Mercurial > repos > drosofff > msp_sr_bowtie
changeset 1:b50d7228b678 draft
Uploaded
| author | mvdbeek | 
|---|---|
| date | Sun, 29 Mar 2015 10:25:36 -0400 | 
| parents | 64064dccdb11 | 
| children | 316124e85b8d | 
| files | sRbowtie.py sRbowtie.xml test-data/297_reference.fa test-data/input.fa test-data/input.fastq test-data/output.bam test-data/output2.bam test-data/sRbowtie.fa test-data/sRbowtie.out tool_dependencies.xml | 
| diffstat | 10 files changed, 419 insertions(+), 246 deletions(-) [+] | 
line wrap: on
 line diff
--- a/sRbowtie.py Mon Nov 03 10:24:38 2014 -0500 +++ b/sRbowtie.py Sun Mar 29 10:25:36 2015 -0400 @@ -5,119 +5,185 @@ # current rev: for bowtie __norc, move from --supress 2,6,7,8 to --supress 6,7,8. Future Parser must be updated to take into account this standardisation # Christophe Antoniewski <drosofff@gmail.com> -import sys, os, subprocess, tempfile, shutil, argparse +import sys +import os +import subprocess +import tempfile +import shutil +import argparse + def Parser(): - the_parser = argparse.ArgumentParser(description="bowtie wrapper for small fasta reads") - the_parser.add_argument('--input', action="store", type=str, help="input fasta file") - the_parser.add_argument('--method', action="store", type=str, help="RNA, unique, multiple, k_option, n_option, a_option") - the_parser.add_argument('--v-mismatches', dest="v_mismatches", action="store", type=str, help="number of mismatches allowed for the alignments") - the_parser.add_argument('--output-format', dest="output_format", action="store", type=str, help="tabular, sam, bam") - the_parser.add_argument('--output', action="store", type=str, help="output file path") - the_parser.add_argument('--index-from', dest="index_from", action="store", type=str, help="indexed or history") - the_parser.add_argument('--index-source', dest="index_source", action="store", type=str, help="file path to the index source") - the_parser.add_argument('--aligned', action="store", type=str, help="aligned read file path, maybe None") - the_parser.add_argument('--unaligned', action="store", type=str, help="unaligned read file path, maybe None") - the_parser.add_argument('--num-threads', dest="num_threads", action="store", type=str, help="number of bowtie threads") - args = the_parser.parse_args() - return args + the_parser = argparse.ArgumentParser( + description="bowtie wrapper for small fasta reads") + the_parser.add_argument( + '--input', action="store", type=str, help="input file") + the_parser.add_argument( + '--input-format', dest="input_format", action="store", type=str, help="fasta or fastq") + the_parser.add_argument('--method', action="store", type=str, + help="RNA, unique, multiple, k_option, n_option, a_option") + the_parser.add_argument('--v-mismatches', dest="v_mismatches", action="store", + type=str, help="number of mismatches allowed for the alignments") + the_parser.add_argument( + '--output-format', dest="output_format", action="store", type=str, help="tabular, sam, bam") + the_parser.add_argument( + '--output', action="store", type=str, help="output file path") + the_parser.add_argument( + '--index-from', dest="index_from", action="store", type=str, help="indexed or history") + the_parser.add_argument('--index-source', dest="index_source", + action="store", type=str, help="file path to the index source") + the_parser.add_argument( + '--aligned', action="store", type=str, help="aligned read file path, maybe None") + the_parser.add_argument('--unaligned', action="store", + type=str, help="unaligned read file path, maybe None") + the_parser.add_argument('--num-threads', dest="num_threads", + action="store", type=str, help="number of bowtie threads") + args = the_parser.parse_args() + return args -def stop_err( msg ): - sys.stderr.write( '%s\n' % msg ) + +def stop_err(msg): + sys.stderr.write('%s\n' % msg) sys.exit() -def bowtieCommandLiner (alignment_method="RNA", v_mis="1", out_type="tabular", aligned="None", unaligned="None", input="path", index="path", output="path", pslots="4"): - if alignment_method=="RNA": - x = "-v %s -M 1 --best --strata -p %s --norc --suppress 6,7,8" % (v_mis, pslots) - elif alignment_method=="unique": - x = "-v %s -m 1 -p %s --suppress 6,7,8" % (v_mis, pslots) - elif alignment_method=="multiple": - x = "-v %s -M 1 --best --strata -p %s --suppress 6,7,8" % (v_mis, pslots) - elif alignment_method=="k_option": + +def bowtieCommandLiner(alignment_method="RNA", v_mis="1", out_type="tabular", + aligned="None", unaligned="None", input_format="fasta", input="path", + index="path", output="path", pslots="4"): + if input_format == "fasta": + input_format = "-f" + elif input_format == "fastq": + input_format = "-q" + else: + raise Exception('input format must be one of fasta or fastq') + if alignment_method == "RNA": + x = "-v %s -M 1 --best --strata -p %s --norc --suppress 6,7,8" % ( + v_mis, pslots) + elif alignment_method == "unique": + x = "-v %s -m 1 -p %s --suppress 6,7,8" % (v_mis, pslots) + elif alignment_method == "multiple": + x = "-v %s -M 1 --best --strata -p %s --suppress 6,7,8" % ( + v_mis, pslots) + elif alignment_method == "k_option": x = "-v %s -k 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots) - elif alignment_method=="n_option": + elif alignment_method == "n_option": x = "-n %s -M 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots) - elif alignment_method=="a_option": + elif alignment_method == "a_option": x = "-v %s -a --best -p %s --suppress 6,7,8" % (v_mis, pslots) - if aligned == "None" and unaligned == "None": fasta_command = "" - elif aligned != "None" and unaligned == "None": fasta_command= " --al %s" % aligned - elif aligned == "None" and unaligned != "None": fasta_command = " --un %s" % unaligned - else: fasta_command = " --al %s --un %s" % (aligned, unaligned) + if aligned == "None" and unaligned == "None": + fasta_command = "" + elif aligned != "None" and unaligned == "None": + fasta_command = " --al %s" % aligned + elif aligned == "None" and unaligned != "None": + fasta_command = " --un %s" % unaligned + else: + fasta_command = " --al %s --un %s" % (aligned, unaligned) x = x + fasta_command if out_type == "tabular": - return "bowtie %s %s -f %s > %s" % (x, index, input, output) - elif out_type=="sam": - return "bowtie %s -S %s -f %s > %s" % (x, index, input, output) - elif out_type=="bam": - return "bowtie %s -S %s -f %s |samtools view -bS - > %s" % (x, index, input, output) + return "bowtie %s %s %s %s > %s" % (x, index, input_format, input, output) + elif out_type == "sam": + return "bowtie %s -S %s %s %s > %s" % (x, index, input_format, input, output) + elif out_type == "bam": + return "bowtie %s -S %s %s %s |samtools view -bS - > %s" % ( + x, index, input_format, input, output) + def bowtie_squash(fasta): - tmp_index_dir = tempfile.mkdtemp() # make temp directory for bowtie indexes - ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir ) - ref_file_name = ref_file.name - ref_file.close() # by default, delete the temporary file, but ref_file.name is now stored in ref_file_name - os.symlink( fasta, ref_file_name ) # symlink between the fasta source file and the deleted ref_file name - cmd1 = 'bowtie-build -f %s %s' % (ref_file_name, ref_file_name ) # bowtie command line, which will work after changing dir (cwd=tmp_index_dir) - try: - FNULL = open(os.devnull, 'w') - tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name # a path string for a temp file in tmp_index_dir. Just a string - tmp_stderr = open( tmp, 'wb' ) # creates and open a file handler pointing to the temp file - proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=FNULL, stdout=FNULL ) # both stderr and stdout of bowtie-build are redirected in dev/null - returncode = proc.wait() - tmp_stderr.close() - FNULL.close() - sys.stdout.write(cmd1 + "\n") - except Exception, e: - # clean up temp dir - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - stop_err( 'Error indexing reference sequence\n' + str( e ) ) - # no Cleaning if no Exception, tmp_index_dir has to be cleaned after bowtie_alignment() - index_full_path = os.path.join(tmp_index_dir, ref_file_name) # bowtie fashion path without extention - return tmp_index_dir, index_full_path - + # make temp directory for bowtie indexes + tmp_index_dir = tempfile.mkdtemp() + ref_file = tempfile.NamedTemporaryFile(dir=tmp_index_dir) + ref_file_name = ref_file.name + # by default, delete the temporary file, but ref_file.name is now stored + # in ref_file_name + ref_file.close() + # symlink between the fasta source file and the deleted ref_file name + os.symlink(fasta, ref_file_name) + # bowtie command line, which will work after changing dir + # (cwd=tmp_index_dir) + cmd1 = 'bowtie-build -f %s %s' % (ref_file_name, ref_file_name) + try: + FNULL = open(os.devnull, 'w') + # a path string for a temp file in tmp_index_dir. Just a string + tmp = tempfile.NamedTemporaryFile(dir=tmp_index_dir).name + # creates and open a file handler pointing to the temp file + tmp_stderr = open(tmp, 'wb') + # both stderr and stdout of bowtie-build are redirected in dev/null + proc = subprocess.Popen( + args=cmd1, shell=True, cwd=tmp_index_dir, stderr=FNULL, stdout=FNULL) + returncode = proc.wait() + tmp_stderr.close() + FNULL.close() + sys.stdout.write(cmd1 + "\n") + except Exception as e: + # clean up temp dir + if os.path.exists(tmp_index_dir): + shutil.rmtree(tmp_index_dir) + stop_err('Error indexing reference sequence\n' + str(e)) + # no Cleaning if no Exception, tmp_index_dir has to be cleaned after + # bowtie_alignment() + # bowtie fashion path without extention + index_full_path = os.path.join(tmp_index_dir, ref_file_name) + return tmp_index_dir, index_full_path + + def bowtie_alignment(command_line, flyPreIndexed=''): - # make temp directory just for stderr - tmp_index_dir = tempfile.mkdtemp() - tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name - tmp_stderr = open( tmp, 'wb' ) - # conditional statement for sorted bam generation viewable in Trackster - if "samtools" in command_line: - target_file = command_line.split()[-1] # recover the final output file name - path_to_unsortedBam = os.path.join(tmp_index_dir, "unsorted.bam") - path_to_sortedBam = os.path.join(tmp_index_dir, "unsorted.bam.sorted") - first_command_line = " ".join(command_line.split()[:-3]) + " -o " + path_to_unsortedBam + " - " - # example: bowtie -v 0 -M 1 --best --strata -p 12 --suppress 6,7,8 -S /home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49 -f /home/galaxy/galaxy-dist/database/files/003/dataset_3460.dat |samtools view -bS -o /tmp/tmp_PgMT0/unsorted.bam - - second_command_line = "samtools sort %s %s" % (path_to_unsortedBam, path_to_sortedBam) # generates an "unsorted.bam.sorted.bam file", NOT an "unsorted.bam.sorted" file - p = subprocess.Popen(args=first_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) # fileno() method return the file descriptor number of tmp_stderr - returncode = p.wait() - sys.stdout.write("%s\n" % first_command_line + str(returncode)) - p = subprocess.Popen(args=second_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) - returncode = p.wait() - sys.stdout.write("\n%s\n" % second_command_line + str(returncode)) - if os.path.isfile(path_to_sortedBam + ".bam"): - shutil.copy2(path_to_sortedBam + ".bam", target_file) - else: - p = subprocess.Popen(args=command_line, shell=True, stderr=tmp_stderr.fileno()) - returncode = p.wait() - sys.stdout.write(command_line + "\n") - tmp_stderr.close() - ## cleaning if the index was created in the fly - if os.path.exists( flyPreIndexed ): - shutil.rmtree( flyPreIndexed ) - # cleaning tmp files and directories - if os.path.exists( tmp_index_dir ): - shutil.rmtree( tmp_index_dir ) - return + # make temp directory just for stderr + tmp_index_dir = tempfile.mkdtemp() + tmp = tempfile.NamedTemporaryFile(dir=tmp_index_dir).name + tmp_stderr = open(tmp, 'wb') + # conditional statement for sorted bam generation viewable in Trackster + if "samtools" in command_line: + # recover the final output file name + target_file = command_line.split()[-1] + path_to_unsortedBam = os.path.join(tmp_index_dir, "unsorted.bam") + path_to_sortedBam = os.path.join(tmp_index_dir, "unsorted.bam.sorted") + first_command_line = " ".join( + command_line.split()[:-3]) + " -o " + path_to_unsortedBam + " - " + # example: bowtie -v 0 -M 1 --best --strata -p 12 --suppress 6,7,8 -S + # /home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49 -f + # /home/galaxy/galaxy-dist/database/files/003/dataset_3460.dat + # |samtools view -bS -o /tmp/tmp_PgMT0/unsorted.bam - + # generates an "unsorted.bam.sorted.bam file", NOT an + # "unsorted.bam.sorted" file + second_command_line = "samtools sort %s %s" % ( + path_to_unsortedBam, path_to_sortedBam) + # fileno() method return the file descriptor number of tmp_stderr + p = subprocess.Popen( + args=first_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) + returncode = p.wait() + sys.stdout.write("%s\n" % first_command_line + str(returncode)) + p = subprocess.Popen( + args=second_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) + returncode = p.wait() + sys.stdout.write("\n%s\n" % second_command_line + str(returncode)) + if os.path.isfile(path_to_sortedBam + ".bam"): + shutil.copy2(path_to_sortedBam + ".bam", target_file) + else: + p = subprocess.Popen( + args=command_line, shell=True, stderr=tmp_stderr.fileno()) + returncode = p.wait() + sys.stdout.write(command_line + "\n") + tmp_stderr.close() + # cleaning if the index was created in the fly + if os.path.exists(flyPreIndexed): + shutil.rmtree(flyPreIndexed) + # cleaning tmp files and directories + if os.path.exists(tmp_index_dir): + shutil.rmtree(tmp_index_dir) + return + def __main__(): - args = Parser() - F = open (args.output, "w") - if args.index_from == "history": - tmp_dir, index_path = bowtie_squash(args.index_source) - else: - tmp_dir, index_path = "dummy/dymmy", args.index_source - command_line = bowtieCommandLiner(args.method, args.v_mismatches, args.output_format, args.aligned, args.unaligned, args.input, index_path, args.output, args.num_threads) - bowtie_alignment(command_line, flyPreIndexed=tmp_dir) - F.close() -if __name__=="__main__": __main__() + args = Parser() + F = open(args.output, "w") + if args.index_from == "history": + tmp_dir, index_path = bowtie_squash(args.index_source) + else: + tmp_dir, index_path = "dummy/dymmy", args.index_source + command_line = bowtieCommandLiner(args.method, args.v_mismatches, args.output_format, + args.aligned, args.unaligned, args.input_format, args.input, + index_path, args.output, args.num_threads) + bowtie_alignment(command_line, flyPreIndexed=tmp_dir) + F.close() +if __name__ == "__main__": + __main__()
--- a/sRbowtie.xml Mon Nov 03 10:24:38 2014 -0500 +++ b/sRbowtie.xml Sun Mar 29 10:25:36 2015 -0400 @@ -1,11 +1,11 @@ <tool id="bowtieForSmallRNA" name="sRbowtie" version="1.1.0"> - <description>for FASTA small reads</description> - <requirements> - <requirement type="package" version="0.12.7">bowtie</requirement> + <description>for FASTA small reads</description> + <requirements> + <requirement type="package" version="0.12.7">bowtie</requirement> <requirement type="package" version="0.1.18">samtools</requirement> - </requirements> - <parallelism method="basic"></parallelism> - <command interpreter="python"> sRbowtie.py --input $input + </requirements> + <command interpreter="python"> sRbowtie.py --input $input + --input-format $input.extension --method $method --v-mismatches $v_mismatches --output-format $output_format @@ -22,101 +22,102 @@ --unaligned $unaligned --num-threads \${GALAXY_SLOTS:-4} ## number of processors to be handled by bowtie </command> - <inputs> - <param name="input" type="data" format="fasta" label="Input fasta file: reads clipped from their adapter" help="Only with clipped, raw fasta files"/> -<!-- which method will be used --> - <param name="method" type="select" label="What kind of matching do you want to do?" help="bowtie parameters adjusted to the type of matching. RNA option match to only one strand"> - <option value="RNA">Match on sense strand RNA reference index, multiple mappers randomly matched at a single position</option> - <option value="unique">Match unique mappers on DNA reference index</option> - <option value="multiple" selected="true">Match on DNA, multiple mappers randomly matched at a single position</option> - <option value="k_option">Match on DNA as fast as possible, without taking care of mapping issues (for raw annotation of reads)</option> - <option value="n_option">Match on DNA - RNAseq mode (-n bowtie option)</option> - <option value="a_option">Match and report all valid alignments</option> - </param> -<!-- END of which method will be used --> - <param name="v_mismatches" type="select" label="Number of mismatches allowed" help="specify the -v bowtie option"> - <option value="0">0</option> - <option value="1" selected="true">1</option> - <option value="2">2</option> - <option value="3">3</option> - </param> -<!-- bowtie index selection --> - <conditional name="refGenomeSource"> - <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> - <option value="indexed">Use a built-in index</option> - <option value="history">Use one from the history</option> - </param> - <when value="indexed"> - <param name="index" type="select" label="Select a DNA reference index" help="if your genome of interest is not listed - contact GED team"> - <options from_data_table="bowtie_indexes"> - <!-- <filter type="sort_by" column="2" /> - <validator type="no_options" message="No indexes are available" /> --> + <inputs> + <param format="fasta, fastq" help="Only with clipped, raw fasta files" label="Input fasta file: reads clipped from their adapter" name="input" type="data" /> + <param help="bowtie parameters adjusted to the type of matching. RNA option match to only one strand" label="What kind of matching do you want to do?" name="method" type="select"> + <option value="RNA">Match on sense strand RNA reference index, multiple mappers randomly matched at a single position</option> + <option value="unique">Match unique mappers on DNA reference index</option> + <option selected="true" value="multiple">Match on DNA, multiple mappers randomly matched at a single position</option> + <option value="k_option">Match on DNA as fast as possible, without taking care of mapping issues (for raw annotation of reads)</option> + <option value="n_option">Match on DNA - RNAseq mode (-n bowtie option)</option> + <option value="a_option">Match and report all valid alignments</option> + </param> + <param help="specify the -v bowtie option" label="Number of mismatches allowed" name="v_mismatches" type="select"> + <option value="0">0</option> + <option selected="true" value="1">1</option> + <option value="2">2</option> + <option value="3">3</option> + </param> + <conditional name="refGenomeSource"> + <param help="Built-ins were indexed using default options" label="Will you select a reference genome from your history or use a built-in index?" name="genomeSource" type="select"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param help="if your genome of interest is not listed - contact GED team" label="Select a DNA reference index" name="index" type="select"> + <options from_data_table="bowtie_indexes"> + </options> + </param> + </when> + <when value="history"> + <param format="fasta" label="Select a fasta file, to serve as index reference" name="ownFile" type="data" /> + </when> + </conditional> + <param help="Note that the BAM will be viewable in trackster only if you choose a full genome referenced for Trackster usage. see the doc below" label="Select output format" name="output_format" type="select"> + <option select="true" value="tabular">tabular</option> + <option value="sam">sam</option> + <option value="bam">bam</option> + </param> + <param help="to get aligned and unaligned reads in fasta format" label="additional fasta output" name="additional_fasta" type="select"> + <option select="true" value="No">No</option> + <option value="al">aligned</option> + <option value="unal">unaligned</option> + <option value="al_and_unal">both aligned and unaligned</option> </param> - </when> - <when value="history"> - <param name="ownFile" type="data" format="fasta" label="Select a fasta file, to serve as index reference" /> - </when> - </conditional> -<!-- END bowtie index selection --> - <param name="output_format" type="select" label="Select output format" help="Note that the BAM will be viewable in trackster only if you choose a full genome referenced for Trackster usage. see the doc below"> - <option value="tabular" select="true">tabular</option> - <option value="sam">sam</option> - <option value="bam">bam</option> - </param> - <param name="additional_fasta" type="select" label="additional fasta output" help="to get aligned and unaligned reads in fasta format"> - <option value="No" select="true">No</option> - <option value="al">aligned</option> - <option value="unal">unaligned</option> - <option value="al_and_unal">both aligned and unaligned</option> - </param> - </inputs> - <outputs> - <data format="tabular" name="output" label="Bowtie Output"> - <change_format> - <when input="output_format" value="sam" format="sam" /> - <when input="output_format" value="bam" format="bam" /> - </change_format> -<!-- Set metadata based on reference genome --> - <actions> - <conditional name="refGenomeSource.genomeSource"> - <when value="indexed"> - <action type="metadata" name="dbkey"> - <option type="from_data_table" name="bowtie_indexes" column="1" offset="0"> - <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> - <filter type="param_value" ref="refGenomeSource.index" column="0"/> - </option> - </action> - </when> - <when value="history"> - <action type="metadata" name="dbkey"> - <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> - </action> - </when> - </conditional> - </actions> - </data> - <data format="fasta" name="aligned" label="Matched reads"> - <filter>additional_fasta == "al" or additional_fasta == "al_and_unal"</filter> - </data> - <data format="fasta" name="unaligned" label ="Unmatched reads"> - <filter>additional_fasta == "unal" or additional_fasta == "al_and_unal"</filter> - </data> - </outputs> - - <test> - <param name="genomeSource" value="indexed" /> - <param name="index" value="/home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49" /> - <param name="method" value="multiple" /> - <param name="input" ftype="fasta" value="sRbowtie.fa" /> - <param name="v_mismatches" value="1" /> - <param name="output_format" value="tabular" /> - <output name="output" ftype="tabular" value="sRbowtie.out" /> - <output name="aligned" value="None" /> - <output name="unaligned" value="None" /> - </test> - - <help> + </inputs> + <outputs> + <data format="tabular" label="Bowtie Output" name="output"> + <change_format> + <when format="sam" input="output_format" value="sam" /> + <when format="bam" input="output_format" value="bam" /> + </change_format> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action name="dbkey" type="metadata"> + <option column="1" name="bowtie_indexes" offset="0" type="from_data_table"> + <filter column="0" compare="startswith" keep="False" type="param_value" value="#" /> + <filter column="0" ref="refGenomeSource.index" type="param_value" /> + </option> + </action> + </when> + <when value="history"> + <action name="dbkey" type="metadata"> + <option name="refGenomeSource.ownFile" param_attribute="dbkey" type="from_param" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="fasta" label="Matched reads" name="aligned"> + <filter>additional_fasta == "al" or additional_fasta == "al_and_unal"</filter> + </data> + <data format="fasta" label="Unmatched reads" name="unaligned"> + <filter>additional_fasta == "unal" or additional_fasta == "al_and_unal"</filter> + </data> + </outputs> + <tests> + <test> + <param name="genomeSource" value="history" /> + <param ftype="fasta" name="ownFile" value="297_reference.fa" /> + <param name="method" value="unique" /> + <param ftype="fasta" name="input" value="input.fa" /> + <param name="v_mismatches" value="1" /> + <param name="output_format" value="bam" /> + <output file="output.bam" ftype="bam" lines_diff="4" name="output" /> + </test> + <test> + <param name="genomeSource" value="history" /> + <param ftype="fasta" name="ownFile" value="297_reference.fa" /> + <param name="method" value="unique" /> + <param ftype="fastq" name="input" value="input.fastq" /> + <param name="v_mismatches" value="1" /> + <param name="output_format" value="bam" /> + <output file="output2.bam" ftype="bam" lines_diff="4" name="output" /> + </test> + </tests> + <help> **What it does** @@ -209,4 +210,7 @@ **Matched and unmatched fasta reads can be retrieved, for further analyses** </help> + <citations> + <citation type="doi">10.1186/gb-2009-10-3-r25</citation> + </citations> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/297_reference.fa Sun Mar 29 10:25:36 2015 -0400 @@ -0,0 +1,118 @@ +>FBgn0000005_297 +AGTGACGTATTTGGGTGGTCCAAACCAGCCACTTCCATTATTTCAAAGAAATCAGTAATG +CACTCTAGTAATTTTCCATAACTGTATCCCAGCTGCGCAGACTCGTTTATCTTTTGCAGC +GCAGCGTTCTTTGTAAACATCCTAAAGACCTGCCTAAGCAGATTTGACTGCCCTCTTTCA +ACGCTACCTAATCTTAAGAACCCAAGAGCGAGGCTCTCCCGAAATACAAATATTGTTCAA +ATACTGAGGCTTCTCCTCAATCCAATTTGCATTTGATTTTTAGTCTTAAGCTGAGATCCA +AAGAATAAAGTCGTGAAACTATTTCTCCTAAAAACTATTTTTTATTTCTTGGCGTTGTCC +TTAGTCAACTGACGGGACATTAGTTCGACTCATAAATAAAACAACAATTTTACTGGCGCA +GTCGGTAGGATACAAAAGTATCCGAAAAAAAAGAACCTTCGAATGGAAAATAAGTTAAAT +TTTATAGTCCTGTGCTCGAAACATCTCCCAAAATAAATTCGTGAAAACTCTTCAACTTCA +ATTATAATTCCAATTCGGTTATCCAATAATAAGTGGAAGTGAAATACGAAACAAAAATAT +TAAGTCCAAAGGCAACTAAGTTTTAAAACCAACATATAAAAATAAAAAATTAAAACAATA +TAGAATTTTAATAATACAACACAAAAATTTACAAAACAAAAAAACAAACAAGTGAAACTA +GAAAGCTTAAAAATAATAATAACATTGAATCCGAAACAAAACAAAAAAATAAAACACAAA +AGTTAAAAATTTTACAATAAAAATGTCACAACCAATTATTGCGCTGAGCGACATAAACCT +TGCCGAAGCCCGTCGGCAGCTTAAAGACATTATGCCATTCAAGGGTGATCCAGAAACCCT +TCACACCTTTATCAGCAGAGTGGATTACGTAATTTCGCTCTACCAAACAAATGATGTCCG +ACAACAGAGGATTCTACTGGGAGCCATCGAAAGGAACTTGGACGGACAAATTACACGATC +TTTGGGACTTCCGAACGTCGAAGATTGGCCTACCCTTAAAGCAAGACTCATCGCGGAATT +TAAAATTCAAACACCAAACTACAAACTTCTGGAGAACTTCAGGGAGACACCATACAGAGG +AAGCCTAAGAGCATTCTGCGAAGAAGCGGAGAGACGACGTCAATTACTAATTTCGAAACT +ACACCTGGAAGGTAACCAATCGGATTTTCTTATTTATATTCAGGGTATTAAAGAATCTAT +TAAGATACTGATAAGGAAACTACCAATACAATTATTCACTATTTTAGCCCATCACGATAT +TACAGACTTAAGATCCTTAATTACCATTGCACAAAATGAGGGAATTTATGAAGAACACAT +TAATTTTGAATTTTATGAAAAACCAGAATATCGTAATAAAAATTCAAATTCTAACCAGAA +TTCGAAAACACAAAAATTCAATACAAATGTTCAAACTCAAAATCGACCAAGTTACTCACA +ATATTCCCAACCCTTCCAACCTAATTTTAATCAATACATTCAACCATTTAGACCTAGCTA +TACACAGCAGATAACTAACAACCCACCCATGTGGCACGCACCTAATTATTTCAGACCCAA +CCAATACATAAACCCACAACCCATTATTCAAAAAAATCATTTCCAACAATATCCCAACAA +AGCCCAATTTCCCCAAACAACGCATTTTAGAGGAAATACATACCCTCGACTACAACAACC +CTCTACATATAAAAATACTAACTTCCCGATTACTAAACGACTAAGACCATCGGACAGTGA +ACAAACTAAAATGTCTATTGACGAAATTAGATTCCAAGACGCGCATGAATTCGAACAAGT +CCAACCTAATTATTACGAGCAACAGTATTTTAACCAAAATCAATACAATCCGTATCAAAA +TCATAGCTTCATTAATGAAGGGCAACAACAAGTTCAATTTGTACAAATTAATAACAAACA +AAACCAAAATAATTCTGAACTAAACGAAAATTTTCGGTTAACAGTTCCGGAAAATACGAA +TACATAAAAATAGTATACAAAGGGCGTTCATACAAATGCCTTCTAGACACAGGATCAACA +ATTAATATGATCAATGAAAATATATTTTGTCTTCCCATTCAAAATAGTAGATGTGAAGTT +TTAACATCAAATGGCCCTATTACCTTGAACGACTTGATTATGTTACCCAGAAATAGTATT +TTCAAAAAAACCGAACCATTTTATGTGCACAGATTTTCTAATAATTACGATATGCTAATT +GGCAGAAAATTGTTGAAAAATGCTCAATCAGTTATTAATTACAAAAATGATACAGTTACC +CTTTTTGATCAAACATACAAATTAATTACTTCAGAATCCGAAAGAAACCAAAATTTGTAT +ATCCAAAGGACACCAGAATCAATTGCAAGCTCAGATCAGGAATCAATAAAAAAATTAGAT +TTTTCACAGTTTCGATTAGATCACCTAAATCAGGAGGAAACTTTTAAGTTAAAAGGCTTG +TTAAATAAATTTAGAAATCTTGAATATAAGGAGGGAGAGAAATTAACATTTACAAATACA +ATTAAACACGTACTAAATACAACACATAACTCCCCAATTTATTCGAAACAATACCCACTT +GCGCAAACACACGAAATCGAAGTAGAAAACCAAGTACAGGAAATGCTGAATCAGGGATTA +ATTAGGGAAAGTAATTCTCCATACAATAGTCCTACTTGGGTCGTACCAAAGAAACCGGAT +GCTTCTGGTGCAAATAAGTACAGGGTAGTAATTGATTATAGAAAGCTAAATGAAATAACC +ATACCTGACAGATATCCAATTCCAAATATGGACGAAATTCTTGGCAAACTGGGTAAATGC +CAATATTTTACAACGATCGATCTGGCAAAGGGATTTCATCAAATAGAAATGGACGAAGAA +TCAATTTCTAAAACTGCATTCTCCACAAAAAGCGGTCATTACGAATACCTTCGAATGCCA +TTTGGCCTTAGGAATGCACCCGCTACTTTTCAAAGGTGCATGAATAATATCCTTCGACCG +TTGCTTAACAAACACTGTTTGGTGTATCTGGATGATATTATAATTTTTTCAACATCCCTT +ACAGAACATTTAAATTCAATACAATTAGTTTTTACAAAGCTTGCAGATGCAAATTTAAAA +TTGCAACTAGACAAATGTGAGTTCTTAAAAAAGGAAGCTAACTTTCTTGGTCACATAGTT +ACCCCTGATGGTATTAAACCAAATCCTATTAAAGTTAAAGCCATAGTTTCATACCCAATT +CCGACAAAAGATAAAGAGATAAGAGCTTTCCTTGGATTAACAGGTTATTATCGCAAATTT +ATTCCAAATTACGCAGACATAGCAAAACCCATGACCAGCTGCTTAAAAAAAAGGACAAAG +ATAGATACACAAAAACTTGAGTACATAGAGGCATTCGAAAAACTTAAGGCTTTGATAATT +CGTGACCCAATTTTACAATTACCTGATTTTGAAAAGAAATTTGTTTTAACCACAGATGCA +AGTAACTTGGCCCTCGGGGCTGTCCTTTCTCAAAACGGTCATCCTATATCTTTTATTAGT +AGAACACTTAACGATCACGAATTAAATTACAGTGCTATCGAAAAAGAATTACTTGCCATA +GTTTGGGCCACAAAAACTTTTCGACATTATTTACTAGGACGACAATTTCTCATTGCCAGT +GACCATCAACCTCTTAGATGGCTTCATAACTTAAAGGAACCAGGTGCTAAGTTAGAAAGA +TGGAGAGTTAGATTAAGCGAATACCAATTTAAAATAGATTATATTAAAGGGAAAGAAAAT +TCAGTTGCCGATGCATTATCAAGAATTAAAATTGAAGAAAATCATCATAGTGAAGCTACT +CAACATAGTGCAGAAGAGGACAATAGCAACCTTATTCATTTAACAGAAAAACCAATAAAT +TATTTCAAAAAACAAATAATCTTTATTAAATCCGATAAAAATAAAGTAGAGCATTCAAAA +ATATTCGGTAACTCCATTACCACAATTCAATATGACGTAATGACACTTGAAAAGGCCAAA +CAAATTTTACTCGATCACTTTATCCATAGAAACATTACCATTTATATTGAGAGCGATGTA +GATTTTGAAATCGTTCAAAGAGCACACATAGAAATTGTTAATACCACCTACACAAAAGTA +ATTCGCAGTCTTTTCCTATTAAAGAACGTTGGTTCATACGCCGAATTCAAAGAAATCATA +CTTCAATCACATGAAAAACTTTTACACCCTGGTATACAGAAAATGACAAAATTATTTAAA +GAAAATCACTTCTTTCCAAATAGCCAACTATTAATTCAGAATATAATAAACGAATGCAAC +ATATGCAATTTGGCCAAAACAGAACATAGAAACACCAAAATGCCTTTAAAAATCACACCC +AACCCGGAACATTGCCGAGAAAAATTTGTAGTAGATATTTATTCATCTGAGGGAAAACAT +TACATCAGTTGCATTGATATTTATTCTAAATTCGCTACACTTGAGCAAATTAAAACTAAG +GATTGGATAGAATGCAGAAACGCATTAATGCGCATTTTTAATCAACTAGGAAAACCCAAA +TTATTAAAGGCAGACAGAGACGGAGCTTTCTCCAGTTTAGCTTTAAAGCGATGGCTTGAA +GAAGAAGAAGTCGAATTACAGCTCAATACAGCAAAAAACGGAGTAGCAGACGTCGAAAGA +TTACACAAAACAATAAATGAAAAAATTCGTATAATCAATTCATCTGATGATGAAGAAGTA +AAATTAAGCAAGATAGAAACAATCCTCTACACATACAACCAAAAAATTAAACATGACACT +ACTGGACAGAGACCTGCTCAAATTTTCTTATACGCTGGGCATCCCATATTAGACACTCAA +AAAATTAAAGAGAAGAAAATAGAGAAAATAAATGAAGACAGACGGGAATTTAATATTGAC +ACTAATTACAGAAAAGGTCCACTACAGAAAGGCAAATTAGAAAACCCATTTAAACCAACC +AAAAATGTAGAACAGACAGACCCTGACCATTACAAAATCACTAATAGAAATAGAGTTACG +CACTACTACAAAACACAATTCAAAAAACAAAAGAAAAATAATAAACTCTCAATTTCACAG +GCACCTGGTACCCGATAACACTATTGTTTATACTGATCACAGCTGTTCATGGACAACAAA +TTCAAATTAATAATATTGACACCAACCACGGATATCTCCTTTTTTCTGATAAGCCAGTAC +AGATACCATCCTCCTTTGAACATCACTCCTTAAAAATCAATTTAACTGAAATAGACATCG +TGGTTGACTATTTTGAGCAAAGACTACGAACCGATTACCATGCACCCCAGATCAATTTTT +TATACAATAAAATAAAAAGAGAACTAGCCAGAATAACCCTGAAACATAGAAACAAACGGG +GTTTTATTAACATTGTGGGTTCAGGTTTTAAATACCTATTTGGAACACTAGATGAAAATG +ATCGAGTCGAAATACAGAAAAAACTTGAAATCAACGTCCATAACTCAGTAAAATTACATG +AACTCAACGACGCCATACGATTGATAAATGACGGAATGCAAAAAATACAGAATTATGAAA +ATAACCACACCATCATTGACAGTCTTTTGTTCGAACTAATGCAGTTTACGGAATACATAG +AAGATTTGGAAATGGCTATGCAGCTTTCCAGACTTGGACTGTTTAACCCCAAATTACTAA +ACTACGACAAACTTGAAAATGTGAACAGCCAAAACATTTTGAACATTAAAACATCCACTT +GGATTAACTACAATGATAACCAAGTATTAATCATATCCCACATACCCATTTACCTTTCAC +TAATAAGCACAATTAAAATAATTCCTTACCCAGACTCCAACGGCTATCAGCTAGATTACA +CAGACACACAATCATATTTTGAAAAAGAAAATAAAGTTTATAATACCGAAAATAAAGAAG +TAAAAAATGAATGTGTCACCAATATTATTAAACACTTAAATCCAATTTGTAATTTTAAGC +CAGTACACACGAACGAAATAATAAAATACATAGAACCAAACACAATTGTAACTTGGAACT +TAACCCAAACAATTCTTAACCAAAATTGCCAAAATTCAATTAATAAAATAAAAATAGAAG +GAAACAAAATGATAAGAGTAACGCAATGCAAAATAGAAATCAATAATATAAATTTTAGTG +AAACTCTGTTAGAACCAGAAATAGATTTGACACCACTATACACACCACTTAATATAACAA +AAATAAAAATTGTAAAACACAACGACATTATTGAGATGATTTCAGAGAACAATATTACAC +TTTACATACAAATGATCATTGTAATAATCGCACTAATTTTGTTGTACTCATATTTAAGAT +ATGTATCATTTAAACCATTTATGATGTTGTATGCAAAACTTAAAATAAGAAAAAATCAAA +ATCAAAACACACCACAACAAACAGAAATAGAAGAAATTCCATTTCCCACACTATATCCAT +CAATCCCAGCCCAAGTATAGGCTTCTCTTTAAGGGAAGGGGAGTGACGTATTTGGGTGGT +CCAAACCAGCCACTTCCATTATTTCAAAGAAATCAGTAATGCACTCTAGTAATTTTCCAT +AACTGTATCCCAGCTGCGCAGACTCGTTTATCTTTTGCAGCGCAGCGTTCTTTGTAAACA +TCCTAAAGACCTGCCTAAGCAGATTTGACTGCCCTCTTTCAACGCTACCTAATCTTAAGA +ACCCAAGAGCGAGGCTCTCCCGAAATACAAATATTGTTCAAATACTGAGGCTTCTCCTCA +ATCCAATTTGCATTTGATTTTTAGTCTTAAGCTGAGATCCAAAGAATAAAGTCGTGAAAC +TATTTCTCCTAAAAACTATTTTTTATTTCTTGGCGTTGTCCTTAGTCAACTGACGGGACA +TTAGTTCGACTCATAAATAAAACAACAATTTTACT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input.fa Sun Mar 29 10:25:36 2015 -0400 @@ -0,0 +1,10 @@ +>1 +CATTCTGCGAAGAAGC +>2 +GGAGAGACGACGTCAATTACT +>3 +AATTTCGAAACTACACCTGGAAGGTAACCA +>4 +ATCGGATTTTCTTATTTATATTCAGGGTATTAAAGAATCTAT +>5 +TAAGATACTGATAAGGAAACTACCAATA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input.fastq Sun Mar 29 10:25:36 2015 -0400 @@ -0,0 +1,20 @@ +@HTW-1 +CATTCTGCGAAGAAGC ++ +HHHHHHHHHHHHHHHH +@HTW-2 +GGAGAGACGACGTCAATTACT ++ +HHHHHHHHHHHHHHHHHHHHH +@HTW-3 +AATTTCGAAACTACACCTGGAAGGTAACCA ++ +HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH +@HTW-4 +ATCGGATTTTCTTATTTATATTCAGGGTATTAAAGAATCTAT ++ +HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH +@HTW-5 +TAAGATACTGATAAGGAAACTACCAATA ++ +HHHHHHHHHHHHHHHHHHHHHHHHHHHH
--- a/test-data/sRbowtie.fa Mon Nov 03 10:24:38 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,40 +0,0 @@ ->1 -GTATTGTAAGTGGCAGAGTGGC ->2 -TGGAATGTAAAGAAGTATGGAG ->3 -GTGGGGAGTTTGGATGGGGCGGCA ->4 -AATGGCACTGGAAGAATTCACGG ->5 -GTACGGACAAGGGGAATC ->6 -TTGGGTTCTGGGGGGAGTATGG ->7 -GTGGGGAGTTTCGCTGGGGCGGCA ->8 -TAAGGGTCGGGTAGTGAGGGC ->9 -AGCTGGGACTGAGGACTG ->10 -AGCTGGGACTGAGGACTGC ->11 -AAGGGTCGGGTAGTGAGG ->12 -GTCGGGTAGTGAGGGCCTT ->13 -TGGTGGGGCTTGGAACAATTGGAGGGC ->14 -TGACGGAAGGGCACCACC ->15 -TGGAATGTAAAGAAGTATGGAG ->16 -TTGGGTTCTGGGGGGAGT ->17 -TCAGGTGGGGAGTTTGGCTGGGGCGGCACA ->18 -TTGGGTATAGGGGCGAAAGA ->19 -AGCGGGCGTGCTTGTGGAC ->20 -GTCGAATTTGGGTATAGGGGC
--- a/test-data/sRbowtie.out Mon Nov 03 10:24:38 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,5 +0,0 @@ -2 + 2L 20487495 TGGAATGTAAAGAAGTATGGAG -4 - 2L 11953463 CCGTGAATTCTTCCAGTGCCATT -15 + 2L 20487495 TGGAATGTAAAGAAGTATGGAG -14 - Uextra 7115665 GGTGGTGCCCTTCCGTCA -18 + Uextra 7726410 TTGGGTATAGGGGCGAAAGA
--- a/tool_dependencies.xml Mon Nov 03 10:24:38 2014 -0500 +++ b/tool_dependencies.xml Sun Mar 29 10:25:36 2015 -0400 @@ -1,7 +1,7 @@ <?xml version="1.0"?> <tool_dependency> <package name="bowtie" version="0.12.7"> - <repository changeset_revision="f54826948b0b" name="package_bowtie_0_12_7" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" /> + <repository changeset_revision="f0faa5eea2eb" name="package_bowtie_0_12_7" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" /> </package> <package name="samtools" version="0.1.18"> <repository changeset_revision="c0f72bdba484" name="package_samtools_0_1_18" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
