augustus: augustus.xml annotate

annotate augustus.xml @ 12:48528e640fe6 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 211061259f97dfbeb080aaf4713a21f64a1742e1"

author	iuc
date	Fri, 20 Dec 2019 19:07:47 +0000
parents	e519d7b4f9ac
children	66c8e9d8d1c4

rev	line source
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	1 <tool id="augustus" name="Augustus" profile="16.04" version="@VERSION@">
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	2 <description>gene prediction for prokaryotic and eukaryotic genomes</description>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	3 <macros>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	4 <import>macros.xml</import>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	5 </macros>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	6 <expand macro="requirements"/>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	7 <command detect_errors="aggressive">
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	8 <![CDATA[
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	9 #if $model.augustus_mode == 'history'
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	10
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	11 ## Using an augustus model from history, we need to unzip it and let augustus find it
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	12
12 48528e640fe6 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 211061259f97dfbeb080aaf4713a21f64a1742e1" iuc parents: 11 diff changeset	13 cp -r `command -v augustus \| xargs dirname`/../config/ augustus_dir/ &&
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	14
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	15 mkdir -p 'augustus_dir/species/' &&
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	16
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	17 tar -C 'augustus_dir/species/' -xzvf '${model.custom_model}' > /dev/null &&
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	18
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	19 export AUGUSTUS_CONFIG_PATH=`pwd`/augustus_dir/ &&
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	20 #end if
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	21
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	22 ## Augustus writes the protein and coding sequences as comment into the gff/gtf file an external
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	23 ## script is used to extract the sequences into additional files
0 633039f94425 Uploaded bgruening parents: diff changeset	24
1 3c5116448979 Uploaded bgruening parents: 0 diff changeset	25 augustus
3c5116448979 Uploaded bgruening parents: 0 diff changeset	26 --strand=$strand
3c5116448979 Uploaded bgruening parents: 0 diff changeset	27 $noInFrameStop
3c5116448979 Uploaded bgruening parents: 0 diff changeset	28 $gff
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	29 --uniqueGeneId=true
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	30
6 711633263de7 Uploaded bgruening parents: 5 diff changeset	31 #if 'protein' in str($outputs).split(','):
711633263de7 Uploaded bgruening parents: 5 diff changeset	32 --protein=on
711633263de7 Uploaded bgruening parents: 5 diff changeset	33 #else:
711633263de7 Uploaded bgruening parents: 5 diff changeset	34 --protein=off
711633263de7 Uploaded bgruening parents: 5 diff changeset	35 #end if
711633263de7 Uploaded bgruening parents: 5 diff changeset	36
711633263de7 Uploaded bgruening parents: 5 diff changeset	37 #if 'codingseq' in str($outputs).split(','):
711633263de7 Uploaded bgruening parents: 5 diff changeset	38 --codingseq=on
711633263de7 Uploaded bgruening parents: 5 diff changeset	39 #else:
711633263de7 Uploaded bgruening parents: 5 diff changeset	40 --codingseq=off
711633263de7 Uploaded bgruening parents: 5 diff changeset	41 #end if
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	42
6 711633263de7 Uploaded bgruening parents: 5 diff changeset	43 #if 'introns' in str($outputs).split(','):
711633263de7 Uploaded bgruening parents: 5 diff changeset	44 --introns=on
711633263de7 Uploaded bgruening parents: 5 diff changeset	45 #else:
711633263de7 Uploaded bgruening parents: 5 diff changeset	46 --introns=off
711633263de7 Uploaded bgruening parents: 5 diff changeset	47 #end if
711633263de7 Uploaded bgruening parents: 5 diff changeset	48
711633263de7 Uploaded bgruening parents: 5 diff changeset	49 #if 'start' in str($outputs).split(','):
711633263de7 Uploaded bgruening parents: 5 diff changeset	50 --start=on
711633263de7 Uploaded bgruening parents: 5 diff changeset	51 #else:
711633263de7 Uploaded bgruening parents: 5 diff changeset	52 --stop=off
711633263de7 Uploaded bgruening parents: 5 diff changeset	53 #end if
711633263de7 Uploaded bgruening parents: 5 diff changeset	54
711633263de7 Uploaded bgruening parents: 5 diff changeset	55 #if 'stop' in str($outputs).split(','):
711633263de7 Uploaded bgruening parents: 5 diff changeset	56 --stop=on
711633263de7 Uploaded bgruening parents: 5 diff changeset	57 #else:
711633263de7 Uploaded bgruening parents: 5 diff changeset	58 --stop=off
711633263de7 Uploaded bgruening parents: 5 diff changeset	59 #end if
711633263de7 Uploaded bgruening parents: 5 diff changeset	60
711633263de7 Uploaded bgruening parents: 5 diff changeset	61 #if 'cds' in str($outputs).split(','):
711633263de7 Uploaded bgruening parents: 5 diff changeset	62 --cds=on
711633263de7 Uploaded bgruening parents: 5 diff changeset	63 #else:
711633263de7 Uploaded bgruening parents: 5 diff changeset	64 --cds=off
711633263de7 Uploaded bgruening parents: 5 diff changeset	65 #end if
711633263de7 Uploaded bgruening parents: 5 diff changeset	66
1 3c5116448979 Uploaded bgruening parents: 0 diff changeset	67 $singlestrand
3c5116448979 Uploaded bgruening parents: 0 diff changeset	68 $input_genome
3c5116448979 Uploaded bgruening parents: 0 diff changeset	69 $utr
3c5116448979 Uploaded bgruening parents: 0 diff changeset	70 --genemodel=$genemodel
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	71
11 e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	72 #if $hints.usehints == 'T'
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	73 --hintsfile='$hints.hintsfile' --extrinsicCfgFile='$hints.extrinsiccfg'
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	74 #end if
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	75
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	76 #if $range.userange == 'T'
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	77 --predictionStart=$range.start --predictionEnd=$range.stop
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	78 #end if
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	79
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	80 #if $model.augustus_mode == 'history'
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	81 --species=local
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	82 #else
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	83 --species=$model.organism
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	84 #end if
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	85
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	86 \| tee '$output'
8 d2689bbb8d16 Uploaded bgruening parents: 7 diff changeset	87 #if 'protein' in str($outputs).split(',') or 'codingseq' in str($outputs).split(','):
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	88 \| python $__tool_directory__/extract_features.py
8 d2689bbb8d16 Uploaded bgruening parents: 7 diff changeset	89 #if 'protein' in str($outputs).split(','):
2 b8ccbad1b062 Uploaded bgruening parents: 1 diff changeset	90 --protein $protein_output
b8ccbad1b062 Uploaded bgruening parents: 1 diff changeset	91 #end if
8 d2689bbb8d16 Uploaded bgruening parents: 7 diff changeset	92 #if 'codingseq' in str($outputs).split(','):
1 3c5116448979 Uploaded bgruening parents: 0 diff changeset	93 --codingseq $codingseq_output
2 b8ccbad1b062 Uploaded bgruening parents: 1 diff changeset	94 #end if
b8ccbad1b062 Uploaded bgruening parents: 1 diff changeset	95 #end if
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	96 ]]>
0 633039f94425 Uploaded bgruening parents: diff changeset	97 </command>
633039f94425 Uploaded bgruening parents: diff changeset	98 <inputs>
633039f94425 Uploaded bgruening parents: diff changeset	99 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/>
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	100 <param name="noInFrameStop" argument="--noInFrameStop" type="boolean"
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	101 label="Don't report transcripts with in-frame stop codons"
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	102 truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false"
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	103 help="Otherwise, intron-spanning stop codons could occur." />
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	104 <param name="singlestrand" type="boolean" argument="--singlestrand"
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	105 label="Predict genes independently on each strand"
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	106 help="This allows overlapping genes on opposite strands."
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	107 truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" />
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	108
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	109 <param name="utr" type="boolean" argument="--UTR"
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	110 label="Predict the untranslated regions in addition to the coding sequence"
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	111 truevalue="--UTR=on" falsevalue="--UTR=off" checked="false"
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	112 help="This currently works only for human, galdieria, toxoplasma and caenorhabditis." />
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	113
0 633039f94425 Uploaded bgruening parents: diff changeset	114
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	115 <conditional name="model">
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	116 <param name="augustus_mode" type="select" label="Trainingset">
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	117 <option value="builtin">Run Augustus with a predefined trainingset</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	118 <option value="history">Run Augustus with a custom trainingset</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	119 </param>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	120 <when value="history">
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	121 <param name="custom_model" type="data" format="augustus" label="Augustus model" help="Archive created with the 'Train Augustus' tool"/>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	122 </when>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	123 <when value="builtin">
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	124 <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset.">
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	125 <!-- If you update this list, please also update it in maker and busco tools (../maker/maker.xml and ../busco/busco.xml) -->
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	126 <option value="human">Homo sapiens</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	127 <option value="fly">Drosophila melanogaster</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	128 <option value="arabidopsis">Arabidopsis thaliana</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	129 <option value="brugia ">Brugia malayi</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	130 <option value="aedes">Aedes aegypti</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	131 <option value="tribolium2012">Tribolium castaneum</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	132 <option value="schistosoma">Schistosoma mansoni</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	133 <option value="tetrahymena">Tetrahymena thermophila</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	134 <option value="galdieria">Galdieria sulphuraria</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	135 <option value="maize">Zea mays</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	136 <option value="toxoplasma">Toxoplasma gondii</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	137 <option value="caenorhabditis ">Caenorhabditis elegans</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	138 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	139 <option value="aspergillus_nidulans ">Aspergillus nidulans</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	140 <option value="aspergillus_oryzae ">Aspergillus oryzae</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	141 <option value="aspergillus_terreus">Aspergillus terreus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	142 <option value="botrytis_cinerea ">Botrytis cinerea</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	143 <option value="candida_albicans ">Candida albicans</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	144 <option value="candida_guilliermondii ">Candida guilliermondii</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	145 <option value="candida_tropicalis ">Candida tropicalis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	146 <option value="chaetomium_globosum">Chaetomium globosum</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	147 <option value="coccidioides_immitis">Coccidioides immitis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	148 <option value="coprinus">Coprinus cinereus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	149 <option value="coprinus_cinereus">Coprinus cinereus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	150 <option value="cryptococcus_neoformans_gattii">Cryptococcus neoformans gattii</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	151 <option value="cryptococcus_neoformans_neoformans_B">Cryptococcus neoformans neoformans</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	152 <option value="cryptococcus_neoformans_neoformans_JEC21">Cryptococcus neoformans neoformans</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	153 <option value="cryptococcus">Cryptococcus neoformans</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	154 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	155 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	156 <option value="eremothecium_gossypii">Eremothecium gossypii</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	157 <option value="fusarium_graminearum ">Fusarium graminearum</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	158 <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	159 <option value="histoplasma">Histoplasma capsulatum</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	160 <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	161 <option value="laccaria_bicolor ">Laccaria bicolor</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	162 <option value="lamprey">Petromyzon marinus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	163 <option value="leishmania_tarentolae">Leishmania tarentolae</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	164 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	165 <option value="magnaporthe_grisea ">Magnaporthe grisea</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	166 <option value="neurospora_crassa">Neurospora crassa</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	167 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	168 <option value="pichia_stipitis">Pichia stipitis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	169 <option value="rhizopus_oryzae">Rhizopus oryzae</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	170 <option value="saccharomyces_cerevisiae_S288C">Saccharomyces cerevisiae</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	171 <option value="saccharomyces_cerevisiae_rm11-1a_1">Saccharomyces cerevisiae</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	172 <option value="saccharomyces">Saccharomyces cerevisiae</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	173 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	174 <option value="trichinella">Trichinella spiralis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	175 <option value="ustilago_maydis">Ustilago maydis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	176 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	177 <option value="nasonia">Nasonia vitripennis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	178 <option value="tomato">Solanum lycopersicum</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	179 <option value="chlamydomonas">Chlamydomonas reinhardtii</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	180 <option value="amphimedon">Amphimedon queenslandica</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	181 <option value="pneumocystis">Pneumocystis jirovecii</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	182 <option value="chicken">Gallus gallus domesticus (chicken)</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	183 <option value="cacao">Theobroma cacao (cacao)</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	184 <option value="heliconius_melpomene1">Heliconius melpomene</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	185 <option value="xenoturbella">Xenoturbella</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	186 <option value="E_coli_K12">E coli K12</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	187 <option value="c_elegans_trsk">c elegans trsk</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	188 <option value="camponotus_floridanus">Camponotus floridanus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	189 <option value="coyote_tobacco">Coyote tobacco</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	190 <option value="s_aureus">Staphylococcus aureus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	191 <option value="thermoanaerobacter_tengcongensis">Thermoanaerobacter tengcongensis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	192 <option value="wheat">wheat</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	193 <option value="zebrafish">Danio rerio</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	194 <option value="anidulans">Aspergillus nidulans</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	195 <option value="bombus_impatiens1">Bombus impatiens1</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	196 <option value="bombus_terrestris2">Bombus terrestris2</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	197 <option value="botrytis_cinerea">Botrytis cinerea</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	198 <option value="brugia_malayi">Brugia malayi</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	199 <option value="conidiobolus_coronatus">Conidiobolus coronatus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	200 <option value="cryptococcus_neoformans">Cryptococcus neoformans</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	201 <option value="culex_pipiens">Culex pipiens</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	202 <option value="elephant_shark">Callorhinchus milii</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	203 <option value="honeybee1">Apis mellifera</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	204 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	205 <option value="pea_aphid">Acyrthosiphon pisum</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	206 <option value="rhodnius_prolixus">Rhodnius prolixus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	207 <option value="ustilago_maydis">Ustilago maydis</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	208 <option value="verticillium_albo_atrum1">Verticillium albo atrum1</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	209 <option value="verticillium_longisporum1">Verticillium longisporum1</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	210 <option value="Xipophorus_maculatus">Xipophorus_maculatus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	211 <option value="adorsata">adorsata</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	212 <option value="ancylostoma_ceylanicum">ancylostoma_ceylanicum</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	213 <option value="maker2_athal1">maker2_athal1</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	214 <option value="maker2_c_elegans1">maker2_c_elegans1</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	215 <option value="maker2_dmel1">maker2_dmel1</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	216 <option value="maker2_spomb1">maker2_spomb1</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	217 <option value="parasteatoda">parasteatoda</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	218 <option value="rice">rice</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	219 <option value="schistosoma2">schistosoma2</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	220 <option value="sulfolobus_solfataricus">sulfolobus_solfataricus</option>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	221 </param>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	222 </when>
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	223 </conditional>
0 633039f94425 Uploaded bgruening parents: diff changeset	224
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	225 <param name="strand" type="select" argument="--strand"
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	226 label="Predict genes on specific strands">
0 633039f94425 Uploaded bgruening parents: diff changeset	227 <option value="both">both</option>
633039f94425 Uploaded bgruening parents: diff changeset	228 <option value="forward">forward</option>
633039f94425 Uploaded bgruening parents: diff changeset	229 <option value="backward">backward</option>
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	230 </param>
0 633039f94425 Uploaded bgruening parents: diff changeset	231
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	232 <param name="genemodel" label="Gene Model" type="select"
11 e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	233 help="Gene Model to predict, for more information please refer to the help.">
0 633039f94425 Uploaded bgruening parents: diff changeset	234 <option value="complete">complete</option>
633039f94425 Uploaded bgruening parents: diff changeset	235 <option value="partial">partial</option>
633039f94425 Uploaded bgruening parents: diff changeset	236 <option value="intronless">intronless</option>
633039f94425 Uploaded bgruening parents: diff changeset	237 <option value="atleastone">atleastone</option>
633039f94425 Uploaded bgruening parents: diff changeset	238 <option value="exactlyone">exactlyone</option>
633039f94425 Uploaded bgruening parents: diff changeset	239 </param>
633039f94425 Uploaded bgruening parents: diff changeset	240
11 e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	241 <conditional name="hints">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	242 <param name="usehints" label="Use hints (extrinsic information)?" type="select" display="radio">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	243 <option value="F">No</option>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	244 <option value="T">Yes</option>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	245 </param>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	246 <when value="T">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	247 <param name="hintsfile" label="Select hints file from history" type="data" format="gff"
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	248 help="A file containing hints in gff format (--hintsfile)"/>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	249 <param name="extrinsiccfg" label="Select extrinsic configuration file from history" type="data" format="txt"
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	250 help="A .cfg file listing hint sources and their boni and mali (--extrinsicCfgFile)"/>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	251 </when>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	252 <when value="F">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	253 </when>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	254 </conditional>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	255
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	256 <conditional name="range">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	257 <param name="userange" label="Specify prediction sequence range?" type="select" display="radio">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	258 <option value="F">No</option>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	259 <option value="T">Yes</option>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	260 </param>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	261 <when value="T">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	262 <param name="start" label="Starting position" type="integer" value=""
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	263 help="The beginning of the search range (--predictionStart)"/>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	264 <param name="stop" label="Ending position" type="integer" value=""
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	265 help="The end of the search range (--predictionEnd); must be greater than starting position"/>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	266 </when>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	267 <when value="F">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	268 </when>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	269 </conditional>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	270
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	271 <param name="gff" type="boolean" label="GFF formated output"
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	272 help="Standard output is GTF."
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	273 truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" />
0 633039f94425 Uploaded bgruening parents: diff changeset	274
6 711633263de7 Uploaded bgruening parents: 5 diff changeset	275 <param name="outputs" type="select" display="checkboxes" multiple="True" label="Output options">
711633263de7 Uploaded bgruening parents: 5 diff changeset	276 <option value="protein" selected="True">predicted protein sequences (--protein)</option>
711633263de7 Uploaded bgruening parents: 5 diff changeset	277 <option value="codingseq" selected="True">coding sequence as comment in the output file (--codingseq)</option>
711633263de7 Uploaded bgruening parents: 5 diff changeset	278 <option value="introns">predicted intron sequences (--introns)</option>
711633263de7 Uploaded bgruening parents: 5 diff changeset	279 <option value="start">predicted start codons (--start)</option>
711633263de7 Uploaded bgruening parents: 5 diff changeset	280 <option value="stop">predicted stop codons (--stop)</option>
711633263de7 Uploaded bgruening parents: 5 diff changeset	281 <option value="cds" selected="true">CDS region (--cds)</option>
711633263de7 Uploaded bgruening parents: 5 diff changeset	282 </param>
0 633039f94425 Uploaded bgruening parents: diff changeset	283 </inputs>
633039f94425 Uploaded bgruening parents: diff changeset	284 <outputs>
6 711633263de7 Uploaded bgruening parents: 5 diff changeset	285 <data format="gtf" name="output" label="${tool.name} on ${on_string}: GTF/GFF">
0 633039f94425 Uploaded bgruening parents: diff changeset	286 <change_format>
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	287 <when input="gff" value="--gff3=on" format="gff3" />
0 633039f94425 Uploaded bgruening parents: diff changeset	288 </change_format>
633039f94425 Uploaded bgruening parents: diff changeset	289 </data>
6 711633263de7 Uploaded bgruening parents: 5 diff changeset	290 <data format="fasta" name="protein_output" label="${tool.name} on ${on_string}: Protein sequence">
711633263de7 Uploaded bgruening parents: 5 diff changeset	291 <filter>'protein' in outputs</filter>
1 3c5116448979 Uploaded bgruening parents: 0 diff changeset	292 </data>
6 711633263de7 Uploaded bgruening parents: 5 diff changeset	293 <data format="fasta" name="codingseq_output" label="${tool.name} on ${on_string}: Coding sequence">
711633263de7 Uploaded bgruening parents: 5 diff changeset	294 <filter>'codingseq' in outputs</filter>
1 3c5116448979 Uploaded bgruening parents: 0 diff changeset	295 </data>
0 633039f94425 Uploaded bgruening parents: diff changeset	296 </outputs>
633039f94425 Uploaded bgruening parents: diff changeset	297 <tests>
633039f94425 Uploaded bgruening parents: diff changeset	298 <test>
633039f94425 Uploaded bgruening parents: diff changeset	299 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
633039f94425 Uploaded bgruening parents: diff changeset	300 <param name="organism" value="human" />
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	301 <param name="utr" value="True" />
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	302 <output name="output" file="human_augustus_utr-on.gtf" ftype="gtf" lines_diff="6"/>
0 633039f94425 Uploaded bgruening parents: diff changeset	303 </test>
633039f94425 Uploaded bgruening parents: diff changeset	304 <test>
4 c243e17fb224 Uploaded bgruening parents: 3 diff changeset	305 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
0 633039f94425 Uploaded bgruening parents: diff changeset	306 <param name="organism" value="human" />
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	307 <param name="utr" value="True" />
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	308 <param name="gff" value="True" />
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	309 <output name="output" file="human_augustus_utr-on.gff" ftype="gff3" lines_diff="6"/>
0 633039f94425 Uploaded bgruening parents: diff changeset	310 </test>
3 702d9e042295 Uploaded bgruening parents: 2 diff changeset	311 <test>
4 c243e17fb224 Uploaded bgruening parents: 3 diff changeset	312 <param name="input_genome" value="human_augustus.fa" ftype="fasta" />
3 702d9e042295 Uploaded bgruening parents: 2 diff changeset	313 <param name="organism" value="human" />
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	314 <param name="outputs" value="protein,codingseq,introns,cds,start,stop" />
4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	315 <output name="output" file="human_augustus_protein_codingseq_introns_cds_main.gtf" ftype="gtf" lines_diff="6"/>
3 702d9e042295 Uploaded bgruening parents: 2 diff changeset	316 <output name="codingseq_output" file="human_augustus_protein_codingseq_introns_cds_codingseq.fasta" ftype="fasta" />
702d9e042295 Uploaded bgruening parents: 2 diff changeset	317 <output name="protein_output" file="human_augustus_protein_codingseq_introns_cds_protein.fasta" ftype="fasta" />
702d9e042295 Uploaded bgruening parents: 2 diff changeset	318 </test>
11 e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	319 <test>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	320 <param name="input_genome" value="chr2R.truncated.fa" ftype="fasta" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	321 <param name="organism" value="fly" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	322 <param name="usehints" value="T" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	323 <param name="hintsfile" value="hints.truncated.adjusted.gff" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	324 <param name="extrinsiccfg" value="extrinsic.truncated.cfg" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	325 <param name="outputs" value="" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	326 <output name="output" file="augustus.hints.output.gtf" ftype="gtf" lines_diff="12">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	327 <assert_contents>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	328 <has_text_matching expression="chr2R\tAUGUSTUS\tgene\t7560\t9303\t0\.(7[8-9]\|8[0-5])\t-\t.\tchr2R.g1" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	329 <has_text_matching expression="chr2R\tAUGUSTUS\ttranscript\t7560\t9303\t0\.(7[8-9]\|8[0-5])\t-\t.\tchr2R.g1.t1" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	330 </assert_contents>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	331 </output>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	332
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	333 </test>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	334 <test>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	335 <param name="input_genome" value="chr2R.truncated.fa" ftype="fasta" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	336 <param name="organism" value="fly" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	337 <param name="usehints" value="T" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	338 <param name="hintsfile" value="hints.truncated.adjusted.gff" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	339 <param name="extrinsiccfg" value="extrinsic.truncated.cfg" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	340 <param name="userange" value="T" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	341 <param name="start" value="7000" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	342 <param name="stop" value="9000" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	343 <param name="outputs" value="" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	344 <output name="output" file="augustus.hints_and_range.output.gtf" ftype="gtf" lines_diff="12">
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	345 <assert_contents>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	346 <has_text_matching expression="chr2R\tAUGUSTUS\tgene\t7560\t8931\t0.8[2-5]\t-\t.\tchr2R.g1" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	347 <has_text_matching expression="chr2R\tAUGUSTUS\ttranscript\t7560\t8931\t0.8[2-5]\t-\t.\tchr2R.g1.t1" />
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	348 </assert_contents>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	349 </output>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	350 </test>
e519d7b4f9ac planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 0fed5bb024a096dcb5b2858520ba191da7798b6d iuc parents: 10 diff changeset	351
0 633039f94425 Uploaded bgruening parents: diff changeset	352 </tests>
633039f94425 Uploaded bgruening parents: diff changeset	353 <help>
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	354 <![CDATA[
0 633039f94425 Uploaded bgruening parents: diff changeset	355
633039f94425 Uploaded bgruening parents: diff changeset	356 What it does
633039f94425 Uploaded bgruening parents: diff changeset	357
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	358 AUGUSTUS is a gene prediction program for prokaryotes and eukaryotes written by Mario Stanke and Oliver Keller.
0 633039f94425 Uploaded bgruening parents: diff changeset	359 It can be used as an ab initio program, which means it bases its prediction purely on the
633039f94425 Uploaded bgruening parents: diff changeset	360 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources
633039f94425 Uploaded bgruening parents: diff changeset	361 such as EST, MS/MS, protein alignments and synthenic genomic alignments.
633039f94425 Uploaded bgruening parents: diff changeset	362
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	363
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	364 Input
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	365
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	366 Input data for the gene prediction tool Augustus is a FASTA file with a genomic nucleotide sequence.
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	367
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	368
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	369 Output
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	370
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	371 Augustus produces three output files: a FASTA file with predicted coding sequences, a FASTA file with predicted protein sequences and a gtf/GFF output file if selected.
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	372
0 633039f94425 Uploaded bgruening parents: diff changeset	373
633039f94425 Uploaded bgruening parents: diff changeset	374 Parameters
633039f94425 Uploaded bgruening parents: diff changeset	375
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	376 Gene Model:
0 633039f94425 Uploaded bgruening parents: diff changeset	377
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	378 partial: allow prediction of incomplete genes at the sequence boundaries (default)
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	379 intronless: only predict single-exon genes like in prokaryotes and some eukaryotes
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	380 complete: only predict complete genes
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	381 atleastone: predict at least one complete gene
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	382 exactlyone: predict exactly one complete gene
0 633039f94425 Uploaded bgruening parents: diff changeset	383
633039f94425 Uploaded bgruening parents: diff changeset	384
633039f94425 Uploaded bgruening parents: diff changeset	385
633039f94425 Uploaded bgruening parents: diff changeset	386 Example
633039f94425 Uploaded bgruening parents: diff changeset	387
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	388 Suppose you have the following DNA FASTA sequence:
0 633039f94425 Uploaded bgruening parents: diff changeset	389
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	390 >Seq1
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	391 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	392 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	393 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	394 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	395 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
0 633039f94425 Uploaded bgruening parents: diff changeset	396
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	397
cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	398 Running this tool will produce this:
0 633039f94425 Uploaded bgruening parents: diff changeset	399
633039f94425 Uploaded bgruening parents: diff changeset	400 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1\|size1992969) -----
633039f94425 Uploaded bgruening parents: diff changeset	401 #
633039f94425 Uploaded bgruening parents: diff changeset	402 # Constraints/Hints:
633039f94425 Uploaded bgruening parents: diff changeset	403 # (none)
633039f94425 Uploaded bgruening parents: diff changeset	404 # Predicted genes for sequence number 1 on both strands
633039f94425 Uploaded bgruening parents: diff changeset	405 # start gene g1
633039f94425 Uploaded bgruening parents: diff changeset	406 scaffold1\|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6
633039f94425 Uploaded bgruening parents: diff changeset	407 scaffold1\|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1
633039f94425 Uploaded bgruening parents: diff changeset	408 scaffold1\|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	409 scaffold1\|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	410 scaffold1\|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	411 scaffold1\|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	412 scaffold1\|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	413 scaffold1\|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	414 scaffold1\|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	415 scaffold1\|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	416 scaffold1\|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	417 scaffold1\|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	418 scaffold1\|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	419 scaffold1\|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	420 scaffold1\|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6";
633039f94425 Uploaded bgruening parents: diff changeset	421
633039f94425 Uploaded bgruening parents: diff changeset	422
9 4611e8073293 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/augustus commit cf04d83d615ff09c4458982282d422fbef7d83ac iuc parents: 8 diff changeset	423 ]]>
0 633039f94425 Uploaded bgruening parents: diff changeset	424 </help>
10 cb47e789ccaa planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 4a8f640dec78899be470ddd1c436fc0d158c80f3 bgruening parents: 9 diff changeset	425 <expand macro="citations"/>
0 633039f94425 Uploaded bgruening parents: diff changeset	426 </tool>

Mercurial > repos > bgruening > augustus

annotate augustus.xml @ 12:48528e640fe6 draft