | |
| 199 rrna_fasta = $(dataset_prefix).rrna.fa | |
| 200 ig_gene_list = $(dataset_prefix).ig.gene.list | |
| 201 repeats_regions = $(dataset_directory)/repeats.regions | |
| 202 est_split_fasta1 = $(dataset_directory)/est.1.fa | |
| 203 est_split_fasta2 = $(dataset_directory)/est.2.fa | |
| 204 est_split_fasta3 = $(dataset_directory)/est.3.fa | |
| 205 est_split_fasta4 = $(dataset_directory)/est.4.fa | |
| 206 est_split_fasta5 = $(dataset_directory)/est.5.fa | |
| 207 est_split_fasta6 = $(dataset_directory)/est.6.fa | |
| 208 est_split_fasta7 = $(dataset_directory)/est.7.fa | |
| 209 est_split_fasta8 = $(dataset_directory)/est.8.fa | |
| 210 est_split_fasta9 = $(dataset_directory)/est.9.fa | |
| 211 | |
| 212 # Fasta files with bowtie indices for prefiltering reads for concordantly mapping pairs | |
| 213 prefilter1 = $(unigene_fasta) | |
| 214 | |
| 215 # deFuse scripts and tools | |
| 216 scripts_directory = $(source_directory)/scripts | |
| 217 tools_directory = $(source_directory)/tools | |
| 218 data_directory = $(source_directory)/data | |
| 219 #end raw | |
| 220 | |
| 221 # Path to samtools, 0.1.8 is compiled for you, use other versions at your own risk | |
| 222 samtools_bin = #slurp | |
| 223 #try | |
| 224 $ref_dict['samtools_bin'] | |
| 225 #except | |
| 226 \$(source_directory)/external/samtools-0.1.8/samtools | |
| 227 #end try | |
| 228 | |
| 229 # Bowtie parameters | |
| 230 bowtie_threads = #slurp | |
| 231 #try | |
| 232 $ref_dict['bowtie_threads'] | |
| 233 #except | |
| 234 4 | |
| 235 #end try | |
| 236 bowtie_quals = #slurp | |
| 237 #try | |
| 238 $ref_dict['bowtie_quals'] | |
| 239 #except | |
| 240 --phred33-quals | |
| 241 #end try | |
| 242 max_insert_size = #slurp | |
| 243 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_insert_size.__str__ != "": | |
| 244 $refGenomeSource.defuse_param.max_insert_size | |
| 245 #else | |
| 246 #try | |
| 247 $ref_dict['max_insert_size'] | |
| 248 #except | |
| 249 500 | |
| 250 #end try | |
| 251 #end if | |
| 252 | |
| 253 # Parameters for building the dataset | |
| 254 chromosomes = #slurp | |
| 255 #try | |
| 256 $ref_dict.chromosomes | |
| 257 #except | |
| 258 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,X,Y,MT | |
| 259 #end try | |
| 260 mt_chromosome = #slurp | |
| 261 #try | |
| 262 $ref_dict['mt_chromosome'] | |
| 263 #except | |
| 264 MT | |
| 265 #end try | |
| 266 gene_sources = #slurp | |
| 267 #try | |
| 268 $ref_dict['gene_sources'] | |
| 269 #except | |
| 270 IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding | |
| 271 #end try | |
| 272 ig_gene_sources = #slurp | |
| 273 #try | |
| 274 $ref_dict['ig_gene_sources'] | |
| 275 #except | |
| 276 IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene | |
| 277 #end try | |
| 278 rrna_gene_sources = #slurp | |
| 279 #try | |
| 280 $ref_dict['rrna_gene_sources'] | |
| 281 #except | |
| 282 Mt_rRNA,rRNA,rRNA_pseudogene | |
| 283 #end try | |
| 284 | |
| 285 # Blat sequences per job | |
| 286 num_blat_sequences = #slurp | |
| 287 #try | |
| 288 $ref_dict['num_blat_sequences'] | |
| 289 #except | |
| 290 10000 | |
| 291 #end try | |
| 292 | |
| 293 # Minimum gene fusion range | |
| 294 dna_concordant_length = #slurp | |
| 295 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.dna_concordant_length.__str__ != "": | |
| 296 $refGenomeSource.defuse_param.dna_concordant_length | |
| 297 #else | |
| 298 #try | |
| 299 $ref_dict['dna_concordant_length'] | |
| 300 #except | |
| 301 2000 | |
| 302 #end try | |
| 303 #end if | |
| 304 | |
| 305 # Trim length for discordant reads (split reads are not trimmed) | |
| 306 discord_read_trim = #slurp | |
| 307 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.discord_read_trim.__str__ != "": | |
| 308 $refGenomeSource.defuse_param.discord_read_trim | |
| 309 #else | |
| 310 #try | |
| 311 $ref_dict['discord_read_trim'] | |
| 312 #except | |
| 313 50 | |
| 314 #end try | |
| 315 #end if | |
| 316 | |
| 317 # Filtering parameters | |
| 318 clustering_precision = #slurp | |
| 319 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.clustering_precision.__str__ != "" | |
| 320 $refGenomeSource.defuse_param.clustering_precision | |
| 321 #else | |
| 322 #try | |
| 323 $ref_dict['clustering_precision'] | |
| 324 #except | |
| 325 0.95 | |
| 326 #end try | |
| 327 #end if | |
| 328 span_count_threshold = #slurp | |
| 329 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.span_count_threshold.__str__ != "" | |
| 330 $refGenomeSource.defuse_param.span_count_threshold | |
| 331 #else | |
| 332 #try | |
| 333 $ref_dict['span_count_threshold'] | |
| 334 #except | |
| 335 5 | |
| 336 #end try | |
| 337 #end if | |
| 338 split_count_threshold = #slurp | |
| 339 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_count_threshold.__str__ != "" | |
| 340 $refGenomeSource.defuse_param.split_count_threshold | |
| 341 #else | |
| 342 #try | |
| 343 $ref_dict['split_count_threshold'] | |
| 344 #except | |
| 345 3 | |
| 346 #end try | |
| 347 #end if | |
| 348 percent_identity_threshold = #slurp | |
| 349 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.percent_identity_threshold.__str__ != "" | |
| 350 $refGenomeSource.defuse_param.percent_identity_threshold | |
| 351 #else | |
| 352 #try | |
| 353 $ref_dict['percent_identity_threshold'] | |
| 354 #except | |
| 355 0.90 | |
| 356 #end try | |
| 357 #end if | |
| 358 max_dist_pos = #slurp | |
| 359 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_dist_pos.__str__ != "" | |
| 360 $refGenomeSource.defuse_param.max_dist_pos | |
| 361 #else | |
| 362 #try | |
| 363 $ref_dict['max_dist_pos'] | |
| 364 #except | |
| 365 600 | |
| 366 #end try | |
| 367 #end if | |
| 368 num_dist_genes = #slurp | |
| 369 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.num_dist_genes.__str__ != "" | |
| 370 $refGenomeSource.defuse_param.num_dist_genes | |
| 371 #else | |
| 372 #try | |
| 373 $ref_dict['num_dist_genes'] | |
| 374 #except | |
| 375 500 | |
| 376 #end try | |
| 377 #end if | |
| 378 split_min_anchor = #slurp | |
| 379 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_min_anchor.__str__ != "" | |
| 380 $refGenomeSource.defuse_param.split_min_anchor | |
| 381 #else | |
| 382 #try | |
| 383 $ref_dict['split_min_anchor'] | |
| 384 #except | |
| 385 4 | |
| 386 #end try | |
| 387 #end if | |
| 388 max_concordant_ratio = #slurp | |
| 389 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_concordant_ratio.__str__ != "" | |
| 390 $refGenomeSource.defuse_param.max_concordant_ratio | |
| 391 #else | |
| 392 #try | |
| 393 $ref_dict['max_concordant_ratio'] | |
| 394 #except | |
| 395 0.1 | |
| 396 #end try | |
| 397 #end if | |
| 398 splice_bias = #slurp | |
| 399 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.splice_bias.__str__ != "" | |
| 400 $refGenomeSource.defuse_param.splice_bias | |
| 401 #else | |
| 402 #try | |
| 403 $ref_dict['splice_bias'] | |
| 404 #except | |
| 405 10 | |
| 406 #end try | |
| 407 #end if | |
| 408 denovo_assembly = #slurp | |
| 409 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.denovo_assembly.__str__ != "" | |
| 410 $refGenomeSource.defuse_param.denovo_assembly | |
| 411 #else | |
| 412 #try | |
| 413 $ref_dict['denovo_assembly'] | |
| 414 #except | |
| 415 no | |
| 416 #end try | |
| 417 #end if | |
| 418 probability_threshold = #slurp | |
| 419 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.probability_threshold.__str__ != "" | |
| 420 $refGenomeSource.defuse_param.probability_threshold | |
| 421 #else | |
| 422 #try | |
| 423 $ref_dict['probability_threshold'] | |
| 424 #except | |
| 425 0.50 | |
| 426 #end try | |
| 427 #end if | |
| 428 positive_controls = \$(data_directory)/controls.txt | |
| 429 | |
| 430 # Position density when calculating covariance | |
| 431 covariance_sampling_density = #slurp | |
| 432 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.covariance_sampling_density.__str__ != "" | |
| 433 $refGenomeSource.defuse_param.covariance_sampling_density | |
| 434 #else | |
| 435 #try | |
| 436 $ref_dict['covariance_sampling_density'] | |
| 437 #except | |
| 438 0.01 | |
| 439 #end try | |
| 440 #end if | |
| 441 | |
| 442 | |
| 443 # Number of reads for each job in split | |
| 444 reads_per_job = 1000000 | |
| 445 | |
| 446 # Number of regions for each breakpoint sequence job in split | |
| 447 regions_per_job = 20 | |
| 448 | |
| 449 #raw | |
| 450 # If you have command line 'mail' and wish to be notified | |
| 451 # mailto = andrew.mcpherson@gmail.com | |
| 452 | |
| 453 # Remove temp files | |
| 454 remove_job_files = yes | |
| 455 remove_job_temp_files = yes | |
| 456 | |
| 457 # Converting to fastq | |
| 458 # Fastq converter config format 1 for reads stored in separate files for each end | |
| 459 # data_lane_rexex_N is a perl regex which stores the lane id in $1 | |
| 460 # data_end_regex_N is a perl regex which stores the end, 1 or 2, in $1 | |
| 461 # data_compress_regex_N is a perl regex which stores the compression extension in $1 | |
| 462 # data_convert_N is the associated conversion utility that takes data at stdin and outputs fastq at stdout | |
| 463 # Fastq converter config format 2 for reads stored in separate files for each end | |
| 464 # data_lane_regex_N is a perl regex which stores the lane id in $1 | |
| 465 # data_compress_regex_N is a perl regex which stores the compression extension in $1 | |
| 466 # data_end1_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 1 at stdout | |
| 467 # data_end2_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 2 at stdout | |
| 468 | |
| 469 data_lane_regex_1 = ^(.+)_[12]_export\.txt.*$ | |
| 470 data_end_regex_1 = ^.+_([12])_export\.txt.*$ | |
| 471 data_compress_regex_1 = ^.+_[12]_export\.txt(.*)$ | |
| 472 data_converter_1 = $(scripts_directory)/fq_all2std.pl export2std | |
| 473 | |
| 474 data_lane_regex_2 = ^(.+)_[12]_concat_qseq\.txt.*$ | |
| 475 data_end_regex_2 = ^.+_([12])_concat_qseq\.txt.*$ | |
| 476 data_compress_regex_2 = ^.+_[12]_concat_qseq\.txt(.*)$ | |
| 477 data_converter_2 = $(scripts_directory)/qseq2fastq.pl | |
| 478 | |
| 479 data_lane_regex_3 = ^(.+)\.bam.*$ | |
| 480 data_compress_regex_3 = ^.+\.bam(.*)$ | |
| 481 data_end1_converter_3 = samtools view - | filter_sam_mate.pl 1 | sam_to_fastq.pl | |
| 482 data_end2_converter_3 = samtools view - | filter_sam_mate.pl 2 | sam_to_fastq.pl | |
| 483 | |
| 484 data_lane_regex_4 = ^(.+).[12].fastq.*$ | |
| 485 data_end_regex_4 = ^.+.([12]).fastq.*$ | |
| 486 data_compress_regex_4 = ^.+.[12].fastq(.*)$ | |
| 487 data_converter_4 = cat | |
| 488 #end raw | |
| 489 | |
| 490 #end if | |
| 491 | |
| 492 </configfile> | |
| 493 <configfile name="shscript"> | |
| 494 #!/bin/bash | |
| 495 ## define some things for cheetah proccessing | |
| 496 #set $ds = chr(36) | |
| 497 #set $amp = chr(38) | |
| 498 #set $gt = chr(62) | |
| 499 #set $lt = chr(60) | |
| 500 #set $echo_cmd = 'echo' | |
| 501 ## Find the defuse.pl in the galaxy tool path | |
| 502 #import Cheetah.FileUtils | |
| 503 ## declare a bash function for converting a results tsv into html with links to the get_reads output files | |
| 504 results2html() { | |
| 505 rlts=${ds}1 | |
| 506 rslt_name=`basename ${ds}rlts` | |
| 507 html=${ds}2 | |
| 508 echo '${lt}html${gt}${lt}head${gt}${lt}title${gt}Defuse '${ds}rslt_name'${lt}/title${gt}${lt}/head${gt}${lt}body${gt}' ${gt} ${ds}html | |
| 509 echo '${lt}h2${gt}Defuse '${ds}rslt_name'${lt}/h2${gt}${lt}table${gt}' ${gt}${gt} ${ds}html | |
| 510 if [ -z "${ds}3" ] | |
| 511 then | |
| 512 awk '${ds}1 ~ /cluster_id/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}th${gt}%s${lt}/th${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}\ | |
| 513 ${ds}1 ~ /[1-9][0-9]*/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}td${gt}%s${lt}/td${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}' ${ds}rlts ${gt}${gt} ${ds}html | |
| 514 echo '${lt}/table${gt}' ${gt}${gt} ${ds}html | |
| 515 echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt} ${ds}html | |
| 516 else | |
| 517 export _EFP=${ds}3 | |
| 518 mkdir -p ${ds}_EFP | |
| 519 awk '${ds}1 ~ /cluster_id/{printf("${lt}tr${gt}");for (i = 1; i ${lt}= NF; i++) {printf("${lt}th${gt}%s${lt}/th${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}\ | |
| 520 ${ds}1 ~ /[1-9][0-9]*/{fn="cluster_"${ds}1"_reads.txt"; \ | |
| 521 printf("${lt}tr${gt}${lt}td${gt}${lt}a href=\"%s\"${gt}%s${lt}/a${gt}${lt}/td${gt}",fn, ${ds}1);for (i = 2; i ${lt}= NF; i++) {printf("${lt}td${gt}%s${lt}/td${gt}", ${ds}i);}; printf("${lt}/tr${gt}\n");}' ${ds}rlts ${gt}${gt} ${ds}html | |
| 522 echo '${lt}/table${gt}' ${gt}${gt} ${ds}html | |
| 523 echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt} ${ds}html | |
| 524 for i in `awk '${ds}1 ~ /[1-9][0-9]*/{print ${ds}1}' ${ds}rlts`; | |
| 525 do fn=cluster_${ds}{i}_reads.txt; | |
| 526 pn=${ds}_EFP/${ds}fn; | |
| 527 perl \${DEFUSE_PATH}/scripts/get_reads.pl -c $defuse_config -o output_dir -i ${ds}i ${gt} ${ds}pn; | |
| 528 done | |
| 529 fi | |
| 530 } | |
| 531 ## substitute pathnames into config file | |
| 1 | 532 if `grep __DEFUSE_PATH__ $defuse_config ${gt} /dev/null`;then sed -i'.tmp' "s#__DEFUSE_PATH__#\${DEFUSE_PATH}#" $defuse_config; fi |
| 533 if `grep __SAMTOOLS_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} SAMTOOLS_BIN=`which samtools`;then sed -i'.tmp' "s#__SAMTOOLS_BIN__#\${SAMTOOLS_BIN}#" $defuse_config; fi | |
| 534 if `grep __BOWTIE_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BOWTIE_BIN=`which bowtie`;then sed -i'.tmp' "s#__BOWTIE_BIN__#\${BOWTIE_BIN}#" $defuse_config; fi | |
| 535 if `grep __BOWTIE_BUILD_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BOWTIE_BUILD_BIN=`which bowtie-build`;then sed -i'.tmp' "s#__BOWTIE_BUILD_BIN__#\${BOWTIE_BUILD_BIN}#" $defuse_config; fi | |
| 536 if `grep __BLAT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} BLAT_BIN=`which blat`;then sed -i'.tmp' "s#__BLAT_BIN__#\${BLAT_BIN}#" $defuse_config; fi | |
| 2 | 537 if `grep __FATOTWOBIT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} FATOTWOBIT_BIN=`which faToTwoBit`;then sed -i'.tmp' "s#__FATOTWOBIT_BIN__#\${FATOTWOBIT_BIN}#" $defuse_config; fi |
| 1 | 538 if `grep __R_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} R_BIN=`which R`;then sed -i'.tmp' "s#__R_BIN__#\${R_BIN}#" $defuse_config; fi |
| 539 if `grep __RSCRIPT_BIN__ $defuse_config ${gt} /dev/null` ${amp}${amp} RSCRIPT_BIN=`which Rscript`;then sed -i'.tmp' "s#__RSCRIPT_BIN__#\${RSCRIPT_BIN}#" $defuse_config; fi | |
| 0 | 540 |
| 541 | |
| 542 ## copy config to output | |
| 543 cp $defuse_config $config_txt | |
| 544 ## make a data_dir and ln -s the input fastq | |
| 545 mkdir -p data_dir | |
| 546 ln -s $left_pairendreads data_dir/reads_1.fastq | |
| 547 ln -s $right_pairendreads data_dir/reads_2.fastq | |
| 548 ## ln to output_dir in from_work_dir | |
| 549 #if $defuse_out.__str__ != 'None': | |
| 550 mkdir -p $defuse_out.extra_files_path | |
| 551 ln -s $defuse_out.extra_files_path output_dir | |
| 552 #else | |
| 553 mkdir -p output_dir | |
| 554 #end if | |
| 555 ## run defuse.pl | |
| 556 perl \${DEFUSE_PATH}/scripts/defuse.pl -c $defuse_config -d data_dir -o output_dir -p 8 | |
| 557 ## copy primary results to output datasets | |
| 558 if [ -e output_dir/log/defuse.log ]; then cp output_dir/log/defuse.log $defuse_log; fi | |
| 559 if [ -e output_dir/results.tsv ]; then cp output_dir/results.tsv $results_tsv; fi | |
| 560 if [ -e output_dir/results.filtered.tsv ]; then cp output_dir/results.filtered.tsv $results_filtered_tsv; fi | |
| 561 if [ -e output_dir/results.classify.tsv ]; then cp output_dir/results.classify.tsv $results_classify_tsv; fi | |
| 562 ## create html with links for output_dir | |
| 563 #if $defuse_out.__str__ != 'None': | |
| 564 if [ -e $defuse_out ] | |
| 565 then | |
| 566 echo '${lt}html${gt}${lt}head${gt}${lt}title${gt}Defuse Output${lt}/title${gt}${lt}/head${gt}${lt}body${gt}' ${gt} $defuse_out | |
| 567 echo '${lt}h2${gt}Defuse Output Files${lt}/h2${gt}${lt}ul${gt}' ${gt}${gt} $defuse_out | |
| 568 pushd $defuse_out.extra_files_path | |
| 569 for f in `find -L . -maxdepth 1 -type f`; | |
| 570 do fn=`basename ${ds}f`; echo '${lt}li${gt}${lt}a href="'${ds}fn'"${gt}'${ds}fn'${lt}/a${gt}${lt}/li${gt}' ${gt}${gt} $defuse_out; | |
| 571 done | |
| 572 popd | |
| 573 echo '${lt}/ul${gt}' ${gt}${gt} $defuse_out | |
| 574 echo '${lt}/body${gt}${lt}/html${gt}' ${gt}${gt} $defuse_out | |
| 575 fi | |
| 576 #end if | |
| 577 ## run get_reads.pl on each cluster | |
| 578 #if $fusion_reads.__str__ != 'None': | |
| 579 if [ -e output_dir/results.filtered.tsv -a -e $fusion_reads ] | |
| 580 then | |
| 581 mkdir -p $fusion_reads.extra_files_path | |
| 582 results2html output_dir/results.filtered.tsv $fusion_reads $fusion_reads.extra_files_path | |
| 583 fi | |
| 584 #end if | |
| 585 </configfile> | |
| 586 </configfiles> | |
| 587 <outputs> | |
| 588 <data format="txt" name="config_txt" label="${tool.name} on ${on_string}: config.txt"/> | |
| 589 <data format="txt" name="defuse_log" label="${tool.name} on ${on_string}: defuse.log" /> | |
| 590 <data format="html" name="defuse_out" label="${tool.name} on ${on_string}: defuse_output"> | |
| 591 <filter>keep_output == True</filter> | |
| 592 </data> | |
| 593 <data format="html" name="fusion_reads" label="${tool.name} on ${on_string}: fusion_reads"> | |
| 594 <filter>do_get_reads == True</filter> | |
| 595 </data> | |
| 596 <data format="tabular" name="results_tsv" label="${tool.name} on ${on_string}: results.tsv" /> | |
| 597 <data format="tabular" name="results_filtered_tsv" label="${tool.name} on ${on_string}: results.filtered.tsv" /> | |
| 598 <data format="tabular" name="results_classify_tsv" label="${tool.name} on ${on_string}: results.classify.tsv" /> | |
| 599 </outputs> | |
| 600 <tests> | |
| 601 </tests> | |
| 602 <help> | |
| 603 **DeFuse** | |
| 604 | |
| 605 DeFuse_ is a software package for gene fusion discovery using RNA-Seq data. The software uses clusters of discordant paired end alignments to inform a split read alignment analysis for finding fusion boundaries. The software also employs a number of heuristic filters in an attempt to reduce the number of false positives and produces a fully annotated output for each predicted fusion. | |
| 606 | |
| 607 Journal reference: http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1001138 | |
| 608 | |
| 609 .. _DeFuse: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=Main_Page | |
| 610 | |
| 611 ------ | |
| 612 | |
| 613 **Inputs** | |
| 614 | |
| 615 DeFuse requires 2 fastq files for paried reads, one with the left mate of the paired reads, and a second fastq with the the right mate of the paired reads (**with reads in the same order as in the first fastq dataset**). | |
| 616 | |
| 617 If your fastq files have reads in different orders or include unpaired reads, you can preprocess them with **FASTQ interlacer** to create a single interlaced fastq dataset with only the paired reads and input that to **FASTQ de-interlacer** to separate the reads into a left fastq and right fastq. | |
| 618 | |
| 619 DeFuse uses a Reference Dataset to search for gene fusions. The Reference Dataset is generated from the following sources in DeFuse_Version_0.4_: | |
| 620 - genome_fasta from Ensembl | |
| 621 - gene_models from Ensembl | |
| 622 - repeats_filename from UCSC RepeatMasker rmsk.txt | |
| 623 - est_fasta from UCSC | |
| 624 - est_alignments from UCSC intronEst.txt | |
| 625 - unigene_fasta from NCBI | |
| 626 | |
| 627 .. _DeFuse_Version_0.4: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2 | |
| 628 | |
| 629 ------ | |
| 630 | |
| 631 **Outputs** | |
| 632 | |
| 633 The galaxy history will contain 5 outputs: the config.txt file that provides DeFuse with its parameters, the defuse.log which details what DeFuse has done and can be useful in determining any errors, and the 3 results files that defuse generates. | |
| 634 | |
| 635 DeFuse generates 3 results files: results.txt, results.filtered.txt, and results.classify.txt. All three files have the same format, though results.classify.txt has a probability column from the application of the classifier to results.txt, and results.filtered.txt has been filtered according to the threshold probability as set in config.txt. | |
| 636 | |
| 637 The file format is tab delimited with one prediction per line, and the following fields per prediction (not necessarily in this order): | |
| 638 | |
| 639 - **Identification** | |
| 640 - cluster_id : random identifier assigned to each prediction | |
| 641 - library_name : library name given on the command line of defuse | |
| 642 - gene1 : ensembl id of gene 1 | |
| 643 - gene2 : ensembl id of gene 2 | |
| 644 - gene_name1 : name of gene 1 | |
| 645 - gene_name2 : name of gene 2 | |
| 646 - **Evidence** | |
| 647 - break_predict : breakpoint prediction method, denovo or splitr, that is considered most reliable | |
| 648 - concordant_ratio : proportion of spanning reads considered concordant by blat | |
| 649 - denovo_min_count : minimum kmer count across denovo assembled sequence | |
| 650 - denovo_sequence : fusion sequence predicted by debruijn based denovo sequence assembly | |
| 651 - denovo_span_pvalue : p-value, lower values are evidence the prediction is a false positive | |
| 652 - gene_align_strand1 : alignment strand for spanning read alignments to gene 1 | |
| 653 - gene_align_strand2 : alignment strand for spanning read alignments to gene 2 | |
| 654 - min_map_count : minimum of the number of genomic mappings for each spanning read | |
| 655 - max_map_count : maximum of the number of genomic mappings for each spanning read | |
| 656 - mean_map_count : average of the number of genomic mappings for each spanning read | |
| 657 - num_multi_map : number of spanning reads that map to more than one genomic location | |
| 658 - span_count : number of spanning reads supporting the fusion | |
| 659 - span_coverage1 : coverage of spanning reads aligned to gene 1 as a proportion of expected coverage | |
| 660 - span_coverage2 : coverage of spanning reads aligned to gene 2 as a proportion of expected coverage | |
| 661 - span_coverage_min : minimum of span_coverage1 and span_coverage2 | |
| 662 - span_coverage_max : maximum of span_coverage1 and span_coverage2 | |
| 663 - splitr_count : number of split reads supporting the prediction | |
| 664 - splitr_min_pvalue : p-value, lower values are evidence the prediction is a false positive | |
| 665 - splitr_pos_pvalue : p-value, lower values are evidence the prediction is a false positive | |
| 666 - splitr_sequence : fusion sequence predicted by split reads | |
| 667 - splitr_span_pvalue : p-value, lower values are evidence the prediction is a false positive | |
| 668 - **Annotation** | |
| 669 - adjacent : fusion between adjacent genes | |
| 670 - altsplice : fusion likely the product of alternative splicing between adjacent genes | |
| 671 - break_adj_entropy1 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 1 | |
| 672 - break_adj_entropy2 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 2 | |
| 673 - break_adj_entropy_min : minimum of break_adj_entropy1 and break_adj_entropy2 | |
| 674 - breakpoint_homology : number of nucleotides at the fusion splice that align equally well to gene 1 or gene 2 | |
| 675 - breakseqs_estislands_percident : maximum percent identity of fusion sequence alignments to est islands | |
| 676 - cdna_breakseqs_percident : maximum percent identity of fusion sequence alignments to cdna | |
| 677 - deletion : fusion produced by a genomic deletion | |
| 678 - est_breakseqs_percident : maximum percent identity of fusion sequence alignments to est | |
| 679 - eversion : fusion produced by a genomic eversion | |
| 680 - exonboundaries : fusion splice at exon boundaries | |
| 681 - expression1 : expression of gene 1 as number of concordant pairs aligned to exons | |
| 682 - expression2 : expression of gene 2 as number of concordant pairs aligned to exons | |
| 683 - gene_chromosome1 : chromosome of gene 1 | |
| 684 - gene_chromosome2 : chromosome of gene 2 | |
| 685 - gene_end1 : end position for gene 1 | |
| 686 - gene_end2 : end position for gene 2 | |
| 687 - gene_location1 : location of breakpoint in gene 1 | |
| 688 - gene_location2 : location of breakpoint in gene 2 | |
| 689 - gene_start1 : start of gene 1 | |
| 690 - gene_start2 : start of gene 2 | |
| 691 - gene_strand1 : strand of gene 1 | |
| 692 - gene_strand2 : strand of gene 2 | |
| 693 - genome_breakseqs_percident : maximum percent identity of fusion sequence alignments to genome | |
| 694 - genomic_break_pos1 : genomic position in gene 1 of fusion splice / breakpoint | |
| 695 - genomic_break_pos2 : genomic position in gene 2 of fusion splice / breakpoint | |
| 696 - genomic_strand1 : genomic strand in gene 1 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream | |
| 697 - genomic_strand2 : genomic strand in gene 2 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream | |
| 698 - interchromosomal : fusion produced by an interchromosomal translocation | |
| 699 - interrupted_index1 : ratio of coverage before and after the fusion splice / breakpoint in gene 1 | |
| 700 - interrupted_index2 : ratio of coverage before and after the fusion splice / breakpoint in gene 2 | |
| 701 - inversion : fusion produced by genomic inversion | |
| 702 - orf : fusion combines genes in a way that preserves a reading frame | |
| 703 - probability : probability produced by classification using adaboost and example positives/negatives (only given in results.classified.txt) | |
| 704 - read_through : fusion involving adjacent potentially resulting from co-transcription rather than genome rearrangement | |
| 705 - repeat_proportion1 : proportion of the spanning reads in gene 1 that span a repeat region | |
| 706 - repeat_proportion2 : proportion of the spanning reads in gene 2 that span a repeat region | |
| 707 - max_repeat_proportion : max of repeat_proportion1 and repeat_proportion2 | |
| 708 - splice_score : number of nucleotides similar to GTAG at fusion splice | |
| 709 - num_splice_variants : number of potential splice variants for this gene pair | |
| 710 - splicing_index1 : number of concordant pairs in gene 1 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 2 | |
| 711 - splicing_index2 : number of concordant pairs in gene 2 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 1 | |
| 712 | |
| 713 | |
| 714 **Example** | |
| 715 | |
| 716 results.tsv:: | |
| 717 | |
| 718 cluster_id splitr_sequence splitr_count splitr_span_pvalue splitr_pos_pvalue splitr_min_pvalue adjacent altsplice break_adj_entropy1 break_adj_entropy2 break_adj_entropy_min break_predict breakpoint_homology breakseqs_estislands_percident cdna_breakseqs_percident concordant_ratio deletion est_breakseqs_percident eversion exonboundaries expression1 expression2 gene1 gene2 gene_align_strand1 gene_align_strand2 gene_chromosome1 gene_chromosome2 gene_end1 gene_end2 gene_location1 gene_location2 gene_name1 gene_name2 gene_start1 gene_start2 gene_strand1 gene_strand2 genome_breakseqs_percident genomic_break_pos1 genomic_break_pos2 genomic_strand1 genomic_strand2 interchromosomal interrupted_index1 interrupted_index2 inversion library_name max_map_count max_repeat_proportion mean_map_count min_map_count num_multi_map num_splice_variants orf read_through repeat_proportion1 repeat_proportion2 span_count span_coverage1 span_coverage2 span_coverage_max span_coverage_min splice_score splicing_index1 splicing_index2 | |
| 719 1169 GCTTACTGTATGCCAGGCCCCAGAGGGGCAACCACCCTCTAAAGAGAGCGGCTCCTGCCTCCCAGAAAGCTCACAGACTGTGGGAGGGAAACAGGCAGCAGGTGAAGATGCCAAATGCCAGGATATCTGCCCTGTCCTTGCTTGATGCAGCTGCTGGCTCCCACGTTCTCCCCAGAATCCCCTCACACTCCTGCTGTTTTCTCTGCAGGTTGGCAGAGCCCCATGAGGGCAGGGCAGCCACTTTGTTCTTGGGCGGCAAACCTCCCTGGGCGGCACGGAAACCACGGTGAGAAGGGGGCAGGTCGGGCACGTGCAGGGACCACGCTGCAGG|TGTACCCAACAGCTCCGAAGAGACAGCGACCATCGAGAACGGGCCATGATGACGATGGCGGTTTTGTCGAAAAGAAAAGGGGGAAATGTGGGGAAAAGCAAGAGAGATCAGATTGTTACTGTGTCTGTGTAGAAAGAAGTAGACATGGGAGACTCCATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGAGATTCGGTGACCCCACCCCCAACCCCGTGCTCTCTGAAACATGTGCTGTGTCCACTCAGGGTTGAATGGATTAAGGGCGGTGCGAGACGTGCTTT 2 0.000436307890680442 0.110748295953850 0.0880671602973091 N Y 3.19872427442695 3.48337348351473 3.19872427442695 splitr 0 0 0 0 Y 0 N N 0 0 ENSG00000105549 ENSG00000213753 + - 19 19 376013 59111168 intron upstream THEG AC016629.2 361750 59084870 - + 0 375099 386594 + - N 8.34107429512245 - N output_dir 82 0.677852348993289 40.6666666666667 1 11 1 N N 0.361271676300578 0.677852348993289 12 0.758602776578432 0.569678713445872 0.758602776578432 0.569678713445872 2 0.416666666666667 - | |
| 720 3596 TGGGGGTTGAGGCTTCTGTTCCCAGGTTCCATGACCTCAGAGGTGGCTGGTGAGGTTATGACCTTTGCCCTCCAGCCCTGGCTTAAAACCTCAGCCCTAGGACCTGGTTAAAGGAAGGGGAGATGGAGCTTTGCCCCGACCCCCCCCCGTTCCCCTCACCTGTCAGCCCGAGCTGGGCCAGGGCCCCTAGGTGGGGAACTGGGCCGGGGGGCGGGCACAAGCGGAGGTGGTGCCCCCAAAAGGGCTCCCGGTGGGGTCTTGCTGAGAAGGTGAGGGGTTCCCGGGGCCGCAGCAGGTGGTGGTGGAGGAGCCAAGCGGCTGTAGAGCAAGGGGTGAGCAGGTTCCAGACCGTAGAGGCGGGCAGCGGCCACGGCCCCGGGTCCAGTTAGCTCCTCACCCGCCTCATAGAAGCGGGGTGGCCTTGCCAGGCGTGGGGGTGCTGCC|TTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCAGCCCGAGGTTATCTAGAGTCACCAAAGCCGCCGGCGCCCGCCCCCCGGCCGGGGCCGGAGAGGGGCTGACCGGGTTGGTTTTGATCTGATAAATGCACGCATCCCCCCCGCGAAGGGGGTCAGCGCCCGTCGGCATGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAGGAGAGGAGCGAGCGACCAAAGGAACCATAACTGATTTAATGAGCCATTCGCAGTTTCACTGTACCGGCCGTGCGTACTTAGACATGCATGGCTTAATCTTTGAGACAAGCATATGCTACTGGCAGG 250 7.00711162298275e-72 0.00912124762512338 0.00684237452309549 N N 3.31745197152461 3.47233119514066 3.31745197152461 splitr 7 0.0157657657657656 0 0 N 0.0135135135135136 N N 0 0 ENSG00000156860 ENSG00000212932 - + 16 21 30682131 48111157 coding upstream FBRS RPL23AP4 30670289 48110676 + + 0.0157657657657656 30680678 9827473 - + Y - - N output_dir 2 1 1.11111111111111 1 1 1 N N 0 1 9 0.325530693397641 0.296465452915709 0.325530693397641 0.296465452915709 2 - - | |
| 721 | |
| 722 </help> | |
| 723 </tool> |