Mercurial > repos > iuc > seqtk
changeset 2:42a473d89b08 draft
Uploaded
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,33 @@ +<?xml version="1.0"?> +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package" version="1.0-r75-dirty">seqtk</requirement> + <yield/> + </requirements> + </xml> + <token name="@WRAPPER_VERSION@">1.0-r75-dirty</token> + <xml name="stdio"> + <stdio> + <!-- Anything other than zero is an error --> + <exit_code range="1:"/> + <exit_code range=":-1"/> + <!-- In case the return code has not been set propery check stderr too --> + <regex match="Error:"/> + <regex match="Exception:"/> + </stdio> + </xml> + <xml name="in_fq"> + <param name="in_file" type="data" format="fastq" label="Input FASTQ file"/> + </xml> + <xml name="in_faq"> + <param name="in_file" type="data" format="fasta,fastq" label="Input FASTA/Q file"/> + </xml> + <token name="@ATTRIBUTION@"><![CDATA[ +**Attribution** + +This Galaxy tool relies on the seqtk toolkit from `lh3/seqtk +<https://github.com/lh3/seqtk/>`_, developed by Heng Li at the Broad Institute + ]]> + </token> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_comp.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,52 @@ +<?xml version="1.0"?> +<tool id="seqtk_comp" name="seqtk_comp" version="@WRAPPER_VERSION@.0"> + <description>get the nucleotide composition of FASTA/Q</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk comp +#if $in_bed: +-r $in_bed +#end if + +$in_file | awk 'BEGIN{print "#chr\tlength\t#A\t#C\t#G\t#T\t#2\t#3\t#4\t#CpG\t#tv\t#ts\t#CpG-ts"}1' + +> $default]]></command> + <inputs> + <expand macro="in_faq"/> + <param name="in_bed" optional="True" type="data" format="bed" label="bed file"/> + </inputs> + <outputs> + <data format="tabular" hidden="false" name="default" label="Nucleotide composition of $in_file.name"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_comp.fa" ftype="fasta"/> + <output name="default" file="seqtk_comp.out" ftype="tabular"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Reports composition of fasta/fastq sequences. For an example sequence like + +:: + >test0 + ACTGACTGAA + >ambig_ref + ACGTCGTGTTVHDBN + +The seqtk tool will report: + +:: + + #chr length #A #C #G #T #2 #3 #4 #CpG #tv #ts #CpG-ts + test0 11 4 2 2 2 0 0 1 0 0 0 0 + ambig_ref 15 1 2 3 4 0 4 1 4 0 0 0 + + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_cutN.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,52 @@ +<?xml version="1.0"?> +<tool id="seqtk_cutN" name="seqtk_cutN" version="@WRAPPER_VERSION@.0"> + <description>cut sequence at long N</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk cutN -n $n +-p $p +$g +$in_file +> $default]]></command> + <inputs> + <expand macro="in_faq"/> + <param label="min size of N tract" help="(-n)" name="n" type="integer" value="1000"/> + <param label="penalty for a non-N" help="(-p)" name="p" type="integer" value="10"/> + <param checked="false" label="print gaps only, no sequence" help="(-g)" name="g" type="boolean" falsevalue="" truevalue="-g"/> + </inputs> + <outputs> + <data format_source="in_file" hidden="false" name="default" label="$in_file.name split on N runs longer than $n"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_cutn.fa"/> + <param name="n" value="1"/> + <output name="default" file="seqtk_cutn.out" ftype="fasta"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Splits long sequences with runs of Ns + +:: + + >test + AACTGATCGATCGATCGNNNNNNNNNNNACATG + +This will be split into the component sequences without the ambiguity. + +:: + + >test:1-17 + AACTGATCGATCGATCG + >test:29-33 + ACATG + + +@ATTRIBUTION@ + ]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_dropse.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,76 @@ +<?xml version="1.0"?> +<tool id="seqtk_dropse" name="seqtk_dropse" version="@WRAPPER_VERSION@.0"> + <description>drop unpaired from interleaved Paired End FASTA/Q</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk dropse + $in_file +> $default]]></command> + <inputs> + <expand macro="in_faq"/> + </inputs> + <outputs> + <data format_source="in_file" hidden="false" name="default" label="Only paired-end reads from $in_file.name"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_dropse.fq"/> + <output name="default" file="seqtk_dropse.out" ftype="fastq"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Remove unpaired reads in an interleaved paired-end FASTA/Q file. Given a fastq file with unpaired reads: + +:: + + @test-6/1 + AGCTTGACGC + + + ?.HCF@C>>F + @test-6/2 + TGCGAAGACC + + + >2?A?A@@7? + @test-4/1 + CTTGACGCTG + + + I@>3EFCG@C + @test-2/1 + AGACCAAAAT + + + ??><6E?IFC + @test-2/2 + CTGGCGAATT + + + ?=?*?A?<?@ + +This tool will remove the offending reads (test-4/1), leaving just the paired data. + +:: + + @test-6/1 + AGCTTGACGC + + + ?.HCF@C>>F + @test-6/2 + TGCGAAGACC + + + >2?A?A@@7? + @test-2/1 + AGACCAAAAT + + + ??><6E?IFC + @test-2/2 + CTGGCGAATT + + + ?=?*?A?<?@ + + +@ATTRIBUTION@ + ]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_fqchk.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,58 @@ +<?xml version="1.0"?> +<tool id="seqtk_fqchk" name="seqtk_fqchk" version="@WRAPPER_VERSION@.0"> + <description>fastq QC (base/quality summary)</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk fqchk +-q $q +$in_file | awk '{if(NR<4){print "#"$0}else{print $0}}' +> $default]]></command> + <inputs> + <expand macro="in_fq"/> + <param name="q" type="integer" value="20" label="quality values" help="use 0 to get the distribution of all quality values (-q)"/> + </inputs> + <outputs> + <data format="tabular" hidden="false" name="default" label="Quality information for $in_file.name"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_fqchk.fq"/> + <output name="default" file="seqtk_fqchk.out" ftype="tabular"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Returns quality score information base-by-base. + +:: + + @SEQ_ID1 + GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + + + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 + +each based is examined individually and information reported: + +:: + + #min_len: 60; max_len: 60; avg_len: 60.00; 15 distinct quality values + #POS #bases %A %C %G %T %N avgQ errQ %low %high + #ALL 60 31.7 16.7 18.3 33.3 0.0 15.1 8.7 66.7 33.3 + 1 1 0.0 0.0 100.0 0.0 0.0 0.0 3.0 100.0 0.0 + 2 1 100.0 0.0 0.0 0.0 0.0 6.0 6.0 100.0 0.0 + 3 1 0.0 0.0 0.0 100.0 0.0 6.0 6.0 100.0 0.0 + 4 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 + 5 1 0.0 0.0 0.0 100.0 0.0 7.0 7.0 100.0 0.0 + 6 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 + 7 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 + 8 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 + 9 1 0.0 0.0 100.0 0.0 0.0 9.0 9.0 100.0 0.0 + 10 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_hety.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,73 @@ +<?xml version="1.0"?> +<tool id="seqtk_hety" name="seqtk_hety" version="@WRAPPER_VERSION@.0"> + <description>regional heterozygosity</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk hety -w $w +-t $t +$m +$in_file | awk 'BEGIN{print "#chr\tstart\tend\tA\tB\tnum_het"}1' +> $default]]></command> + <inputs> + <expand macro="in_faq"/> + <param label="window size" help="(-w)" name="w" type="integer" value="50000"/> + <param label="# start positions in a window" help="(-t)" name="t" type="integer" value="5"/> + <param checked="false" label="treat lowercases as masked" help="(-m)" name="m" type="boolean" falsevalue="" truevalue="-m"/> + </inputs> + <outputs> + <data format="tabular" hidden="false" name="default" label="Heterozygous regions in $in_file.name"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_hety.fa"/> + <param name="w" value="8"/> + <output name="default" file="seqtk_hety.out" ftype="tabular"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Reports on heterozygosity over a region + +:: + + >het_region + ACTTTACATCGAGCMMMMMMMACAGTACTG + +As can be seen in the following output: + +:: + + #chr start end A B num_het + het_region 0 8 0.00 8 0 + het_region 8 9 0.00 8 0 + het_region 9 10 0.00 8 0 + het_region 10 11 0.00 8 0 + het_region 11 12 0.00 8 0 + het_region 12 13 0.00 8 0 + het_region 13 14 0.00 8 0 + het_region 14 15 1.00 8 1 + het_region 15 16 2.00 8 2 + het_region 16 17 3.00 8 3 + het_region 17 18 4.00 8 4 + het_region 18 19 5.00 8 5 + het_region 19 20 6.00 8 6 + het_region 20 21 7.00 8 7 + het_region 21 22 7.00 8 7 + het_region 22 23 6.00 8 6 + het_region 23 24 5.00 8 5 + het_region 24 25 4.00 8 4 + het_region 25 26 3.00 8 3 + het_region 26 27 2.00 8 2 + het_region 27 28 1.00 8 1 + het_region 28 29 0.00 8 0 + het_region 29 30 0.00 1 0 + +If you know what A and B are measures of, please `submit an issue <https://github.com/galaxyproject/tools-iuc/issues>`__ and it will be corrected + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_listhet.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,47 @@ +<?xml version="1.0"?> +<tool id="seqtk_listhet" name="seqtk_listhet" version="@WRAPPER_VERSION@.0"> + <description>extract the position of each het</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk listhet $in_file | awk 'BEGIN{print "#chr\tposition\tbase"}1' > $default]]></command> + <inputs> + <expand macro="in_faq"/> + </inputs> + <outputs> + <data format="tabular" hidden="false" name="default" label="Positions of heterozygous bases in $in_file.name"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_listhet.fa"/> + <output name="default" file="seqtk_listhet.out" ftype="tabular"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Lists regions of heterozygosity. + +:: + + >ambig + ACGTMRWSYKVHDBN + +The seqtk suite recognises MRWSYK: + +:: + + #chr position base + ambig 5 M + ambig 6 R + ambig 7 W + ambig 8 S + ambig 9 Y + ambig 10 K + + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_mergefa.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,68 @@ +<?xml version="1.0"?> +<tool id="seqtk_mergefa" name="seqtk_mergefa" version="@WRAPPER_VERSION@.0"> + <description>merge two FASTA/Q files</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk mergefa -q $q +$i +$m +$r +$h + +$in_fa1 +$in_fa2 + +> $default]]></command> + <inputs> + <param name="in_fa1" type="data" format="fasta,fastq" label="Input FASTA/Q file #1"/> + <param name="in_fa2" type="data" format="fasta,fastq" label="Input FASTA/Q file #2"/> + <param label="quality threshold" help="(-q)" name="q" type="integer" value="0"/> + <param checked="false" label="take intersection" help="(-i)" name="i" type="boolean" falsevalue="" truevalue="-i"/> + <param checked="false" label="convert to lowercase when one of the input base is N" help="(-m)" name="m" type="boolean" falsevalue="" truevalue="-m"/> + <param checked="false" label="pick a random allele from het" help="(-r)" name="r" type="boolean" falsevalue="" truevalue="-r"/> + <param checked="false" label="suppress hets in the input" help="(-h)" name="h" type="boolean" falsevalue="" truevalue="-h"/> + </inputs> + <outputs> + <data format_source="in_fa1" hidden="false" name="default" label="Merger of $in_fa1.name and $in_fa2.name"/> + </outputs> + <tests> + <test> + <param name="in_fa1" value="seqtk_mergefa1.fa"/> + <param name="in_fa2" value="seqtk_mergefa2.fa"/> + <output name="default" file="seqtk_mergefa.out" ftype="fasta"/> + </test> + <test> + <param name="in_fa1" value="seqtk_mergefa1.fa"/> + <param name="in_fa2" value="seqtk_mergefa2.fa"/> + <param name="m" value="True" /> + <output name="default" file="seqtk_mergefa2.out" ftype="fasta"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Merges two fasta files, using ambiguity codes + +:: + + # seq1.fa + >test0 + ACTGACTGAAA + + # seq2.fa + >test0 + ACTGAMTGCGN + +In the following the `-m` option has been set to highlight seqtk-mergefa's features. + +:: + + >test0 + ACTGACTGxxa + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_mergepe.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,93 @@ +<?xml version="1.0"?> +<tool id="seqtk_mergepe" name="seqtk_mergepe" version="@WRAPPER_VERSION@.0"> + <description>interleave two unpaired FASTA/Q files for a paired-end file</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk mergepe + $in_fq1 + $in_fq2 +> $default]]></command> + <inputs> + <param name="in_fq1" type="data" format="fasta,fastq" label="Input FASTA/Q file #1"/> + <param name="in_fq2" type="data" format="fasta,fastq" label="Input FASTA/Q file #2"/> + </inputs> + <outputs> + <data format_source="in_fq1" hidden="false" name="default" label="$in_fq1.name and $in_fq2.name as interleaved paired-end"/> + </outputs> + <tests> + <test> + <param name="in_fq1" value="paired_dat1.fq"/> + <param name="in_fq2" value="paired_dat2.fq"/> + <output name="default" file="paired_dat.fq" ftype="fastq"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Merge two files which constitute a paired-end file into a single, interleaved, paired-end FASTA/Q file + +:: + + # r1.fq + @test-6/1 + AGCTTGACGC + + + ?.HCF@C>>F + + # r2.fq + @test-6/2 + TGCGAAGACC + + + >2?A?A@@7? + +will produce the following paired file: + +:: + + @test-6/1 + AGCTTGACGC + + + ?.HCF@C>>F + @test-6/2 + TGCGAAGACC + + + >2?A?A@@7? + +While this may not have been an illuminating example, it is important to note +that this tool will properly interleave data. For example if you have the ids: + +:: + + @r-1/1 + @r-2/1 + @r-3/1 + @r-4/1 + +and + +:: + + @r-1/2 + @r-2/2 + @r-3/2 + @r-4/2 + +These will be interleaved as + +:: + + @r-1/1 + @r-1/2 + @r-2/1 + @r-2/2 + @r-3/1 + @r-3/2 + @r-4/1 + @r-4/2 + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_mutfa.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,51 @@ +<?xml version="1.0"?> +<tool id="seqtk_mutfa" name="seqtk_mutfa" version="@WRAPPER_VERSION@.0"> + <description>point mutate FASTA at specified positions</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk mutfa + $in_file $in_snp +> $default]]></command> + <inputs> + <expand macro="in_faq"/> + <param name="in_snp" type="data" format="tabular" label="Input SNP file"/> + </inputs> + <outputs> + <data format_source="in_file" hidden="false" name="default" label="Mutated $in_file.name"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_mutfa.fa"/> + <param name="in_snp" value="seqtk_mutfa.snp"/> + <output name="default" file="seqtk_mutfa.out" ftype="fasta"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +the SNP inputs consist of 4 columns: chromosome, 1-based-pos, any, base-changed-to. + +:: + + # Input fasta + >test0 + ACTGACTGAA + + # Input SNP file + test0 1 . G + test0 4 . A + +This will effect the desired mutations in the output file + +:: + + # Output result + >test0 + GCTAACTGAA + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_randbase.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,45 @@ +<?xml version="1.0"?> +<tool id="seqtk_randbase" name="seqtk_randbase" version="@WRAPPER_VERSION@.0"> + <description>choose a random base from hets</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk randbase + $in_file +> $default]]></command> + <inputs> + <expand macro="in_faq"/> + </inputs> + <outputs> + <data format_source="in_file" hidden="false" name="default" label="Unambiguous $in_file.name"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_randbase.fa"/> + <output name="default" file="seqtk_randbase.out" ftype="fasta"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Randomly resolves ambiguous bases + +:: + + # Input fasta + >ambig + ACGTMRWSYK + +results in + +:: + + # Output result + >ambig + ACGTCGTGTT + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_sample.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,38 @@ +<?xml version="1.0"?> +<tool id="seqtk_sample" name="seqtk_sample" version="@WRAPPER_VERSION@.0"> + <description>random subsample of fasta or fastq sequences</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk sample -s $s + $in_file + $subsample_size +> $default]]></command> + <inputs> + <expand macro="in_faq" /> + <param label="RNG seed" help="(-s)" name="s" type="integer" value="4"/> + <param label="Subsample (decimal fraction or number)" name="subsample_size" type="integer" value="100"/> + </inputs> + <outputs> + <data format_source="in_file" hidden="false" name="default" label="Subsample of reads from $in_file.name"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_sample.fa"/> + <param name="subsample_size" value="4"/> + <param name="s" value="4"/> + <output name="default" file="seqtk_sample.out" ftype="fasta"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Takes a random subsample of fasta or fastq sequences. The RNG is seedable to allow for reproducible results, and defaults to `4 <http://xkcd.com/221/>`__. + +The subsample size can be a decimal fraction <=1, where 1 implies 100% of the reads should be used. If a number >1 is provided, that many reads will be taken from the dataset. + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_seq.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,76 @@ +<?xml version="1.0"?> +<tool id="seqtk_seq" name="seqtk_seq" version="@WRAPPER_VERSION@.0"> + <description>common transformation of FASTA/Q</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk seq -q $q +-X $X +#if $n and $n != "None" and $n is not None and $n != "": +-n "$n" +#end if +-l $l +-Q $Q +-s $s +-f $f +#if $M and $M != "None" and $M is not None and $M != "": +-M "$M" +#end if +-L $L +$c +$r +$A +$C +$N +$x1 +$x2 +$V + +$in_file +> $default]]></command> + <inputs> + <expand macro="in_faq"/> + <param label="mask bases with quality lower than INT" help="(-q)" name="q" type="integer" value="0"/> + <param label="mask bases with quality higher than INT" help="(-X)" name="X" type="integer" value="255"/> + <param area="false" default="0" label="masked bases converted to CHAR; 0 for lowercase" help="(-n)" name="n" type="text"/> + <param label="number of residues per line; 0 for 2^32-1" help="(-l)" name="l" type="integer" value="0"/> + <param label="quality shift: ASCII-INT gives base quality" help="(-Q)" name="Q" type="integer" value="33"/> + <param label="random seed" help="effective with -f (-s)" name="s" type="integer" value="11"/> + <param label="sample fraction of sequences" help="(-f)" name="f" type="float" value="1"/> + <param area="false" default="null" label="mask regions in BED or name list FILE" help="(-M)" name="M" type="text"/> + <param label="drop sequences with length shorter than INT" help="(-L)" name="L" type="integer" value="0"/> + <param checked="false" label="mask complement region" help="effective with -M (-c)" name="c" type="boolean" falsevalue="" truevalue="-c"/> + <param checked="false" label="reverse complement" help="(-r)" name="r" type="boolean" falsevalue="" truevalue="-r"/> + <param checked="false" label="force FASTA output (discard quality)" help="(-A)" name="A" type="boolean" falsevalue="" truevalue="-A"/> + <param checked="false" label="drop comments at the header lines" help="(-C)" name="C" type="boolean" falsevalue="" truevalue="-C"/> + <param checked="false" label="drop sequences containing ambiguous bases" help="(-N)" name="N" type="boolean" falsevalue="" truevalue="-N"/> + <param checked="false" label="output the 2n-1 reads only" help="(-1)" name="x1" type="boolean" falsevalue="" truevalue="-1"/> + <param checked="false" label="output the 2n reads only" help="(-2)" name="x2" type="boolean" falsevalue="" truevalue="-2"/> + <param checked="false" label="shift quality by '(-Q) - 33' " help="(-V)" name="V" type="boolean" falsevalue="" truevalue="-V"/> + </inputs> + <outputs> + <data format_source="in_file" hidden="false" name="default"/> + </outputs> + <tests> + <test> + <!-- This is a sorry excuse for a test for a tool which does way more + than it should, but upstream decided to put a TON of functionality + into a single tool rather than using the single responsibility + principle. --> + <param name="in_file" value="seqtk_seq.fa"/> + <param name="r" value="True"/> + <param name="n" value=""/> + <param name="M" value=""/> + <output name="default" file="seqtk_seq_revcom.fa" ftype="fasta"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Various utilities for transforming FASTA/Q data + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_subseq.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,83 @@ +<?xml version="1.0"?> +<tool id="seqtk_subseq" name="seqtk_subseq" version="@WRAPPER_VERSION@.0"> + <description>extract subsequences from FASTA/Q files</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk subseq $t +-l $l +$in_file + +#if $source.type == 'bed': + $in_bed +#else + $name_list +#end if + +#if $t == '-t': + | awk 'BEGIN{print "chr\tunknown\tseq"}1' +#end if + +> $default]]></command> + <inputs> + <param name="in_file" type="data" format="fasta,fastq" label="Input fasta/q file"/> + <conditional name="source"> + <param name="type" type="select" label="Select source of sequence choices"> + <option value="bed">BED</option> + <option value="name">FASTA/Q ID list</option> + </param> + <when value="bed"> + <param name="in_bed" type="data" format="bed" label="Input BED file"/> + </when> + <when value="name"> + <param name="name_list" type="data" format="txt" label="Input fasta file"/> + </when> + </conditional> + <param label="TAB delimited output" help="(-t)" name="t" type="boolean" falsevalue="" truevalue="-t"/> + <param label="sequence line length" help="(-l)" name="l" type="integer" value="0"/> + </inputs> + <outputs> + <data format_source="in_file" hidden="false" name="default" label="Selected sequences from $in_file.name"> + <change_format> + <when input="t" value="-t" format="tabular"/> + </change_format> + </data> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_subseq.fa"/> + <param name="type" value="name"/> + <param name="t" value="False" /> + <param name="name_list" value="seqtk_subseq_list.txt"/> + <output name="default" file="seqtk_subseq.out" ftype="fasta"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Given a list of newline separated IDs from a fasta file, this will extract those named fasta sequences from the input file. + +:: + + # Input ID list + seq1 + + # Input fasta + >seq1 + ACGTMRWSYK + >seq2 + RWSYKACGTM + +results in + +:: + + # Output result + >seq1 + ACGTMRWSYK + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/seqtk_trimfq.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,62 @@ +<?xml version="1.0"?> +<tool id="seqtk_trimfq" name="seqtk_trimfq" version="@WRAPPER_VERSION@.0"> + <description>trim FASTQ using the Phred algorithm</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[seqtk trimfq +#if $mode.mode_select == "quality": +-q $mode.q +-l $mode.l +#else: +-b $mode.b +-e $mode.e +#end if +$in_file +> $default]]></command> + <inputs> + <expand macro="in_faq"/> + <conditional name="mode"> + <param name="mode_select" type="select" label="Mode for trimming FASTQ File"> + <option value="quality">Quality</option> + <option value="position">Length/Position</option> + </param> + <when value="quality"> + <param label="error rate threshold" help="(-q)" name="q" type="float" value="0.05"/> + <param label="maximally trim down to INT bp" help="(-l)" name="l" type="integer" value="30"/> + </when> + <when value="position"> + <param label="trim INT bp from left" help="(-b)" name="b" type="integer" value="0"/> + <param label="trim INT bp from right" help="(-e)" name="e" type="integer" value="0"/> + </when> + </conditional> + </inputs> + <outputs> + <data format_source="in_file" hidden="false" name="default" label="$in_file.name trimmed"/> + </outputs> + <tests> + <test> + <param name="in_file" value="seqtk_trimfq.fq"/> + <param name="mode_select" value="quality"/> + <param name="q" value="0.05"/> + <param name="l" value="30"/> + <output name="default" file="seqtk_trimfq_default.fq" ftype="fastq"/> + </test> + <test> + <param name="in_file" value="seqtk_trimfq.fq"/> + <param name="mode_select" value="position"/> + <param name="b" value="5"/> + <param name="e" value="5"/> + <output name="default" file="seqtk_trimfq_be.fq" ftype="fastq"/> + </test> + </tests> + <help><![CDATA[ +**What it does** + +Trim a fastq file based on Phred scores, or by length + +@ATTRIBUTION@ +]]></help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/paired_dat.fq Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,24 @@ +@test-6/1 +AGCTTGACGC ++ +?.HCF@C>>F +@test-6/2 +TGCGAAGACC ++ +>2?A?A@@7? +@test-4/1 +CTTGACGCTG ++ +I@>3EFCG@C +@test-4/2 +TGCGAAGACC ++ +A?A@@B@<BC +@test-2/1 +AGACCAAAAT ++ +??><6E?IFC +@test-2/2 +CTGGCGAATT ++ +?=?*?A?<?@
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/paired_dat1.fq Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,12 @@ +@test-6/1 +AGCTTGACGC ++ +?.HCF@C>>F +@test-4/1 +CTTGACGCTG ++ +I@>3EFCG@C +@test-2/1 +AGACCAAAAT ++ +??><6E?IFC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/paired_dat2.fq Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,12 @@ +@test-6/2 +TGCGAAGACC ++ +>2?A?A@@7? +@test-4/2 +TGCGAAGACC ++ +A?A@@B@<BC +@test-2/2 +CTGGCGAATT ++ +?=?*?A?<?@
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_comp.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,5 @@ +>test0 +ACTGACTGAA +>ambig_ref +ACGTCGTGTTVHDBN +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_comp.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,3 @@ +#chr length #A #C #G #T #2 #3 #4 #CpG #tv #ts #CpG-ts +test0 10 4 2 2 2 0 0 0 0 0 0 0 +ambig_ref 15 1 2 3 4 0 4 1 4 0 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_cutn.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,3 @@ +>test +AACTGATCGATCGATCGNNNNNNNNNNNACATG +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_cutn.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,4 @@ +>test:1-17 +AACTGATCGATCGATCG +>test:29-33 +ACATG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_dropse.fq Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,20 @@ +@test-6/1 +AGCTTGACGC ++ +?.HCF@C>>F +@test-6/2 +TGCGAAGACC ++ +>2?A?A@@7? +@test-4/2 +TGCGAAGACC ++ +A?A@@B@<BC +@test-2/1 +AGACCAAAAT ++ +??><6E?IFC +@test-2/2 +CTGGCGAATT ++ +?=?*?A?<?@
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_dropse.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,16 @@ +@test-6/1 +AGCTTGACGC ++ +?.HCF@C>>F +@test-6/2 +TGCGAAGACC ++ +>2?A?A@@7? +@test-2/1 +AGACCAAAAT ++ +??><6E?IFC +@test-2/2 +CTGGCGAATT ++ +?=?*?A?<?@
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_fqchk.fq Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,4 @@ +@SEQ_ID1 +GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT ++ +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_fqchk.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,63 @@ +#min_len: 60; max_len: 60; avg_len: 60.00; 15 distinct quality values +#POS #bases %A %C %G %T %N avgQ errQ %low %high +#ALL 60 31.7 16.7 18.3 33.3 0.0 15.1 8.7 66.7 33.3 +1 1 0.0 0.0 100.0 0.0 0.0 0.0 3.0 100.0 0.0 +2 1 100.0 0.0 0.0 0.0 0.0 6.0 6.0 100.0 0.0 +3 1 0.0 0.0 0.0 100.0 0.0 6.0 6.0 100.0 0.0 +4 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 +5 1 0.0 0.0 0.0 100.0 0.0 7.0 7.0 100.0 0.0 +6 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 +7 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 +8 1 0.0 0.0 100.0 0.0 0.0 7.0 7.0 100.0 0.0 +9 1 0.0 0.0 100.0 0.0 0.0 9.0 9.0 100.0 0.0 +10 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 +11 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 +12 1 0.0 100.0 0.0 0.0 0.0 10.0 10.0 100.0 0.0 +13 1 100.0 0.0 0.0 0.0 0.0 8.0 8.0 100.0 0.0 +14 1 100.0 0.0 0.0 0.0 0.0 8.0 8.0 100.0 0.0 +15 1 100.0 0.0 0.0 0.0 0.0 4.0 4.0 100.0 0.0 +16 1 0.0 0.0 100.0 0.0 0.0 4.0 4.0 100.0 0.0 +17 1 0.0 100.0 0.0 0.0 0.0 4.0 4.0 100.0 0.0 +18 1 100.0 0.0 0.0 0.0 0.0 10.0 10.0 100.0 0.0 +19 1 0.0 0.0 100.0 0.0 0.0 10.0 10.0 100.0 0.0 +20 1 0.0 0.0 0.0 100.0 0.0 8.0 8.0 100.0 0.0 +21 1 100.0 0.0 0.0 0.0 0.0 7.0 7.0 100.0 0.0 +22 1 0.0 0.0 0.0 100.0 0.0 4.0 4.0 100.0 0.0 +23 1 0.0 100.0 0.0 0.0 0.0 4.0 4.0 100.0 0.0 +24 1 0.0 0.0 100.0 0.0 0.0 4.0 4.0 100.0 0.0 +25 1 100.0 0.0 0.0 0.0 0.0 4.0 4.0 100.0 0.0 +26 1 0.0 0.0 0.0 100.0 0.0 8.0 8.0 100.0 0.0 +27 1 0.0 100.0 0.0 0.0 0.0 13.0 13.0 100.0 0.0 +28 1 100.0 0.0 0.0 0.0 0.0 16.0 16.0 100.0 0.0 +29 1 100.0 0.0 0.0 0.0 0.0 9.0 9.0 100.0 0.0 +30 1 100.0 0.0 0.0 0.0 0.0 9.0 9.0 100.0 0.0 +31 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 +32 1 100.0 0.0 0.0 0.0 0.0 12.0 12.0 100.0 0.0 +33 1 0.0 0.0 100.0 0.0 0.0 10.0 10.0 100.0 0.0 +34 1 0.0 0.0 0.0 100.0 0.0 9.0 9.0 100.0 0.0 +35 1 100.0 0.0 0.0 0.0 0.0 6.0 6.0 100.0 0.0 +36 1 100.0 0.0 0.0 0.0 0.0 6.0 6.0 100.0 0.0 +37 1 100.0 0.0 0.0 0.0 0.0 8.0 8.0 100.0 0.0 +38 1 0.0 0.0 0.0 100.0 0.0 8.0 8.0 100.0 0.0 +39 1 0.0 100.0 0.0 0.0 0.0 9.0 9.0 100.0 0.0 +40 1 0.0 100.0 0.0 0.0 0.0 9.0 9.0 100.0 0.0 +41 1 100.0 0.0 0.0 0.0 0.0 20.0 20.0 0.0 100.0 +42 1 0.0 0.0 0.0 100.0 0.0 20.0 20.0 0.0 100.0 +43 1 0.0 0.0 0.0 100.0 0.0 34.0 34.0 0.0 100.0 +44 1 0.0 0.0 0.0 100.0 0.0 34.0 34.0 0.0 100.0 +45 1 0.0 0.0 100.0 0.0 0.0 37.0 37.0 0.0 100.0 +46 1 0.0 0.0 0.0 100.0 0.0 29.0 29.0 0.0 100.0 +47 1 0.0 0.0 0.0 100.0 0.0 29.0 29.0 0.0 100.0 +48 1 0.0 100.0 0.0 0.0 0.0 29.0 29.0 0.0 100.0 +49 1 100.0 0.0 0.0 0.0 0.0 29.0 29.0 0.0 100.0 +50 1 100.0 0.0 0.0 0.0 0.0 29.0 29.0 0.0 100.0 +51 1 0.0 100.0 0.0 0.0 0.0 29.0 29.0 0.0 100.0 +52 1 0.0 0.0 0.0 100.0 0.0 34.0 34.0 0.0 100.0 +53 1 0.0 100.0 0.0 0.0 0.0 34.0 34.0 0.0 100.0 +54 1 100.0 0.0 0.0 0.0 0.0 34.0 34.0 0.0 100.0 +55 1 0.0 100.0 0.0 0.0 0.0 34.0 34.0 0.0 100.0 +56 1 100.0 0.0 0.0 0.0 0.0 34.0 34.0 0.0 100.0 +57 1 0.0 0.0 100.0 0.0 0.0 34.0 34.0 0.0 100.0 +58 1 0.0 0.0 0.0 100.0 0.0 34.0 34.0 0.0 100.0 +59 1 0.0 0.0 0.0 100.0 0.0 21.0 21.0 0.0 100.0 +60 1 0.0 0.0 0.0 100.0 0.0 20.0 20.0 0.0 100.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_hety.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,3 @@ +>het_region +ACTTTACATCGAGCMMMMMMMACAGTACTG +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_hety.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,24 @@ +#chr start end A B num_het +het_region 0 8 0.00 8 0 +het_region 8 9 0.00 8 0 +het_region 9 10 0.00 8 0 +het_region 10 11 0.00 8 0 +het_region 11 12 0.00 8 0 +het_region 12 13 0.00 8 0 +het_region 13 14 0.00 8 0 +het_region 14 15 1.00 8 1 +het_region 15 16 2.00 8 2 +het_region 16 17 3.00 8 3 +het_region 17 18 4.00 8 4 +het_region 18 19 5.00 8 5 +het_region 19 20 6.00 8 6 +het_region 20 21 7.00 8 7 +het_region 21 22 7.00 8 7 +het_region 22 23 6.00 8 6 +het_region 23 24 5.00 8 5 +het_region 24 25 4.00 8 4 +het_region 25 26 3.00 8 3 +het_region 26 27 2.00 8 2 +het_region 27 28 1.00 8 1 +het_region 28 29 0.00 8 0 +het_region 29 30 0.00 1 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_listhet.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,3 @@ +>ambig +ACGTMRWSYKVHDBN +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_listhet.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,7 @@ +#chr position base +ambig 5 M +ambig 6 R +ambig 7 W +ambig 8 S +ambig 9 Y +ambig 10 K
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_mergefa.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>test0 +ACTGAMTGMRN
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_mergefa1.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>test0 +ACTGACTGAAA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_mergefa2.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>test0 +ACTGAMTGCGN
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_mergefa2.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>test0 +ACTGACTGxxa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_mutfa.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>test0 +ACTGACTGAA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_mutfa.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>test0 +GCTAACTGAA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_mutfa.snp Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +test0 1 . G +test0 4 . A
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_randbase.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>ambig +ACGTMRWSYK
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_randbase.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>ambig +ACGTCGTGTT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_sample.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,27 @@ +>seq0 +AAAAAAAAAA +AAAAAAAAAA +>seq1 +TTTTTTTTTT +TTTTTTTTTT +>seq2 +CCCCCCCCCC +CCCCCCCCCC +>seq3 +GGGGGGGGGG +GGGGGGGGGG +>seq4 +AAAAAAAAAA +TTTTTTTTTT +>seq5 +AAAAAAAAAA +CCCCCCCCCC +>seq6 +AAAAAAAAAA +GGGGGGGGGG +>seq7 +TTTTTTTTTT +CCCCCCCCCC +>seq8 +TTTTTTTTTT +GGGGGGGGGG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_sample.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,8 @@ +>seq7 +TTTTTTTTTTCCCCCCCCCC +>seq1 +TTTTTTTTTTTTTTTTTTTT +>seq4 +AAAAAAAAAATTTTTTTTTT +>seq3 +GGGGGGGGGGGGGGGGGGGG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_seq.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,3 @@ +>test +AACTGATCGATCGATCGNNNNNNNNNNNACATG +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_seq_revcom.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>test +CATGTNNNNNNNNNNNCGATCGATCGATCAGTT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_subseq.fa Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,4 @@ +>seq1 +ACGTMRWSYK +>seq2 +RWSYKACGTM
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_subseq.out Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,2 @@ +>seq1 +ACGTMRWSYK
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_subseq_list.txt Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,1 @@ +seq1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_trimfq.fq Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,4 @@ +@SEQ_ID1 +GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT ++ +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_trimfq_be.fq Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,4 @@ +@SEQ_ID1 +GGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCAC ++ +(((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/seqtk_trimfq_default.fq Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,4 @@ +@SEQ_ID1 +TAGTAAATCCATTTGTTCAACTCACAGTTT ++ +*-+*''))**55CCF>>>>>>CCCCCCC65
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Tue Apr 28 22:56:42 2015 -0400 @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="seqtk" version="1.0-r75-dirty"> + <repository changeset_revision="f059064a6de2" name="package_seqtk_1_0_r75" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>
