Mercurial > repos > iuc > seqtk
changeset 3:e7d27bcef53d draft
Uploaded
| author | iuc |
|---|---|
| date | Wed, 29 Apr 2015 11:55:27 -0400 |
| parents | 42a473d89b08 |
| children | 8a5151868549 |
| files | macros.xml seqtk_comp.xml seqtk_cutN.xml seqtk_dropse.xml seqtk_fqchk.xml seqtk_hety.xml seqtk_listhet.xml seqtk_mergefa.xml seqtk_mergepe.xml seqtk_mutfa.xml seqtk_randbase.xml seqtk_sample.xml seqtk_seq.xml seqtk_subseq.xml seqtk_trimfq.xml test-data/paired_dat.fq test-data/paired_dat1.fq test-data/paired_dat2.fq test-data/seqtk_comp.fa test-data/seqtk_comp.out test-data/seqtk_cutn.fa test-data/seqtk_cutn.out test-data/seqtk_dropse.fq test-data/seqtk_dropse.out test-data/seqtk_fqchk.fq test-data/seqtk_fqchk.out test-data/seqtk_hety.fa test-data/seqtk_hety.out test-data/seqtk_listhet.fa test-data/seqtk_listhet.out test-data/seqtk_mergefa.out test-data/seqtk_mergefa1.fa test-data/seqtk_mergefa2.fa test-data/seqtk_mergefa2.out test-data/seqtk_mutfa.fa test-data/seqtk_mutfa.out test-data/seqtk_mutfa.snp test-data/seqtk_randbase.fa test-data/seqtk_randbase.out test-data/seqtk_sample.fa test-data/seqtk_sample.out test-data/seqtk_seq.fa test-data/seqtk_seq_revcom.fa test-data/seqtk_subseq.fa test-data/seqtk_subseq.out test-data/seqtk_subseq_list.txt test-data/seqtk_trimfq.fq test-data/seqtk_trimfq_be.fq test-data/seqtk_trimfq_default.fq tool_dependencies.xml |
| diffstat | 50 files changed, 0 insertions(+), 1193 deletions(-) [+] |
line wrap: on
line diff
--- a/macros.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,33 +0,0 @@ -<?xml version="1.0"?> -<macros> - <xml name="requirements"> - <requirements> - <requirement type="package" version="1.0-r75-dirty">seqtk</requirement> - <yield/> - </requirements> - </xml> - <token name="@WRAPPER_VERSION@">1.0-r75-dirty</token> - <xml name="stdio"> - <stdio> - <!-- Anything other than zero is an error --> - <exit_code range="1:"/> - <exit_code range=":-1"/> - <!-- In case the return code has not been set propery check stderr too --> - <regex match="Error:"/> - <regex match="Exception:"/> - </stdio> - </xml> - <xml name="in_fq"> - <param name="in_file" type="data" format="fastq" label="Input FASTQ file"/> - </xml> - <xml name="in_faq"> - <param name="in_file" type="data" format="fasta,fastq" label="Input FASTA/Q file"/> - </xml> - <token name="@ATTRIBUTION@"><![CDATA[ -**Attribution** - -This Galaxy tool relies on the seqtk toolkit from `lh3/seqtk -<https://github.com/lh3/seqtk/>`_, developed by Heng Li at the Broad Institute - ]]> - </token> -</macros>
--- a/seqtk_comp.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,52 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_comp" name="seqtk_comp" version="@WRAPPER_VERSION@.0"> - <description>get the nucleotide composition of FASTA/Q</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk comp -#if $in_bed: --r $in_bed -#end if - -$in_file | awk 'BEGIN{print "#chr\tlength\t#A\t#C\t#G\t#T\t#2\t#3\t#4\t#CpG\t#tv\t#ts\t#CpG-ts"}1' - -> $default]]></command> - <inputs> - <expand macro="in_faq"/> - <param name="in_bed" optional="True" type="data" format="bed" label="bed file"/> - </inputs> - <outputs> - <data format="tabular" hidden="false" name="default" label="Nucleotide composition of $in_file.name"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_comp.fa" ftype="fasta"/> - <output name="default" file="seqtk_comp.out" ftype="tabular"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Reports composition of fasta/fastq sequences. For an example sequence like - -:: - >test0 - ACTGACTGAA - >ambig_ref - ACGTCGTGTTVHDBN - -The seqtk tool will report: - -:: - - #chr length #A #C #G #T #2 #3 #4 #CpG #tv #ts #CpG-ts - test0 11 4 2 2 2 0 0 1 0 0 0 0 - ambig_ref 15 1 2 3 4 0 4 1 4 0 0 0 - - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_cutN.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,52 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_cutN" name="seqtk_cutN" version="@WRAPPER_VERSION@.0"> - <description>cut sequence at long N</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk cutN -n $n --p $p -$g -$in_file -> $default]]></command> - <inputs> - <expand macro="in_faq"/> - <param label="min size of N tract" help="(-n)" name="n" type="integer" value="1000"/> - <param label="penalty for a non-N" help="(-p)" name="p" type="integer" value="10"/> - <param checked="false" label="print gaps only, no sequence" help="(-g)" name="g" type="boolean" falsevalue="" truevalue="-g"/> - </inputs> - <outputs> - <data format_source="in_file" hidden="false" name="default" label="$in_file.name split on N runs longer than $n"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_cutn.fa"/> - <param name="n" value="1"/> - <output name="default" file="seqtk_cutn.out" ftype="fasta"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Splits long sequences with runs of Ns - -:: - - >test - AACTGATCGATCGATCGNNNNNNNNNNNACATG - -This will be split into the component sequences without the ambiguity. - -:: - - >test:1-17 - AACTGATCGATCGATCG - >test:29-33 - ACATG - - -@ATTRIBUTION@ - ]]></help> -</tool>
--- a/seqtk_dropse.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,76 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_dropse" name="seqtk_dropse" version="@WRAPPER_VERSION@.0"> - <description>drop unpaired from interleaved Paired End FASTA/Q</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk dropse - $in_file -> $default]]></command> - <inputs> - <expand macro="in_faq"/> - </inputs> - <outputs> - <data format_source="in_file" hidden="false" name="default" label="Only paired-end reads from $in_file.name"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_dropse.fq"/> - <output name="default" file="seqtk_dropse.out" ftype="fastq"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Remove unpaired reads in an interleaved paired-end FASTA/Q file. Given a fastq file with unpaired reads: - -:: - - @test-6/1 - AGCTTGACGC - + - ?.HCF@C>>F - @test-6/2 - TGCGAAGACC - + - >2?A?A@@7? - @test-4/1 - CTTGACGCTG - + - I@>3EFCG@C - @test-2/1 - AGACCAAAAT - + - ??><6E?IFC - @test-2/2 - CTGGCGAATT - + - ?=?*?A?<?@ - -This tool will remove the offending reads (test-4/1), leaving just the paired data. - -:: - - @test-6/1 - AGCTTGACGC - + - ?.HCF@C>>F - @test-6/2 - TGCGAAGACC - + - >2?A?A@@7? - @test-2/1 - AGACCAAAAT - + - ??><6E?IFC - @test-2/2 - CTGGCGAATT - + - ?=?*?A?<?@ - - -@ATTRIBUTION@ - ]]></help> -</tool>
--- a/seqtk_fqchk.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,58 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_fqchk" name="seqtk_fqchk" version="@WRAPPER_VERSION@.0"> - <description>fastq QC (base/quality summary)</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk fqchk --q $q -$in_file | awk '{if(NR<4){print "#"$0}else{print $0}}' -> $default]]></command> - <inputs> - <expand macro="in_fq"/> - <param name="q" type="integer" value="20" label="quality values" help="use 0 to get the distribution of all quality values (-q)"/> - </inputs> - <outputs> - <data format="tabular" hidden="false" name="default" label="Quality information for $in_file.name"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_fqchk.fq"/> - <output name="default" file="seqtk_fqchk.out" ftype="tabular"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Returns quality score information base-by-base. - -:: - - @SEQ_ID1 - GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT - + - !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 - -each based is examined individually and information reported: - -:: - - #min_len: 60; max_len: 60; avg_len: 60.00; 15 distinct quality values - #POS #bases %A %C %G %T %N avgQ errQ %low %high - #ALL 60 31.7 16.7 18.3 33.3 0.0 15.1 8.7 66.7 33.3 - 1 1 0.0 0.0 100.0 0.0 0.0 0.0 3.0 100.0 0.0 - 2 1 100.0 0.0 0.0 0.0 0.0 6.0 6.0 100.0 0.0 - 3 1 0.0 0.0 0.0 100.0 0.0 6.0 6.0 100.0 0.0 - 4 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 - 5 1 0.0 0.0 0.0 100.0 0.0 7.0 7.0 100.0 0.0 - 6 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 - 7 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 - 8 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 - 9 1 0.0 0.0 100.0 0.0 0.0 9.0 9.0 100.0 0.0 - 10 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_hety.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,73 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_hety" name="seqtk_hety" version="@WRAPPER_VERSION@.0"> - <description>regional heterozygosity</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk hety -w $w --t $t -$m -$in_file | awk 'BEGIN{print "#chr\tstart\tend\tA\tB\tnum_het"}1' -> $default]]></command> - <inputs> - <expand macro="in_faq"/> - <param label="window size" help="(-w)" name="w" type="integer" value="50000"/> - <param label="# start positions in a window" help="(-t)" name="t" type="integer" value="5"/> - <param checked="false" label="treat lowercases as masked" help="(-m)" name="m" type="boolean" falsevalue="" truevalue="-m"/> - </inputs> - <outputs> - <data format="tabular" hidden="false" name="default" label="Heterozygous regions in $in_file.name"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_hety.fa"/> - <param name="w" value="8"/> - <output name="default" file="seqtk_hety.out" ftype="tabular"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Reports on heterozygosity over a region - -:: - - >het_region - ACTTTACATCGAGCMMMMMMMACAGTACTG - -As can be seen in the following output: - -:: - - #chr start end A B num_het - het_region 0 8 0.00 8 0 - het_region 8 9 0.00 8 0 - het_region 9 10 0.00 8 0 - het_region 10 11 0.00 8 0 - het_region 11 12 0.00 8 0 - het_region 12 13 0.00 8 0 - het_region 13 14 0.00 8 0 - het_region 14 15 1.00 8 1 - het_region 15 16 2.00 8 2 - het_region 16 17 3.00 8 3 - het_region 17 18 4.00 8 4 - het_region 18 19 5.00 8 5 - het_region 19 20 6.00 8 6 - het_region 20 21 7.00 8 7 - het_region 21 22 7.00 8 7 - het_region 22 23 6.00 8 6 - het_region 23 24 5.00 8 5 - het_region 24 25 4.00 8 4 - het_region 25 26 3.00 8 3 - het_region 26 27 2.00 8 2 - het_region 27 28 1.00 8 1 - het_region 28 29 0.00 8 0 - het_region 29 30 0.00 1 0 - -If you know what A and B are measures of, please `submit an issue <https://github.com/galaxyproject/tools-iuc/issues>`__ and it will be corrected - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_listhet.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,47 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_listhet" name="seqtk_listhet" version="@WRAPPER_VERSION@.0"> - <description>extract the position of each het</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk listhet $in_file | awk 'BEGIN{print "#chr\tposition\tbase"}1' > $default]]></command> - <inputs> - <expand macro="in_faq"/> - </inputs> - <outputs> - <data format="tabular" hidden="false" name="default" label="Positions of heterozygous bases in $in_file.name"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_listhet.fa"/> - <output name="default" file="seqtk_listhet.out" ftype="tabular"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Lists regions of heterozygosity. - -:: - - >ambig - ACGTMRWSYKVHDBN - -The seqtk suite recognises MRWSYK: - -:: - - #chr position base - ambig 5 M - ambig 6 R - ambig 7 W - ambig 8 S - ambig 9 Y - ambig 10 K - - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_mergefa.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,68 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_mergefa" name="seqtk_mergefa" version="@WRAPPER_VERSION@.0"> - <description>merge two FASTA/Q files</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk mergefa -q $q -$i -$m -$r -$h - -$in_fa1 -$in_fa2 - -> $default]]></command> - <inputs> - <param name="in_fa1" type="data" format="fasta,fastq" label="Input FASTA/Q file #1"/> - <param name="in_fa2" type="data" format="fasta,fastq" label="Input FASTA/Q file #2"/> - <param label="quality threshold" help="(-q)" name="q" type="integer" value="0"/> - <param checked="false" label="take intersection" help="(-i)" name="i" type="boolean" falsevalue="" truevalue="-i"/> - <param checked="false" label="convert to lowercase when one of the input base is N" help="(-m)" name="m" type="boolean" falsevalue="" truevalue="-m"/> - <param checked="false" label="pick a random allele from het" help="(-r)" name="r" type="boolean" falsevalue="" truevalue="-r"/> - <param checked="false" label="suppress hets in the input" help="(-h)" name="h" type="boolean" falsevalue="" truevalue="-h"/> - </inputs> - <outputs> - <data format_source="in_fa1" hidden="false" name="default" label="Merger of $in_fa1.name and $in_fa2.name"/> - </outputs> - <tests> - <test> - <param name="in_fa1" value="seqtk_mergefa1.fa"/> - <param name="in_fa2" value="seqtk_mergefa2.fa"/> - <output name="default" file="seqtk_mergefa.out" ftype="fasta"/> - </test> - <test> - <param name="in_fa1" value="seqtk_mergefa1.fa"/> - <param name="in_fa2" value="seqtk_mergefa2.fa"/> - <param name="m" value="True" /> - <output name="default" file="seqtk_mergefa2.out" ftype="fasta"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Merges two fasta files, using ambiguity codes - -:: - - # seq1.fa - >test0 - ACTGACTGAAA - - # seq2.fa - >test0 - ACTGAMTGCGN - -In the following the `-m` option has been set to highlight seqtk-mergefa's features. - -:: - - >test0 - ACTGACTGxxa - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_mergepe.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,93 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_mergepe" name="seqtk_mergepe" version="@WRAPPER_VERSION@.0"> - <description>interleave two unpaired FASTA/Q files for a paired-end file</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk mergepe - $in_fq1 - $in_fq2 -> $default]]></command> - <inputs> - <param name="in_fq1" type="data" format="fasta,fastq" label="Input FASTA/Q file #1"/> - <param name="in_fq2" type="data" format="fasta,fastq" label="Input FASTA/Q file #2"/> - </inputs> - <outputs> - <data format_source="in_fq1" hidden="false" name="default" label="$in_fq1.name and $in_fq2.name as interleaved paired-end"/> - </outputs> - <tests> - <test> - <param name="in_fq1" value="paired_dat1.fq"/> - <param name="in_fq2" value="paired_dat2.fq"/> - <output name="default" file="paired_dat.fq" ftype="fastq"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Merge two files which constitute a paired-end file into a single, interleaved, paired-end FASTA/Q file - -:: - - # r1.fq - @test-6/1 - AGCTTGACGC - + - ?.HCF@C>>F - - # r2.fq - @test-6/2 - TGCGAAGACC - + - >2?A?A@@7? - -will produce the following paired file: - -:: - - @test-6/1 - AGCTTGACGC - + - ?.HCF@C>>F - @test-6/2 - TGCGAAGACC - + - >2?A?A@@7? - -While this may not have been an illuminating example, it is important to note -that this tool will properly interleave data. For example if you have the ids: - -:: - - @r-1/1 - @r-2/1 - @r-3/1 - @r-4/1 - -and - -:: - - @r-1/2 - @r-2/2 - @r-3/2 - @r-4/2 - -These will be interleaved as - -:: - - @r-1/1 - @r-1/2 - @r-2/1 - @r-2/2 - @r-3/1 - @r-3/2 - @r-4/1 - @r-4/2 - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_mutfa.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,51 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_mutfa" name="seqtk_mutfa" version="@WRAPPER_VERSION@.0"> - <description>point mutate FASTA at specified positions</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk mutfa - $in_file $in_snp -> $default]]></command> - <inputs> - <expand macro="in_faq"/> - <param name="in_snp" type="data" format="tabular" label="Input SNP file"/> - </inputs> - <outputs> - <data format_source="in_file" hidden="false" name="default" label="Mutated $in_file.name"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_mutfa.fa"/> - <param name="in_snp" value="seqtk_mutfa.snp"/> - <output name="default" file="seqtk_mutfa.out" ftype="fasta"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -the SNP inputs consist of 4 columns: chromosome, 1-based-pos, any, base-changed-to. - -:: - - # Input fasta - >test0 - ACTGACTGAA - - # Input SNP file - test0 1 . G - test0 4 . A - -This will effect the desired mutations in the output file - -:: - - # Output result - >test0 - GCTAACTGAA - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_randbase.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,45 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_randbase" name="seqtk_randbase" version="@WRAPPER_VERSION@.0"> - <description>choose a random base from hets</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk randbase - $in_file -> $default]]></command> - <inputs> - <expand macro="in_faq"/> - </inputs> - <outputs> - <data format_source="in_file" hidden="false" name="default" label="Unambiguous $in_file.name"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_randbase.fa"/> - <output name="default" file="seqtk_randbase.out" ftype="fasta"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Randomly resolves ambiguous bases - -:: - - # Input fasta - >ambig - ACGTMRWSYK - -results in - -:: - - # Output result - >ambig - ACGTCGTGTT - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_sample.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,38 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_sample" name="seqtk_sample" version="@WRAPPER_VERSION@.0"> - <description>random subsample of fasta or fastq sequences</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk sample -s $s - $in_file - $subsample_size -> $default]]></command> - <inputs> - <expand macro="in_faq" /> - <param label="RNG seed" help="(-s)" name="s" type="integer" value="4"/> - <param label="Subsample (decimal fraction or number)" name="subsample_size" type="integer" value="100"/> - </inputs> - <outputs> - <data format_source="in_file" hidden="false" name="default" label="Subsample of reads from $in_file.name"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_sample.fa"/> - <param name="subsample_size" value="4"/> - <param name="s" value="4"/> - <output name="default" file="seqtk_sample.out" ftype="fasta"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Takes a random subsample of fasta or fastq sequences. The RNG is seedable to allow for reproducible results, and defaults to `4 <http://xkcd.com/221/>`__. - -The subsample size can be a decimal fraction <=1, where 1 implies 100% of the reads should be used. If a number >1 is provided, that many reads will be taken from the dataset. - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_seq.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,76 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_seq" name="seqtk_seq" version="@WRAPPER_VERSION@.0"> - <description>common transformation of FASTA/Q</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk seq -q $q --X $X -#if $n and $n != "None" and $n is not None and $n != "": --n "$n" -#end if --l $l --Q $Q --s $s --f $f -#if $M and $M != "None" and $M is not None and $M != "": --M "$M" -#end if --L $L -$c -$r -$A -$C -$N -$x1 -$x2 -$V - -$in_file -> $default]]></command> - <inputs> - <expand macro="in_faq"/> - <param label="mask bases with quality lower than INT" help="(-q)" name="q" type="integer" value="0"/> - <param label="mask bases with quality higher than INT" help="(-X)" name="X" type="integer" value="255"/> - <param area="false" default="0" label="masked bases converted to CHAR; 0 for lowercase" help="(-n)" name="n" type="text"/> - <param label="number of residues per line; 0 for 2^32-1" help="(-l)" name="l" type="integer" value="0"/> - <param label="quality shift: ASCII-INT gives base quality" help="(-Q)" name="Q" type="integer" value="33"/> - <param label="random seed" help="effective with -f (-s)" name="s" type="integer" value="11"/> - <param label="sample fraction of sequences" help="(-f)" name="f" type="float" value="1"/> - <param area="false" default="null" label="mask regions in BED or name list FILE" help="(-M)" name="M" type="text"/> - <param label="drop sequences with length shorter than INT" help="(-L)" name="L" type="integer" value="0"/> - <param checked="false" label="mask complement region" help="effective with -M (-c)" name="c" type="boolean" falsevalue="" truevalue="-c"/> - <param checked="false" label="reverse complement" help="(-r)" name="r" type="boolean" falsevalue="" truevalue="-r"/> - <param checked="false" label="force FASTA output (discard quality)" help="(-A)" name="A" type="boolean" falsevalue="" truevalue="-A"/> - <param checked="false" label="drop comments at the header lines" help="(-C)" name="C" type="boolean" falsevalue="" truevalue="-C"/> - <param checked="false" label="drop sequences containing ambiguous bases" help="(-N)" name="N" type="boolean" falsevalue="" truevalue="-N"/> - <param checked="false" label="output the 2n-1 reads only" help="(-1)" name="x1" type="boolean" falsevalue="" truevalue="-1"/> - <param checked="false" label="output the 2n reads only" help="(-2)" name="x2" type="boolean" falsevalue="" truevalue="-2"/> - <param checked="false" label="shift quality by '(-Q) - 33' " help="(-V)" name="V" type="boolean" falsevalue="" truevalue="-V"/> - </inputs> - <outputs> - <data format_source="in_file" hidden="false" name="default"/> - </outputs> - <tests> - <test> - <!-- This is a sorry excuse for a test for a tool which does way more - than it should, but upstream decided to put a TON of functionality - into a single tool rather than using the single responsibility - principle. --> - <param name="in_file" value="seqtk_seq.fa"/> - <param name="r" value="True"/> - <param name="n" value=""/> - <param name="M" value=""/> - <output name="default" file="seqtk_seq_revcom.fa" ftype="fasta"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Various utilities for transforming FASTA/Q data - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_subseq.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,83 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_subseq" name="seqtk_subseq" version="@WRAPPER_VERSION@.0"> - <description>extract subsequences from FASTA/Q files</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk subseq $t --l $l -$in_file - -#if $source.type == 'bed': - $in_bed -#else - $name_list -#end if - -#if $t == '-t': - | awk 'BEGIN{print "chr\tunknown\tseq"}1' -#end if - -> $default]]></command> - <inputs> - <param name="in_file" type="data" format="fasta,fastq" label="Input fasta/q file"/> - <conditional name="source"> - <param name="type" type="select" label="Select source of sequence choices"> - <option value="bed">BED</option> - <option value="name">FASTA/Q ID list</option> - </param> - <when value="bed"> - <param name="in_bed" type="data" format="bed" label="Input BED file"/> - </when> - <when value="name"> - <param name="name_list" type="data" format="txt" label="Input fasta file"/> - </when> - </conditional> - <param label="TAB delimited output" help="(-t)" name="t" type="boolean" falsevalue="" truevalue="-t"/> - <param label="sequence line length" help="(-l)" name="l" type="integer" value="0"/> - </inputs> - <outputs> - <data format_source="in_file" hidden="false" name="default" label="Selected sequences from $in_file.name"> - <change_format> - <when input="t" value="-t" format="tabular"/> - </change_format> - </data> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_subseq.fa"/> - <param name="type" value="name"/> - <param name="t" value="False" /> - <param name="name_list" value="seqtk_subseq_list.txt"/> - <output name="default" file="seqtk_subseq.out" ftype="fasta"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Given a list of newline separated IDs from a fasta file, this will extract those named fasta sequences from the input file. - -:: - - # Input ID list - seq1 - - # Input fasta - >seq1 - ACGTMRWSYK - >seq2 - RWSYKACGTM - -results in - -:: - - # Output result - >seq1 - ACGTMRWSYK - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/seqtk_trimfq.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,62 +0,0 @@ -<?xml version="1.0"?> -<tool id="seqtk_trimfq" name="seqtk_trimfq" version="@WRAPPER_VERSION@.0"> - <description>trim FASTQ using the Phred algorithm</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - <command><![CDATA[seqtk trimfq -#if $mode.mode_select == "quality": --q $mode.q --l $mode.l -#else: --b $mode.b --e $mode.e -#end if -$in_file -> $default]]></command> - <inputs> - <expand macro="in_faq"/> - <conditional name="mode"> - <param name="mode_select" type="select" label="Mode for trimming FASTQ File"> - <option value="quality">Quality</option> - <option value="position">Length/Position</option> - </param> - <when value="quality"> - <param label="error rate threshold" help="(-q)" name="q" type="float" value="0.05"/> - <param label="maximally trim down to INT bp" help="(-l)" name="l" type="integer" value="30"/> - </when> - <when value="position"> - <param label="trim INT bp from left" help="(-b)" name="b" type="integer" value="0"/> - <param label="trim INT bp from right" help="(-e)" name="e" type="integer" value="0"/> - </when> - </conditional> - </inputs> - <outputs> - <data format_source="in_file" hidden="false" name="default" label="$in_file.name trimmed"/> - </outputs> - <tests> - <test> - <param name="in_file" value="seqtk_trimfq.fq"/> - <param name="mode_select" value="quality"/> - <param name="q" value="0.05"/> - <param name="l" value="30"/> - <output name="default" file="seqtk_trimfq_default.fq" ftype="fastq"/> - </test> - <test> - <param name="in_file" value="seqtk_trimfq.fq"/> - <param name="mode_select" value="position"/> - <param name="b" value="5"/> - <param name="e" value="5"/> - <output name="default" file="seqtk_trimfq_be.fq" ftype="fastq"/> - </test> - </tests> - <help><![CDATA[ -**What it does** - -Trim a fastq file based on Phred scores, or by length - -@ATTRIBUTION@ -]]></help> -</tool>
--- a/test-data/paired_dat.fq Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,24 +0,0 @@ -@test-6/1 -AGCTTGACGC -+ -?.HCF@C>>F -@test-6/2 -TGCGAAGACC -+ ->2?A?A@@7? -@test-4/1 -CTTGACGCTG -+ -I@>3EFCG@C -@test-4/2 -TGCGAAGACC -+ -A?A@@B@<BC -@test-2/1 -AGACCAAAAT -+ -??><6E?IFC -@test-2/2 -CTGGCGAATT -+ -?=?*?A?<?@
--- a/test-data/paired_dat1.fq Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,12 +0,0 @@ -@test-6/1 -AGCTTGACGC -+ -?.HCF@C>>F -@test-4/1 -CTTGACGCTG -+ -I@>3EFCG@C -@test-2/1 -AGACCAAAAT -+ -??><6E?IFC
--- a/test-data/paired_dat2.fq Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,12 +0,0 @@ -@test-6/2 -TGCGAAGACC -+ ->2?A?A@@7? -@test-4/2 -TGCGAAGACC -+ -A?A@@B@<BC -@test-2/2 -CTGGCGAATT -+ -?=?*?A?<?@
--- a/test-data/seqtk_comp.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,5 +0,0 @@ ->test0 -ACTGACTGAA ->ambig_ref -ACGTCGTGTTVHDBN -
--- a/test-data/seqtk_comp.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ -#chr length #A #C #G #T #2 #3 #4 #CpG #tv #ts #CpG-ts -test0 10 4 2 2 2 0 0 0 0 0 0 0 -ambig_ref 15 1 2 3 4 0 4 1 4 0 0 0
--- a/test-data/seqtk_cutn.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ ->test -AACTGATCGATCGATCGNNNNNNNNNNNACATG -
--- a/test-data/seqtk_cutn.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ ->test:1-17 -AACTGATCGATCGATCG ->test:29-33 -ACATG
--- a/test-data/seqtk_dropse.fq Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,20 +0,0 @@ -@test-6/1 -AGCTTGACGC -+ -?.HCF@C>>F -@test-6/2 -TGCGAAGACC -+ ->2?A?A@@7? -@test-4/2 -TGCGAAGACC -+ -A?A@@B@<BC -@test-2/1 -AGACCAAAAT -+ -??><6E?IFC -@test-2/2 -CTGGCGAATT -+ -?=?*?A?<?@
--- a/test-data/seqtk_dropse.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,16 +0,0 @@ -@test-6/1 -AGCTTGACGC -+ -?.HCF@C>>F -@test-6/2 -TGCGAAGACC -+ ->2?A?A@@7? -@test-2/1 -AGACCAAAAT -+ -??><6E?IFC -@test-2/2 -CTGGCGAATT -+ -?=?*?A?<?@
--- a/test-data/seqtk_fqchk.fq Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -@SEQ_ID1 -GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT -+ -!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
--- a/test-data/seqtk_fqchk.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,63 +0,0 @@ -#min_len: 60; max_len: 60; avg_len: 60.00; 15 distinct quality values -#POS #bases %A %C %G %T %N avgQ errQ %low %high -#ALL 60 31.7 16.7 18.3 33.3 0.0 15.1 8.7 66.7 33.3 -1 1 0.0 0.0 100.0 0.0 0.0 0.0 3.0 100.0 0.0 -2 1 100.0 0.0 0.0 0.0 0.0 6.0 6.0 100.0 0.0 -3 1 0.0 0.0 0.0 100.0 0.0 6.0 6.0 100.0 0.0 -4 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 -5 1 0.0 0.0 0.0 100.0 0.0 7.0 7.0 100.0 0.0 -6 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 -7 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 -8 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 -9 1 0.0 0.0 100.0 0.0 0.0 9.0 9.0 100.0 0.0 -10 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 -11 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 -12 1 0.0 100.0 0.0 0.0 0.0 10.0 10.0 100.0 0.0 -13 1 100.0 0.0 0.0 0.0 0.0 8.0 8.0 100.0 0.0 -14 1 100.0 0.0 0.0 0.0 0.0 8.0 8.0 100.0 0.0 -15 1 100.0 0.0 0.0 0.0 0.0 4.0 4.0 100.0 0.0 -16 1 0.0 0.0 100.0 0.0 0.0 4.0 4.0 100.0 0.0 -17 1 0.0 100.0 0.0 0.0 0.0 4.0 4.0 100.0 0.0 -18 1 100.0 0.0 0.0 0.0 0.0 10.0 10.0 100.0 0.0 -19 1 0.0 0.0 100.0 0.0 0.0 10.0 10.0 100.0 0.0 -20 1 0.0 0.0 0.0 100.0 0.0 8.0 8.0 100.0 0.0 -21 1 100.0 0.0 0.0 0.0 0.0 7.0 7.0 100.0 0.0 -22 1 0.0 0.0 0.0 100.0 0.0 4.0 4.0 100.0 0.0 -23 1 0.0 100.0 0.0 0.0 0.0 4.0 4.0 100.0 0.0 -24 1 0.0 0.0 100.0 0.0 0.0 4.0 4.0 100.0 0.0 -25 1 100.0 0.0 0.0 0.0 0.0 4.0 4.0 100.0 0.0 -26 1 0.0 0.0 0.0 100.0 0.0 8.0 8.0 100.0 0.0 -27 1 0.0 100.0 0.0 0.0 0.0 13.0 13.0 100.0 0.0 -28 1 100.0 0.0 0.0 0.0 0.0 16.0 16.0 100.0 0.0 -29 1 100.0 0.0 0.0 0.0 0.0 9.0 9.0 100.0 0.0 -30 1 100.0 0.0 0.0 0.0 0.0 9.0 9.0 100.0 0.0 -31 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 -32 1 100.0 0.0 0.0 0.0 0.0 12.0 12.0 100.0 0.0 -33 1 0.0 0.0 100.0 0.0 0.0 10.0 10.0 100.0 0.0 -34 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 -35 1 100.0 0.0 0.0 0.0 0.0 6.0 6.0 100.0 0.0 -36 1 100.0 0.0 0.0 0.0 0.0 6.0 6.0 100.0 0.0 -37 1 100.0 0.0 0.0 0.0 0.0 8.0 8.0 100.0 0.0 -38 1 0.0 0.0 0.0 100.0 0.0 8.0 8.0 100.0 0.0 -39 1 0.0 100.0 0.0 0.0 0.0 9.0 9.0 100.0 0.0 -40 1 0.0 100.0 0.0 0.0 0.0 9.0 9.0 100.0 0.0 -41 1 100.0 0.0 0.0 0.0 0.0 20.0 20.0 0.0 100.0 -42 1 0.0 0.0 0.0 100.0 0.0 20.0 20.0 0.0 100.0 -43 1 0.0 0.0 0.0 100.0 0.0 34.0 34.0 0.0 100.0 -44 1 0.0 0.0 0.0 100.0 0.0 34.0 34.0 0.0 100.0 -45 1 0.0 0.0 100.0 0.0 0.0 37.0 37.0 0.0 100.0 -46 1 0.0 0.0 0.0 100.0 0.0 29.0 29.0 0.0 100.0 -47 1 0.0 0.0 0.0 100.0 0.0 29.0 29.0 0.0 100.0 -48 1 0.0 100.0 0.0 0.0 0.0 29.0 29.0 0.0 100.0 -49 1 100.0 0.0 0.0 0.0 0.0 29.0 29.0 0.0 100.0 -50 1 100.0 0.0 0.0 0.0 0.0 29.0 29.0 0.0 100.0 -51 1 0.0 100.0 0.0 0.0 0.0 29.0 29.0 0.0 100.0 -52 1 0.0 0.0 0.0 100.0 0.0 34.0 34.0 0.0 100.0 -53 1 0.0 100.0 0.0 0.0 0.0 34.0 34.0 0.0 100.0 -54 1 100.0 0.0 0.0 0.0 0.0 34.0 34.0 0.0 100.0 -55 1 0.0 100.0 0.0 0.0 0.0 34.0 34.0 0.0 100.0 -56 1 100.0 0.0 0.0 0.0 0.0 34.0 34.0 0.0 100.0 -57 1 0.0 0.0 100.0 0.0 0.0 34.0 34.0 0.0 100.0 -58 1 0.0 0.0 0.0 100.0 0.0 34.0 34.0 0.0 100.0 -59 1 0.0 0.0 0.0 100.0 0.0 21.0 21.0 0.0 100.0 -60 1 0.0 0.0 0.0 100.0 0.0 20.0 20.0 0.0 100.0
--- a/test-data/seqtk_hety.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ ->het_region -ACTTTACATCGAGCMMMMMMMACAGTACTG -
--- a/test-data/seqtk_hety.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,24 +0,0 @@ -#chr start end A B num_het -het_region 0 8 0.00 8 0 -het_region 8 9 0.00 8 0 -het_region 9 10 0.00 8 0 -het_region 10 11 0.00 8 0 -het_region 11 12 0.00 8 0 -het_region 12 13 0.00 8 0 -het_region 13 14 0.00 8 0 -het_region 14 15 1.00 8 1 -het_region 15 16 2.00 8 2 -het_region 16 17 3.00 8 3 -het_region 17 18 4.00 8 4 -het_region 18 19 5.00 8 5 -het_region 19 20 6.00 8 6 -het_region 20 21 7.00 8 7 -het_region 21 22 7.00 8 7 -het_region 22 23 6.00 8 6 -het_region 23 24 5.00 8 5 -het_region 24 25 4.00 8 4 -het_region 25 26 3.00 8 3 -het_region 26 27 2.00 8 2 -het_region 27 28 1.00 8 1 -het_region 28 29 0.00 8 0 -het_region 29 30 0.00 1 0
--- a/test-data/seqtk_listhet.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ ->ambig -ACGTMRWSYKVHDBN -
--- a/test-data/seqtk_listhet.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -#chr position base -ambig 5 M -ambig 6 R -ambig 7 W -ambig 8 S -ambig 9 Y -ambig 10 K
--- a/test-data/seqtk_mergefa.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->test0 -ACTGAMTGMRN
--- a/test-data/seqtk_mergefa1.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->test0 -ACTGACTGAAA
--- a/test-data/seqtk_mergefa2.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->test0 -ACTGAMTGCGN
--- a/test-data/seqtk_mergefa2.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->test0 -ACTGACTGxxa
--- a/test-data/seqtk_mutfa.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->test0 -ACTGACTGAA
--- a/test-data/seqtk_mutfa.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->test0 -GCTAACTGAA
--- a/test-data/seqtk_mutfa.snp Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -test0 1 . G -test0 4 . A
--- a/test-data/seqtk_randbase.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->ambig -ACGTMRWSYK
--- a/test-data/seqtk_randbase.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->ambig -ACGTCGTGTT
--- a/test-data/seqtk_sample.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,27 +0,0 @@ ->seq0 -AAAAAAAAAA -AAAAAAAAAA ->seq1 -TTTTTTTTTT -TTTTTTTTTT ->seq2 -CCCCCCCCCC -CCCCCCCCCC ->seq3 -GGGGGGGGGG -GGGGGGGGGG ->seq4 -AAAAAAAAAA -TTTTTTTTTT ->seq5 -AAAAAAAAAA -CCCCCCCCCC ->seq6 -AAAAAAAAAA -GGGGGGGGGG ->seq7 -TTTTTTTTTT -CCCCCCCCCC ->seq8 -TTTTTTTTTT -GGGGGGGGGG
--- a/test-data/seqtk_sample.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ ->seq7 -TTTTTTTTTTCCCCCCCCCC ->seq1 -TTTTTTTTTTTTTTTTTTTT ->seq4 -AAAAAAAAAATTTTTTTTTT ->seq3 -GGGGGGGGGGGGGGGGGGGG
--- a/test-data/seqtk_seq.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ ->test -AACTGATCGATCGATCGNNNNNNNNNNNACATG -
--- a/test-data/seqtk_seq_revcom.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->test -CATGTNNNNNNNNNNNCGATCGATCGATCAGTT
--- a/test-data/seqtk_subseq.fa Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ ->seq1 -ACGTMRWSYK ->seq2 -RWSYKACGTM
--- a/test-data/seqtk_subseq.out Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ ->seq1 -ACGTMRWSYK
--- a/test-data/seqtk_subseq_list.txt Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -seq1
--- a/test-data/seqtk_trimfq.fq Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -@SEQ_ID1 -GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT -+ -!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
--- a/test-data/seqtk_trimfq_be.fq Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -@SEQ_ID1 -GGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCAC -+ -(((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCC
--- a/test-data/seqtk_trimfq_default.fq Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -@SEQ_ID1 -TAGTAAATCCATTTGTTCAACTCACAGTTT -+ -*-+*''))**55CCF>>>>>>CCCCCCC65
--- a/tool_dependencies.xml Tue Apr 28 22:56:42 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,6 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="seqtk" version="1.0-r75-dirty"> - <repository changeset_revision="f059064a6de2" name="package_seqtk_1_0_r75" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency>