infernal: cmbuild.xml annotate

annotate cmbuild.xml @ 15:e239fae4c2f1 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8

author	bgruening
date	Mon, 19 Dec 2016 15:26:02 -0500
parents	2f8a8962ae22
children	0ac29b4bb1cb

rev	line source
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	1 <tool id="infernal_cmbuild" name="Build covariance models" version="1.1.0.2">
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	2 <description>from sequence alignments (cmbuild)</description>
1aa4c036e41c Uploaded bgruening parents: diff changeset	3 <parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" shared_inputs="" merge_outputs="cmfile_outfile"></parallelism>
1aa4c036e41c Uploaded bgruening parents: diff changeset	4 <requirements>
1aa4c036e41c Uploaded bgruening parents: diff changeset	5 <requirement type="package">infernal</requirement>
12 c17ed5a530d2 Uploaded bgruening parents: 11 diff changeset	6 <requirement type="package" version="1.1">infernal</requirement>
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	7 <requirement type="package" version="8.22">gnu_coreutils</requirement>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	8 </requirements>
1aa4c036e41c Uploaded bgruening parents: diff changeset	9 <command>
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	10 <![CDATA[
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	11 cmbuild -F
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	12 #if $is_summery_output:
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	13 -o '$summary_outfile'
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	14 #end if
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	15
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	16 $model_construction_opts.model_construction_opts_selector
1aa4c036e41c Uploaded bgruening parents: diff changeset	17 #if $model_construction_opts.model_construction_opts_selector == '--fast':
1aa4c036e41c Uploaded bgruening parents: diff changeset	18 --symfrac $model_construction_opts.symfrac
1aa4c036e41c Uploaded bgruening parents: diff changeset	19 #end if
1aa4c036e41c Uploaded bgruening parents: diff changeset	20
1aa4c036e41c Uploaded bgruening parents: diff changeset	21 $noss
1aa4c036e41c Uploaded bgruening parents: diff changeset	22
1aa4c036e41c Uploaded bgruening parents: diff changeset	23 $relative_weights_opts.relative_weights_opts_selector
1aa4c036e41c Uploaded bgruening parents: diff changeset	24 #if $relative_weights_opts.relative_weights_opts_selector == '--wblosum':
1aa4c036e41c Uploaded bgruening parents: diff changeset	25 --wid $relative_weights_opts.wid
1aa4c036e41c Uploaded bgruening parents: diff changeset	26 #end if
1aa4c036e41c Uploaded bgruening parents: diff changeset	27
1aa4c036e41c Uploaded bgruening parents: diff changeset	28 $effective_opts.effective_opts_selector
11 5c6344f67ad0 Uploaded bgruening parents: 10 diff changeset	29 #if str($effective_opts.effective_opts_selector) == '--eent':
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	30 --ere $effective_opts.ere
1aa4c036e41c Uploaded bgruening parents: diff changeset	31 --eminseq $effective_opts.eminseq
1aa4c036e41c Uploaded bgruening parents: diff changeset	32 --ehmmre $effective_opts.ehmmre
1aa4c036e41c Uploaded bgruening parents: diff changeset	33 --eset $effective_opts.eset
1aa4c036e41c Uploaded bgruening parents: diff changeset	34 #end if
1aa4c036e41c Uploaded bgruening parents: diff changeset	35
11 5c6344f67ad0 Uploaded bgruening parents: 10 diff changeset	36 #if str($refining_opts.refining_opts_selector) == '--refine':
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	37 #if $refining_opts.refine_output:
1aa4c036e41c Uploaded bgruening parents: diff changeset	38 --refine $refined_multiple_alignment_output
1aa4c036e41c Uploaded bgruening parents: diff changeset	39 #else:
1aa4c036e41c Uploaded bgruening parents: diff changeset	40 --refine /dev/null
1aa4c036e41c Uploaded bgruening parents: diff changeset	41 #end if
1aa4c036e41c Uploaded bgruening parents: diff changeset	42
1aa4c036e41c Uploaded bgruening parents: diff changeset	43 $l
1aa4c036e41c Uploaded bgruening parents: diff changeset	44 $refining_opts.gibbs_opts.gibbs_opts_selector
1aa4c036e41c Uploaded bgruening parents: diff changeset	45
11 5c6344f67ad0 Uploaded bgruening parents: 10 diff changeset	46 #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == '--gibbs':
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	47 $refining_opts.gibbs_opts.random_seed
1aa4c036e41c Uploaded bgruening parents: diff changeset	48 #end if
1aa4c036e41c Uploaded bgruening parents: diff changeset	49
1aa4c036e41c Uploaded bgruening parents: diff changeset	50 $notrunc
1aa4c036e41c Uploaded bgruening parents: diff changeset	51 $cyk
1aa4c036e41c Uploaded bgruening parents: diff changeset	52 #end if
1aa4c036e41c Uploaded bgruening parents: diff changeset	53
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	54 '$cmfile_outfile'
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	55 '$alignment_infile'
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	56 &&
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	57 cmcalibrate
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	58 -L 0.01 --cpu \${GALAXY_SLOTS:-2}
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	59 '$cmfile_outfile'
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	60 ]]>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	61 </command>
1aa4c036e41c Uploaded bgruening parents: diff changeset	62 <inputs>
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	63 <!-- Stockholm or SELEX
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	64 SELEX is defined in EMBOSS datatypes
1aa4c036e41c Uploaded bgruening parents: diff changeset	65 -->
1aa4c036e41c Uploaded bgruening parents: diff changeset	66 <param name="alignment_infile" type="data" format="stockholm,selex" label="Sequence database"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	67
1aa4c036e41c Uploaded bgruening parents: diff changeset	68 <conditional name="model_construction_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	69 <param name="model_construction_opts_selector" type="select" label="These options control how consensus columns are defined in an alignment" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	70 <option value="--fast" selected="true">automatic (--fast)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	71 <option value="--hand">user defined (--hand)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	72 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	73 <when value="--fast">
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	74 <param name="symfrac" type="float" value="0.5"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	75 label="Define the residue fraction threshold necessary to define a consensus (--symfrac)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	76 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	77 <when value="--hand"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	78 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	79
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	80 <param name="noss" truevalue="--noss" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	81 label="Ignore the secondary structure annotation, if any, in your multiple alignment file (--noss)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	82
1aa4c036e41c Uploaded bgruening parents: diff changeset	83 <conditional name="relative_weights_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	84 <param name="relative_weights_opts_selector" type="select" label="Options controlling relative weights" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	85 <option value="--wpb" selected="true">Henikoff (--wgb)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	86 <option value="--wgsc">Gerstein/Sonnhammer/Chothia (--wgsc)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	87 <option value="--wnone">no sequence weighting (--wnone)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	88 <option value="--wgiven">Sequence weight from given in input file (--wgiven)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	89 <option value="--wblosum">BLOSUM filtering algorithm (--wblosum)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	90 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	91 <when value="--wpb"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	92 <when value="--wgsc"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	93 <when value="--wnone"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	94 <when value="--wgiven"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	95 <when value="--wblosum">
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	96 <param name="wid" type="float" value="0.5"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	97 label="Percent identity for clustering the alignment (--wid)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	98 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	99 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	100
1aa4c036e41c Uploaded bgruening parents: diff changeset	101 <conditional name="effective_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	102 <param name="effective_opts_selector" type="select" label="Options controlling effective sequence number" help="">
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	103 <option value="--eent" >entropy weighting strategy (--eent)</option>
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	104 <option value="--enone" selected="true">Turn off the entropy weighting strategy (--enone)</option>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	105 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	106 <when value="--enone"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	107 <when value="--eent">
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	108 <param name="ere" type="float" value="0.59"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	109 label="Set the target mean match state relative entropy (--ere)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	110
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	111 <param name="eminseq" type="integer" value=""
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	112 label="Define the minimum allowed effective sequence number (--eminseq)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	113
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	114 <param name="ehmmre" type="float" value=""
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	115 label="Set the target HMM mean match state relative entropy (--ehmmre)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	116
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	117 <param name="eset" type="integer" value=""
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	118 label="Set the effective sequence number for entropy weighting (--eset)" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	119 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	120 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	121
1aa4c036e41c Uploaded bgruening parents: diff changeset	122 <conditional name="refining_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	123 <param name="refining_opts_selector" type="select" label="Options for refining the input alignment" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	124 <option value="" selected="true">No refinement</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	125 <option value="--refine">refine the input alignment</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	126 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	127 <when value=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	128 <when value="--refine">
1aa4c036e41c Uploaded bgruening parents: diff changeset	129
1aa4c036e41c Uploaded bgruening parents: diff changeset	130 <conditional name="gibbs_opts">
1aa4c036e41c Uploaded bgruening parents: diff changeset	131 <param name="gibbs_opts_selector" type="select" label="refinement mode" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	132 <option value="" selected="true">expectation-maximization (EM)</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	133 <option value="--gibbs">Gibbs sampling</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	134 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	135 <when value=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	136 <when value="--gibbs">
1aa4c036e41c Uploaded bgruening parents: diff changeset	137 <param name="random_seed" type="integer" value="0" label="Randam Seed" help="" />
1aa4c036e41c Uploaded bgruening parents: diff changeset	138 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	139 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	140
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	141 <param name="l" truevalue="-l" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	142 label="Turn on the local alignment algorithm" help="... which allows the alignment to span two or more subsequences if necessary"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	143
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	144 <param name="notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	145 label="Turn off the truncated alignment algorithm" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	146
1aa4c036e41c Uploaded bgruening parents: diff changeset	147 <param name="cyk" type="select" label="Options for refining the input alignment" help="">
1aa4c036e41c Uploaded bgruening parents: diff changeset	148 <option value="" selected="true">optimal accuracy algorithm</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	149 <option value="--cyk">align with the CYK algorithm</option>
1aa4c036e41c Uploaded bgruening parents: diff changeset	150 </param>
1aa4c036e41c Uploaded bgruening parents: diff changeset	151
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	152 <param name="refine_output" truevalue="" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	153 label="Output the refined alignment file as it is used to build the covariance model" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	154
1aa4c036e41c Uploaded bgruening parents: diff changeset	155 </when>
1aa4c036e41c Uploaded bgruening parents: diff changeset	156 </conditional>
1aa4c036e41c Uploaded bgruening parents: diff changeset	157
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	158 <param name="is_summery_output" truevalue="" falsevalue="" checked="False" type="boolean"
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	159 label="Output a summery file?" help=""/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	160
1aa4c036e41c Uploaded bgruening parents: diff changeset	161 </inputs>
1aa4c036e41c Uploaded bgruening parents: diff changeset	162 <outputs>
1aa4c036e41c Uploaded bgruening parents: diff changeset	163 <data format="text" name="summary_outfile" label="cmbuild summary on ${on_string}">
1aa4c036e41c Uploaded bgruening parents: diff changeset	164 <filter>is_summery_output is True</filter>
1aa4c036e41c Uploaded bgruening parents: diff changeset	165 </data>
1aa4c036e41c Uploaded bgruening parents: diff changeset	166 <!--<data format="stockholm" name="annotated_source_alignment_outfile" label="Annotated alignment from ${on_string}"/>-->
1aa4c036e41c Uploaded bgruening parents: diff changeset	167 <data format="cm" name="cmfile_outfile" label="Covariance models from ${on_string}"/>
1aa4c036e41c Uploaded bgruening parents: diff changeset	168
1aa4c036e41c Uploaded bgruening parents: diff changeset	169 <data format="stockholm" name="refined_multiple_alignment_output" label="refined alignment file of ${on_string}">
1aa4c036e41c Uploaded bgruening parents: diff changeset	170 <filter>
1aa4c036e41c Uploaded bgruening parents: diff changeset	171 ((
1aa4c036e41c Uploaded bgruening parents: diff changeset	172 refining_opts['refining_opts_selector'] == "--refine" and
1aa4c036e41c Uploaded bgruening parents: diff changeset	173 refining_opts['refine_output'] is True
1aa4c036e41c Uploaded bgruening parents: diff changeset	174 ))
1aa4c036e41c Uploaded bgruening parents: diff changeset	175 </filter>
1aa4c036e41c Uploaded bgruening parents: diff changeset	176 </data>
1aa4c036e41c Uploaded bgruening parents: diff changeset	177
1aa4c036e41c Uploaded bgruening parents: diff changeset	178 </outputs>
1aa4c036e41c Uploaded bgruening parents: diff changeset	179 <help>
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	180 <![CDATA[
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	181
1aa4c036e41c Uploaded bgruening parents: diff changeset	182 What it does
1aa4c036e41c Uploaded bgruening parents: diff changeset	183
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	184 cmbuild belongs to the INFERNAL software package that allows you to make consensus RNA secondary structure profiles, and use them to search nucleic acid sequence databases for homologous RNAs, or to create new structure-based multiple sequence alignments.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	185
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	186 cm build builds a covariance model of an RNA multiple alignment. cmbuild uses the consensus structure to determine the architecture of the CM.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	187
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	188 Input
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	189
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	190 Input file is a multiple sequence alignment file in Stockholm or SELEX format, and must contain consensus secondary structure annotation.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	191 cmbuild uses the consensus structure to determine the architecture of the CM.
1aa4c036e41c Uploaded bgruening parents: diff changeset	192
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	193 Example: simple example of a multiple RNA sequence alignment with secondary structure annotation
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	194
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	195 # STOCKHOLM 1.0
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	196
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	197 tRNA1 GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCC
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	198
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	199 tRNA2 UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CC
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	200
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	201 tRNA3 UCCGUGAUAGUUUAAU.GGUCAGAAUGGGCGCUUGUCGCGUGCCAGA.UC
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	202
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	203 tRNA4 GCUCGUAUGGCGCAGU.GGU.AGCGCAGCAGAUUGCAAAUCUGUUGGUCC
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	204
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	205 tRNA5 GGGCACAUGGCGCAGUUGGU.AGCGCGCUUCCCUUGCAAGGAAGAGGUCA
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	206
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	207 #=GC SS_cons <<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	208
1aa4c036e41c Uploaded bgruening parents: diff changeset	209
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	210 Output
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	211
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	212 The output of cmbuild contains information about the size of your input alignment (in aligned columns
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	213 and # of sequences), and about the size of the resulting model.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	214
15 e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	215 In addition to writing CM(s) to the output file, cmbuild also outputs a single line for each model created to stdout.
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	216 Each line has the following fields:
e239fae4c2f1 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 14 diff changeset	217 - aln: the index of the alignment used to build the CM
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	218 - idx: the index of the CM in the output file
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	219 - name: the name of the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	220 - nseq: the number of sequences in the alignment used to build the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	221 - eff nseq: the effective number of sequences used to build the model
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	222 - alen: the length of the alignment used to build the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	223 - clen: the number of columns from the alignment defined as consensus (match) columns
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	224 - bps: the number of basepairs in the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	225 - bifs: the number of bifurcations in the CM
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	226 - rel entropy: CM: the total relative entropy of the model divided by the number of consensus columns
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	227 - rel entropy: HMM: the total relative entropy of the model ignoring secondary structure divided by the number of consensus columns
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	228 - description: description of the model/alignment.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	229
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	230
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	231 Options controlling model construction
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	232
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	233 These options control how consensus columns are defined in an alignment.
1aa4c036e41c Uploaded bgruening parents: diff changeset	234
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	235 - --fast: Define consensus columns automatically as those that have a fraction >= symfrac of residues as opposed to gaps. (See below for the --symfrac option.) This is the default.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	236 - --hand: Use reference coordinate annotation (#=GC RF line, in Stockholm) to determine which columns are consensus, and which are inserts. Any non-gap character indicates a consensus column. (For example, mark consensus columns with ”x”, and insert columns with ”.”.)
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	237 - --symfrac: Define the residue fraction threshold necessary to define a consensus column when not using --hand. The default is 0.5. The symbol fraction in each column is calculated after taking relative sequence weighting into account. Setting this to 0.0 means that every alignment column will be assigned as consensus, which may be useful in some cases. Setting it to 1.0 means that only columns that include 0 gaps will be assigned as consensus.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	238 - --noss: Ignore the secondary structure annotation, if any, in MSA-Infile and build a CM with zero basepairs. This model will be similar to a profile HMM and the cmsearch and cmscan programs will use HMM algorithms which are faster than CM ones for this model. Additionally, a zero basepair model need not be calibrated with cmcalibrate prior to running cmsearch with it. The --noss option must be used if there is no secondary structure annotation in MSA-Infile.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	239
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	240
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	241 Options controlling relative weights
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	242
1aa4c036e41c Uploaded bgruening parents: diff changeset	243
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	244 cmbuild uses an ad hoc sequence weighting algorithm to downweight closely related sequences and upweight distantly related ones. This has the effect of making models less biased by uneven phylogenetic representation. For example, two identical sequences would typically each receive half the weight that one sequence would. These options control which algorithm gets used.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	245
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	246 - --wgb: Use the Henikoff position-based sequence weighting scheme ([Henikoff and Henikoff](http://zhanglab.ccmb.med.umich.edu/literature/henikoff_weight_1994.pdf), J. Mol. Biol. 243:574, 1994). This is the default.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	247 - --wgsc: Use the Gerstein/Sonnhammer/Chothia weighting algorithm ([Gerstein et al.](http://ac.els-cdn.com/0022283694900124/1-s2.0-0022283694900124-main.pdf?_tid=6ed29974-3044-11e5-8949-00000aacb35f&acdnat=1437550798_aaa62caa2c812bb81013f967e7b119ee), J. Mol. Biol. 236:1067, 1994).
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	248 - --wnone: Turn sequence weighting off; e.g. explicitly set all sequence weights to 1.0.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	249 - --wgiven: Use sequence weights as given in annotation in the input alignment file. If no weights were given, assume they are all 1.0. The default is to determine new sequence weights by the Gerstein/Sonnhammer/Chothia algorithm, ignoring any annotated weights.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	250 - --wblosum: Use the BLOSUM filtering algorithm to weight the sequences, instead of the default GSC weighting. Cluster the sequences at a given percentage identity (see --wid); assign each cluster a total weight of 1.0, distributed equally amongst the members of that cluster.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	251
1aa4c036e41c Uploaded bgruening parents: diff changeset	252
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	253 Options controlling effective sequence number
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	254
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	255
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	256 After relative weights are determined, they are normalized to sum to a total effective sequence number, eff nseq. This number may be the actual number of sequences in the alignment, but it is almost always smaller than that. The default entropy weighting method (--eent) reduces the effective sequence number to reduce the information content (relative entropy, or average expected score on true homologs) per consensus position. The target relative entropy is controlled by a two-parameter function, where the two parameters are settable with --ere and --esigma.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	257
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	258 - --eent: Use the entropy weighting strategy to determine the effective sequence number that gives a target mean match state relative entropy. This option is the default, and can be turned off with --enone. The default target mean match state relative entropy is 0.59 bits for models with at least 1 basepair and 0.38 bits for models with zero basepairs, but changed with --ere. The default of 0.59 or 0.38 bits is automatically changed if the total relative entropy of the model (summed match state relative entropy) is less than a cutoff, which is is 6.0 bits by default, but can be changed with the expert, undocumented --eX option. If you really want to play with that option, consult the source code.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	259 - --enone: Turn off the entropy weighting strategy. The effective sequence number is just the number of sequences in the alignment.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	260 - --ere: Set the target mean match state relative entropy. By default the target relative entropy per match position is 0.59 bits for models with at least 1 basepair and 0.38 for models with zero basepairs.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	261 - --eminseq: Define the minimum allowed effective sequence number.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	262 - --ehmmre: Set the target HMM mean match state relative entropy. Entropy for basepairing match states is calculated using marginalized basepair emission probabilities.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	263 - --eset: Set the effective sequence number for entropy weighting.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	264
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	265 Options for refining the input alignment
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	266
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	267 - --refine: Attempt to refine the alignment before building the CM using expectation-maximization (EM). A CM is first built from the initial alignment as usual. Then, the sequences in the alignment are realigned optimally (with the HMM banded CYK algorithm, optimal means optimal given the bands) to the CM, and a new CM is built from the resulting alignment. The sequences are then realigned to the new CM, and a new CM is built from that alignment. This is continued until convergence, specifically when the alignments for two successive iterations are not significantly different (the summed bit scores of all the sequences in the alignment changes less than 1% between two successive iterations).
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	268 - Turn on the local alignment algorithm: allows the alignment to span two or more subsequences if necessary (e.g. if the structures of the query model and target sequence are only partially shared), allowing certain large insertions and deletions in the structure to be penalized differently than normal indels. The default is to globally align the query model to the target sequences.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	269 - --gibbs sampling: Modifies the behavior of --refine so Gibbs sampling is used instead of EM. The difference is that during the alignment stage the alignment is not necessarily optimal, instead an alignment (parsetree) for each sequences is sampled from the posterior distribution of alignments as determined by the Inside algorithm. Due to this sampling step --gibbs is non- deterministic, so different runs with the same alignment may yield different results. This is not true when --refine is used without the --gibbs option, in which case the final alignment and CM will always be the same. When --gibbs is enabled, the --seed "number" option can be used to seed the random number generator predictably, making the results reproducible. The goal of the --gibbs option is to help expert RNA alignment curators refine structural alignments by allowing them to observe alternative high scoring alignments.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	270 - --Random seed: Seed the random number generator with an integer >= 0. This option can only be used in combination with --gibbs. If the given number is nonzero, stochastic sampling of alignments will be reproducible; the same command will give the same results. If the given number is 0, the random number generator is seeded arbitrarily, and stochastic samplings may vary from run to run of the same command. The default seed is 0.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	271 - --Turn off the truncated alignment algorithm: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page.
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	272 - --cyk algorithm: With --refine, align with the CYK algorithm. By default the optimal accuracy algorithm is used. There is more information on this in the cmalign manual page.
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	273
1aa4c036e41c Uploaded bgruening parents: diff changeset	274 For further questions please refere to the Infernal Userguide_.
1aa4c036e41c Uploaded bgruening parents: diff changeset	275
1aa4c036e41c Uploaded bgruening parents: diff changeset	276 .. _Userguide: http://selab.janelia.org/software/infernal/Userguide.pdf
1aa4c036e41c Uploaded bgruening parents: diff changeset	277
13 ffa96097e5b2 Uploaded bgruening parents: 12 diff changeset	278 ]]>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	279 </help>
14 2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	280 <citations>
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	281 <citation type="doi">10.1093/bioinformatics/btt509</citation>
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	282 <citation type="bibtex">
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	283 @ARTICLE{bgruening_galaxytools,
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	284 Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	285 keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	286 title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	287 url = {https://github.com/bgruening/galaxytools}
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	288 }
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	289 </citation>
2f8a8962ae22 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 13 diff changeset	290 </citations>
9 1aa4c036e41c Uploaded bgruening parents: diff changeset	291 </tool>

Mercurial > repos > bgruening > infernal

annotate cmbuild.xml @ 15:e239fae4c2f1 draft