Mercurial > repos > iuc > msa_datatypes
annotate test-data/1.stockholm @ 0:ba3eba35a79d draft default tip
Uploaded
| author | iuc |
|---|---|
| date | Sun, 08 Sep 2013 05:07:09 -0400 |
| parents | |
| children |
| rev | line source |
|---|---|
| 0 | 1 # STOCKHOLM 1.0 |
| 2 #=GF ID UPSK | |
| 3 #=GF SE Predicted; Infernal | |
| 4 #=GF SS Published; PMID 9223489 | |
| 5 #=GF RN [1] | |
| 6 #=GF RM 9223489 | |
| 7 #=GF RT The role of the pseudoknot at the 3' end of turnip yellow mosaic | |
| 8 #=GF RT virus RNA in minus-strand synthesis by the viral RNA-dependent RNA | |
| 9 #=GF RT polymerase. | |
| 10 #=GF RA Deiman BA, Kortlever RM, Pleij CW; | |
| 11 #=GF RL J Virol 1997;71:5990-5996. | |
| 12 | |
| 13 AF035635.1/619-641 UGAGUUCUCGAUCUCUAAAAUCG | |
| 14 M24804.1/82-104 UGAGUUCUCUAUCUCUAAAAUCG | |
| 15 J04373.1/6212-6234 UAAGUUCUCGAUCUUUAAAAUCG | |
| 16 M24803.1/1-23 UAAGUUCUCGAUCUCUAAAAUCG | |
| 17 #=GC SS_cons .AAA....<<<<aaa....>>>> | |
| 18 // |