infernal: cmbuild.xml annotate

annotate cmbuild.xml @ 19:94cc7ef25867 draft

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9"

author	bgruening
date	Thu, 23 Sep 2021 19:38:15 +0000
parents	a82205d6d2c4
children	b10f7688d14c

rev	line source
19 94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	1 <tool id="infernal_cmbuild" name="cmbuild" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@">
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	2 <description>Build covariance models from sequence alignments</description>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	3 <macros>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	4 <import>macros.xml</import>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	5 </macros>
19 94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	6 <!--parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" merge_outputs="cmfile_outfile"></parallelism-->
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	7 <expand macro="requirements" />
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	8 <expand macro="stdio" />
19 94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	9 <expand macro="xrefs"/>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	10 <command>
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	11 <![CDATA[
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	12 cmbuild
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	13 -F
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	14 #if $is_summery_output:
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	15 -o '$summary_outfile'
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	16 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	17 ## to many outputs, is that one really needed?
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	18 ##-O $annotated_source_alignment_outfile
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	19 $model_construction_opts.model_construction_opts_selector
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	20 #if $model_construction_opts.model_construction_opts_selector == '--fast':
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	21 --symfrac $model_construction_opts.symfrac
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	22 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	23 $noss
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	24 $relative_weights_opts.relative_weights_opts_selector
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	25 #if $relative_weights_opts.relative_weights_opts_selector == '--wblosum':
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	26 --wid $relative_weights_opts.wid
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	27 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	28 --p7ere $controlling_filter_p7_hmm.p7ere
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	29 $controlling_filter_p7_hmm.p7ml
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	30 --EmN $controlling_filter_p7_hmm.EmN
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	31 --EvN $controlling_filter_p7_hmm.EvN
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	32 --ElfN $controlling_filter_p7_hmm.ElfN
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	33 --EgfN $controlling_filter_p7_hmm.EgfN
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	34 $effective_opts.effective_opts_selector
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	35 #if str($effective_opts.effective_opts_selector) == '--eent':
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	36 #if $effective_opts.ere
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	37 --ere $effective_opts.ere
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	38 #end if
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	39 #if $effective_opts.eminseq
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	40 --eminseq $effective_opts.eminseq
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	41 #end if
19 94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	42 #if $effective_opts.emaxseq
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	43 --emaxseq $effective_opts.emaxseq
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	44 #end if
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	45 #if $effective_opts.ehmmre
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	46 --ehmmre $effective_opts.ehmmre
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	47 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	48 #if $effective_opts.eset
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	49 --eset $effective_opts.eset
1aa4c036e41c Uploaded bgruening parents: diff changeset	50 #end if
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	51 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	52 #if str($refining_opts.refining_opts_selector) == '--refine':
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	53 #if $refining_opts.refine_output:
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	54 --refine '$refined_multiple_alignment_output'
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	55 #else:
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	56 --refine /dev/null
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	57 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	58 $refining_opts.l
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	59 $refining_opts.gibbs_opts.gibbs_opts_selector
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	60 #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == '--gibbs':
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	61 --seed $refining_opts.gibbs_opts.random_seed
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	62 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	63 $refining_opts.notrunc
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	64 $refining_opts.cyk
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	65 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	66 '$cmfile_outfile'
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	67 '$alignment_infile'
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	68
1aa4c036e41c Uploaded bgruening parents: diff changeset	69
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	70 #if $Calibrate.selector=="true"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	71 && cmcalibrate
17 a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	72 -L $Calibrate.L
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	73 #if $Calibrate.output_options_cond.selector == "extra"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	74 #if str($Calibrate.output_options_cond.output_options) != 'None'
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	75 #for j in $Calibrate.output_options_cond.output_options.value:
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	76 --$j $getVar($j)
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	77 #end for
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	78 #end if
1aa4c036e41c Uploaded bgruening parents: diff changeset	79 #end if
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	80 #if $Calibrate.cont_exp_tails_fits.selector == "top_n"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	81 --gtailn $Calibrate.cont_exp_tails_fits.gtailn
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	82 --ltailn $Calibrate.cont_exp_tails_fits.ltailn
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	83 #elif $Calibrate.cont_exp_tails_fits.selector == "frac"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	84 --tailp $Calibrate.cont_exp_tails_fits.tailp
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	85 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	86 --seed $Calibrate.add_opts.seed
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	87 --beta $Calibrate.add_opts.beta
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	88 $Calibrate.add_opts.nonbanded
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	89 $Calibrate.add_opts.nonull3
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	90 $Calibrate.add_opts.random
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	91 #if str($Calibrate.add_opts.gc) != 'None'
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	92 --gc '$Calibrate.add_opts.gc'
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	93 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	94 --cpu "\${GALAXY_SLOTS:-2}"
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	95 '$cmfile_outfile'
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	96 #end if
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	97
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	98 ]]>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	99 </command>
1aa4c036e41c Uploaded bgruening parents: diff changeset	100 <inputs>
17 a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	101 <param name="alignment_infile" type="data" format="stockholm" label="Sequence database"/>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	102
1aa4c036e41c Uploaded bgruening parents: diff changeset	103 <conditional name="model_construction_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	104 <param name="model_construction_opts_selector" type="select" label="These options control how consensus columns are defined in an alignment" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	105 <option value="--fast" selected="true">automatic (--fast)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	106 <option value="--hand">user defined (--hand)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	107 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	108 <when value="--fast">
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	109 <param name="symfrac" type="float" value="0.5"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	110 label="Define the residue fraction threshold necessary to define a consensus (--symfrac)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	111 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	112 <when value="--hand"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	113 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	114
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	115 <param name="noss" truevalue="--noss" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	116 label="Ignore the secondary structure annotation, if any, in your multiple alignment file (--noss)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	117
1aa4c036e41c Uploaded bgruening parents: diff changeset	118 <conditional name="relative_weights_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	119 <param name="relative_weights_opts_selector" type="select" label="Options controlling relative weights" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	120 <option value="--wpb" selected="true">Henikoff (--wgb)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	121 <option value="--wgsc">Gerstein/Sonnhammer/Chothia (--wgsc)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	122 <option value="--wnone">no sequence weighting (--wnone)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	123 <option value="--wgiven">Sequence weight from given in input file (--wgiven)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	124 <option value="--wblosum">BLOSUM filtering algorithm (--wblosum)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	125 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	126 <when value="--wpb"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	127 <when value="--wgsc"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	128 <when value="--wnone"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	129 <when value="--wgiven"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	130 <when value="--wblosum">
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	131 <param name="wid" type="float" value="0.5"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	132 label="Percent identity for clustering the alignment (--wid)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	133 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	134 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	135
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	136 <section name="controlling_filter_p7_hmm" title="Controlling Filter P7 HMM construction" >
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	137 <param argument="--p7ere" type="float" value="0.38" label="For the filter p7 HMM, set minimum rel entropy/posn to" help="Set the target mean match state relative entropy for the filter p7 HMM"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	138 <param argument="--p7ml" type="boolean" truevalue="--p7ml" falsevalue="" checked="false" label="Define the filter p7 HMM as the ML p7 HMM" help="Use a mzimum likelihood p7 HMM built from the CM as the filter HMM"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	139 <param argument="--EmN" type="integer" value="200" label="Number of sampled seqs to use for p7 local MSV calibration" help=""/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	140 <param argument="--EvN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Vit calibration" help=""/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	141 <param argument="--ElfN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Fwd calibration" help=""/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	142 <param argument="--EgfN" type="integer" value="200" label="Number of sampled seqs to use for p7 glocal Fwd calibration" help=""/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	143 </section>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	144
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	145 <conditional name="effective_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	146 <param name="effective_opts_selector" type="select" label="Options controlling effective sequence number" help="">
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	147 <option value="--eent" >entropy weighting strategy (--eent)</option>
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	148 <option value="--enone" selected="true">Turn off the entropy weighting strategy (--enone)</option>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	149 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	150 <when value="--enone"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	151 <when value="--eent">
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	152 <param name="ere" type="float" value=""
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	153 label="Set the target mean match state relative entropy" help="(--ere)" optional="true"/>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	154
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	155 <param name="eminseq" type="integer" value=""
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	156 label="Define the minimum allowed effective sequence number" help="(--eminseq)" optional="true"/>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	157
19 94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	158 <param name="emaxseq" type="integer" value=""
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	159 label="Define the maximum allowed effective sequence number" help="(--emaxseq)" optional="true"/>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	160
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	161 <param name="ehmmre" type="float" value=""
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	162 label="Set the target HMM mean match state relative entropy" help="(--ehmmre)" optional="true"/>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	163
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	164 <param name="eset" type="integer" value=""
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	165 label="Set the effective sequence number for entropy weighting" help="(--eset)" optional="true"/>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	166 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	167 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	168
1aa4c036e41c Uploaded bgruening parents: diff changeset	169 <conditional name="refining_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	170 <param name="refining_opts_selector" type="select" label="Options for refining the input alignment" help="">
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	171 <option value="--refine">refine the input alignment</option>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	172 <option value="" selected="true">No refinement</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	173 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	174 <when value=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	175 <when value="--refine">
1aa4c036e41c Uploaded bgruening parents: diff changeset	176
1aa4c036e41c Uploaded bgruening parents: diff changeset	177 <conditional name="gibbs_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	178 <param name="gibbs_opts_selector" type="select" label="refinement mode" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	179 <option value="" selected="true">expectation-maximization (EM)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	180 <option value="--gibbs">Gibbs sampling</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	181 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	182 <when value=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	183 <when value="--gibbs">
1aa4c036e41c Uploaded bgruening parents: diff changeset	184 <param name="random_seed" type="integer" value="0" label="Randam Seed" help="" />
1aa4c036e41c Uploaded bgruening parents: diff changeset	185 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	186 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	187
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	188 <param name="l" truevalue="-l" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	189 label="Turn on the local alignment algorithm" help="... which allows the alignment to span two or more subsequences if necessary"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	190
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	191 <param name="notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	192 label="Turn off the truncated alignment algorithm" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	193
1aa4c036e41c Uploaded bgruening parents: diff changeset	194 <param name="cyk" type="select" label="Options for refining the input alignment" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	195 <option value="" selected="true">optimal accuracy algorithm</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	196 <option value="--cyk">align with the CYK algorithm</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	197 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	198
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	199 <param name="refine_output" truevalue="" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	200 label="Output the refined alignment file as it is used to build the covariance model" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	201
1aa4c036e41c Uploaded bgruening parents: diff changeset	202 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	203 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	204
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	205 <param name="is_summery_output" truevalue="" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	206 label="Output a summery file?" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	207
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	208 <!-- calibrate options -->
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	209 <conditional name="Calibrate">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	210 <param name="selector" type="boolean" checked="true" label="Calibrate the covariance model"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	211 help="A CM file must be calibrated with cmcalibrate before it can be used in cmsearch or cmscan. cmcalibrate is very slow. It takes a couple of hours to calibrate a single average sized CM on a single CPU"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	212 <when value="false"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	213 <when value="true">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	214 <param argument="-L" type="float" value="1.6" min="0.01" max="160" label="Total length of random sequences to search" help="Set random seq length to search in Mb (megabases)"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	215 <conditional name="cont_exp_tails_fits" >
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	216 <param name="selector" type="select" label="Options controlling exponential tail fits">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	217 <option value="top_n">Fit the top 'n' hits/Mb in thehistogram</option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	218 <option value="frac">Fit a fraction of the histogram</option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	219 </param>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	220 <when value="top_n">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	221 <param argument="--gtailn" type="integer" value="250" min="0" label=" Fit the top 'n' hits/Mb in histogram for glocal modes" help=""/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	222 <param argument="--ltailn" type="integer" value="750" min="0" label=" Fit the top 'n' hits/Mb in histogram for local modes" help=""/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	223 </when>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	224 <when value="frac">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	225 <param argument="--tailp" type="float" min="0" max="0.6" optional="true" label="Set fraction of histogram tail to fit to exp tail" help=""/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	226 </when>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	227 </conditional>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	228 <conditional name="output_options_cond">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	229 <param name="selector" type="select" label="Output extra files">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	230 <option value="extra">Output extra files</option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	231 <option value="none" selected="true">Don't output extra files</option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	232 </param>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	233 <when value="extra">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	234 <param name="output_options" type="select" label="Optional output files" multiple="true" display="checkboxes">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	235 <option value="hfile">save fitted score histogram(s)</option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	236 <option value="sfile">save survival plot </option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	237 <option value="qqfile">save Q-Q plot for score histograms </option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	238 <option value="ffile">save lambdas for different tail fit probs</option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	239 <option value="xfile">save scores in fit tail</option>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	240 </param>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	241 </when>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	242 <when value="none"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	243 </conditional>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	244 <section name="add_opts" title="Additional Options">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	245 <param argument="--seed" type="integer" value="181"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	246 label="RNG seed" help="If the seed is nonzero, stochas-tic simulations will be reproducible. If 0, the random number generator is seeded arbitrarily"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	247 <param argument="--beta" type="float" value="1e-15"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	248 label="Tail loss prob. for query dependent banding (QDB)" help="The beta parameter is the amount of probability mass excluded during band calculation, higher values of beta give greater speedups but sacrifice more accuracy than lower values."/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	249 <param argument="--nonbanded" truevalue="--nonbanded" falsevalue="" checked="false" type="boolean"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	250 label="Turn off QDB during E-value calibration" help="This will slow down calibration"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	251 <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	252 label="Turn off the null3 post hoc additional null model" help="This is not recommended unless you plan on using the same option to cmsearch and/or cmscan"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	253 <param argument="--random" truevalue="--random" falsevalue="" checked="false" type="boolean"
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	254 label="use GC content of random null background model of CM" help="Use the background null model of the CM to generate the random sequences, instead of the more realistic HMM. Unless the CM was built using the --null option to cmbuild, the background null model will be 25% each A, C, G and U"/>
17 a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	255 <param argument="--gc" type="data" format="txt" optional="true" label="Use GC content distribution from file" help="Generate the random sequences using the nucleotide distribution from the sequence file"/>
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	256 </section>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	257 </when>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	258 </conditional>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	259
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	260
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	261 </inputs>
1aa4c036e41c Uploaded bgruening parents: diff changeset	262 <outputs>
19 94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	263 <data format="txt" name="summary_outfile" label="cmbuild summary on ${on_string}">
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	264 <filter>is_summery_output is True</filter>
1aa4c036e41c Uploaded bgruening parents: diff changeset	265 </data>
1aa4c036e41c Uploaded bgruening parents: diff changeset	266 <!--<data format="stockholm" name="annotated_source_alignment_outfile" label="Annotated alignment from ${on_string}"/>-->
1aa4c036e41c Uploaded bgruening parents: diff changeset	267 <data format="cm" name="cmfile_outfile" label="Covariance models from ${on_string}"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	268
1aa4c036e41c Uploaded bgruening parents: diff changeset	269 <data format="stockholm" name="refined_multiple_alignment_output" label="refined alignment file of ${on_string}">
1aa4c036e41c Uploaded bgruening parents: diff changeset	270 <filter>
1aa4c036e41c Uploaded bgruening parents: diff changeset	271 ((
1aa4c036e41c Uploaded bgruening parents: diff changeset	272 refining_opts['refining_opts_selector'] == "--refine" and
1aa4c036e41c Uploaded bgruening parents: diff changeset	273 refining_opts['refine_output'] is True
1aa4c036e41c Uploaded bgruening parents: diff changeset	274 ))
1aa4c036e41c Uploaded bgruening parents: diff changeset	275 </filter>
1aa4c036e41c Uploaded bgruening parents: diff changeset	276 </data>
1aa4c036e41c Uploaded bgruening parents: diff changeset	277
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	278 <!-- cmcalibrate additional output files -->
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	279 <data name="hfile" format="txt" label="hfile, an cmcalibrate additional output file, on ${on_string}">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	280 <filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	281 ((
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	282 Calibrate['selector'] is True and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	283 Calibrate['output_options_cond']['selector'] == "extra" and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	284 'hfile' in Calibrate['output_options_cond']['output_options']
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	285 ))
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	286 </filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	287 </data>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	288 <data name="sfile" format="txt" label="sfile, an cmcalibrate additional output file, on ${on_string}">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	289 <filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	290 ((
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	291 Calibrate['selector'] is True and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	292 Calibrate['output_options_cond']['selector'] == "extra" and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	293 'sfile' in Calibrate['output_options_cond']['output_options']
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	294 ))
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	295 </filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	296 </data>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	297 <data name="qqfile" format="txt" label="qqfile, an cmcalibrate additional output file, on ${on_string}">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	298 <filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	299 ((
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	300 Calibrate['selector'] is True and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	301 Calibrate['output_options_cond']['selector'] == "extra" and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	302 'qqfile' in Calibrate['output_options_cond']['output_options']
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	303 ))
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	304 </filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	305 </data>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	306 <data name="ffile" format="txt" label="ffile, an cmcalibrate additional output file, on ${on_string}">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	307 <filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	308 ((
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	309 Calibrate['selector'] is True and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	310 Calibrate['output_options_cond']['selector'] == "extra" and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	311 'ffile' in Calibrate['output_options_cond']['output_options']
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	312 ))
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	313 </filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	314 </data>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	315 <data name="xfile" format="txt" label="xfile, an cmcalibrate additional output file, on ${on_string}">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	316 <filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	317 ((
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	318 Calibrate['selector'] is True and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	319 Calibrate['output_options_cond']['selector'] == "extra" and
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	320 'xfile' in Calibrate['output_options_cond']['output_options']
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	321 ))
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	322 </filter>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	323 </data>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	324
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	325 </outputs>
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	326
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	327 <tests>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	328 <test>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	329 <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	330 <conditional name="Calibrate">
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	331 <param name="selector" value="true"/>
17 a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	332 <param name="L" value="0.1"/>
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	333 </conditional>
19 94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	334 <output name="cmfile_outfile">
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	335 <assert_contents>
17 a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	336 <has_text text="S 0 -1 0 1 4 0 1 89 109 -7.220 -8.465 -0.063 -4.919"/>
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	337 </assert_contents>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	338 </output>
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	339 </test>
19 94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	340 <!-- Test emax seq parameter -->
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	341 <test>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	342 <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	343 <conditional name="Calibrate">
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	344 <param name="selector" value="true"/>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	345 <param name="L" value="0.1"/>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	346 </conditional>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	347 <conditional name="effective_opts">
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	348 <param name="effective_opts_selector" value="--eent"/>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	349 <param name="emaxseq" value="100"/>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	350 </conditional>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	351 <output name="cmfile_outfile">
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	352 <assert_contents>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	353 <has_text text="S 0 -1 0 1 4 0 1 89 109 -7.111 -8.357 -0.068 -4.810"/>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	354 </assert_contents>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	355 </output>
94cc7ef25867 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 17 diff changeset	356 </test>
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	357 </tests>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	358 <help>
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	359 <![CDATA[
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	360
1aa4c036e41c Uploaded bgruening parents: diff changeset	361 What it does
1aa4c036e41c Uploaded bgruening parents: diff changeset	362
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	363 cmbuild belongs to the INFERNAL software package that allows you to make consensus RNA secondary structure profiles, and use them to search nucleic acid sequence databases for homologous RNAs, or to create new structure-based multiple sequence alignments.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	364
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	365 cm build builds a covariance model of an RNA multiple alignment. cmbuild uses the consensus structure to determine the architecture of the CM.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	366
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	367 Input
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	368
17 a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	369 Input file is a multiple sequence alignment file in Stockholm format, and must contain consensus secondary structure annotation.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	370 cmbuild uses the consensus structure to determine the architecture of the CM.
1aa4c036e41c Uploaded bgruening parents: diff changeset	371
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	372 Example: simple example of a multiple RNA sequence alignment with secondary structure annotation
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	373
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	374 # STOCKHOLM 1.0
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	375
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	376 tRNA1 GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCC
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	377
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	378 tRNA2 UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CC
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	379
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	380 tRNA3 UCCGUGAUAGUUUAAU.GGUCAGAAUGGGCGCUUGUCGCGUGCCAGA.UC
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	381
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	382 tRNA4 GCUCGUAUGGCGCAGU.GGU.AGCGCAGCAGAUUGCAAAUCUGUUGGUCC
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	383
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	384 tRNA5 GGGCACAUGGCGCAGUUGGU.AGCGCGCUUCCCUUGCAAGGAAGAGGUCA
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	385
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	386 #=GC SS_cons <<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	387
1aa4c036e41c Uploaded bgruening parents: diff changeset	388
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	389 Output
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	390
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	391 The output of cmbuild contains information about the size of your input alignment (in aligned columns
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	392 and # of sequences), and about the size of the resulting model.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	393
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	394 In addition to writing CM(s) to the output file, cmbuild also outputs a single line for each model created to stdout.
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	395 Each line has the following fields:
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	396 - aln: the index of the alignment used to build the CM
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	397 - idx: the index of the CM in the output file
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	398 - name: the name of the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	399 - nseq: the number of sequences in the alignment used to build the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	400 - eff nseq: the effective number of sequences used to build the model
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	401 - alen: the length of the alignment used to build the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	402 - clen: the number of columns from the alignment defined as consensus (match) columns
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	403 - bps: the number of basepairs in the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	404 - bifs: the number of bifurcations in the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	405 - rel entropy: CM: the total relative entropy of the model divided by the number of consensus columns
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	406 - rel entropy: HMM: the total relative entropy of the model ignoring secondary structure divided by the number of consensus columns
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	407 - description: description of the model/alignment.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	408
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	409
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	410 Options controlling model construction
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	411
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	412 These options control how consensus columns are defined in an alignment.
1aa4c036e41c Uploaded bgruening parents: diff changeset	413
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	414 - --fast: Define consensus columns automatically as those that have a fraction >= symfrac of residues as opposed to gaps. (See below for the --symfrac option.) This is the default.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	415 - --hand: Use reference coordinate annotation (#=GC RF line, in Stockholm) to determine which columns are consensus, and which are inserts. Any non-gap character indicates a consensus column. (For example, mark consensus columns with ”x”, and insert columns with ”.”.)
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	416 - --symfrac: Define the residue fraction threshold necessary to define a consensus column when not using --hand. The default is 0.5. The symbol fraction in each column is calculated after taking relative sequence weighting into account. Setting this to 0.0 means that every alignment column will be assigned as consensus, which may be useful in some cases. Setting it to 1.0 means that only columns that include 0 gaps will be assigned as consensus.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	417 - --noss: Ignore the secondary structure annotation, if any, in MSA-Infile and build a CM with zero basepairs. This model will be similar to a profile HMM and the cmsearch and cmscan programs will use HMM algorithms which are faster than CM ones for this model. Additionally, a zero basepair model need not be calibrated with cmcalibrate prior to running cmsearch with it. The --noss option must be used if there is no secondary structure annotation in MSA-Infile.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	418
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	419
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	420 Options controlling relative weights
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	421
1aa4c036e41c Uploaded bgruening parents: diff changeset	422
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	423 cmbuild uses an ad hoc sequence weighting algorithm to downweight closely related sequences and upweight distantly related ones. This has the effect of making models less biased by uneven phylogenetic representation. For example, two identical sequences would typically each receive half the weight that one sequence would. These options control which algorithm gets used.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	424
17 a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	425 - --wgb: Use the Henikoff position-based sequence weighting scheme [Henikoff
a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	426 and Henikoff, J. Mol. Biol. 243:574, 1994]. This is the default.
a82205d6d2c4 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 16 diff changeset	427 - --wgsc: Use the Gerstein/Sonnhammer/Chothia weighting algorithm [Gerstein et al, J. Mol. Biol. 235:1067, 1994].
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	428 - --wnone: Turn sequence weighting off; e.g. explicitly set all sequence weights to 1.0.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	429 - --wgiven: Use sequence weights as given in annotation in the input alignment file. If no weights were given, assume they are all 1.0. The default is to determine new sequence weights by the Gerstein/Sonnhammer/Chothia algorithm, ignoring any annotated weights.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	430 - --wblosum: Use the BLOSUM filtering algorithm to weight the sequences, instead of the default GSC weighting. Cluster the sequences at a given percentage identity (see --wid); assign each cluster a total weight of 1.0, distributed equally amongst the members of that cluster.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	431
1aa4c036e41c Uploaded bgruening parents: diff changeset	432
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	433 Options controlling effective sequence number
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	434
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	435
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	436 After relative weights are determined, they are normalized to sum to a total effective sequence number, eff nseq. This number may be the actual number of sequences in the alignment, but it is almost always smaller than that. The default entropy weighting method (--eent) reduces the effective sequence number to reduce the information content (relative entropy, or average expected score on true homologs) per consensus position. The target relative entropy is controlled by a two-parameter function, where the two parameters are settable with --ere and --esigma.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	437
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	438 - --eent: Use the entropy weighting strategy to determine the effective sequence number that gives a target mean match state relative entropy. This option is the default, and can be turned off with --enone. The default target mean match state relative entropy is 0.59 bits for models with at least 1 basepair and 0.38 bits for models with zero basepairs, but changed with --ere. The default of 0.59 or 0.38 bits is automatically changed if the total relative entropy of the model (summed match state relative entropy) is less than a cutoff, which is is 6.0 bits by default, but can be changed with the expert, undocumented --eX option. If you really want to play with that option, consult the source code.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	439 - --enone: Turn off the entropy weighting strategy. The effective sequence number is just the number of sequences in the alignment.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	440 - --ere: Set the target mean match state relative entropy. By default the target relative entropy per match position is 0.59 bits for models with at least 1 basepair and 0.38 for models with zero basepairs.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	441 - --eminseq: Define the minimum allowed effective sequence number.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	442 - --ehmmre: Set the target HMM mean match state relative entropy. Entropy for basepairing match states is calculated using marginalized basepair emission probabilities.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	443 - --eset: Set the effective sequence number for entropy weighting.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	444
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	445 Options for refining the input alignment
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	446
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	447 - --refine: Attempt to refine the alignment before building the CM using expectation-maximization (EM). A CM is first built from the initial alignment as usual. Then, the sequences in the alignment are realigned optimally (with the HMM banded CYK algorithm, optimal means optimal given the bands) to the CM, and a new CM is built from the resulting alignment. The sequences are then realigned to the new CM, and a new CM is built from that alignment. This is continued until convergence, specifically when the alignments for two successive iterations are not significantly different (the summed bit scores of all the sequences in the alignment changes less than 1% between two successive iterations).
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	448 - Turn on the local alignment algorithm: allows the alignment to span two or more subsequences if necessary (e.g. if the structures of the query model and target sequence are only partially shared), allowing certain large insertions and deletions in the structure to be penalized differently than normal indels. The default is to globally align the query model to the target sequences.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	449 - --gibbs sampling: Modifies the behavior of --refine so Gibbs sampling is used instead of EM. The difference is that during the alignment stage the alignment is not necessarily optimal, instead an alignment (parsetree) for each sequences is sampled from the posterior distribution of alignments as determined by the Inside algorithm. Due to this sampling step --gibbs is non- deterministic, so different runs with the same alignment may yield different results. This is not true when --refine is used without the --gibbs option, in which case the final alignment and CM will always be the same. When --gibbs is enabled, the --seed "number" option can be used to seed the random number generator predictably, making the results reproducible. The goal of the --gibbs option is to help expert RNA alignment curators refine structural alignments by allowing them to observe alternative high scoring alignments.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	450 - --Random seed: Seed the random number generator with an integer >= 0. This option can only be used in combination with --gibbs. If the given number is nonzero, stochastic sampling of alignments will be reproducible; the same command will give the same results. If the given number is 0, the random number generator is seeded arbitrarily, and stochastic samplings may vary from run to run of the same command. The default seed is 0.
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	451 - --Turn off the truncated alignment algorithm: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page.
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	452 - --cyk algorithm: With --refine, align with the CYK algorithm. By default the optimal accuracy algorithm is used. There is more information on this in the cmalign manual page.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	453
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	454
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	455 For further questions please refere to the Infernal Userguide_.
1aa4c036e41c Uploaded bgruening parents: diff changeset	456
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	457 .. _Userguide: http://eddylab.org/infernal/Userguide.pdf
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	458
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	459 ]]>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	460 </help>
16 0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	461
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	462 <expand macro="citations" />
0ac29b4bb1cb planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 15 diff changeset	463
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	464 </tool>

Mercurial > repos > bgruening > infernal

annotate cmbuild.xml @ 19:94cc7ef25867 draft