changeset 39:9a2a88d1dd4a

Uploaded

--- a/test-data/generate_reads.py	Wed Mar 05 05:42:06 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,118 +0,0 @@
-#!/usr/bin/env python
-
-
-import random
-import math
-
-
-class Region:
-	def __init__(self,start,stop,sequence):
-		self.start = start
-		self.stop = stop
-		self.sequence = sequence.strip().replace("\n","").replace(" ","")
-		if(len(self.sequence) != self.getSpanningLength()):
-			print "ERROR: sequence length: "+str(len(self.sequence))+", while spanning region is: "+str(self.getSpanningLength())
-			import sys
-			sys.exit()
-	
-	def getSpanningLength(self):
-		return abs(self.stop-self.start+1)
-
-class ReadSynthesizer:
-	def __init__(self,chromosome):
-		self.regions = []
-		self.chromosome = chromosome
-	
-	def addRegion(self,region):
-		self.regions.append(region)
-	
-	def produceReads(self,readDensity = 1,read_length = 50):
-		"""
-		Produces uniform reads by walking iteratively over self.regions
-		"""
-		
-		mRNA = self.getTotalmRNA()
-		spanning_length = self.getRegionSpanningLength()
-		n = spanning_length['total'] - read_length + 1
-		
-		j = 0
-		k = 0
-		
-		for i in range(n):
-			#  "alpha is playing the role of k and beta is playing the role of theta"
-			dd = max(0,int(round(random.lognormvariate(math.log(readDensity),0.5))))# Notice this is NOT a binomial distribution!!
-			
-			for d in range(dd):
-				sequence = mRNA[i:i+read_length]
-				
-				if(random.randint(0,1) == 0):
-					strand = 0
-				else:
-					strand = 16
-				flag = strand + 0
-				
-				print "read_"+str(j)+"."+str(i)+"."+str(d)+"\t"+str(flag)+"\t"+self.chromosome+"\t"+str(self.regions[j].start + k)+"\t60\t"+self.getMappingString(read_length,j,k)+"\t*\t0\t0\t"+str(sequence.upper())+"\t*"
-			
-			spanning_length['iter'][j] -= 1
-			if(k >= self.regions[j].getSpanningLength()-1):
-				j += 1
-				k = 0
-			else:
-				k += 1
-	
-	def getMappingString(self,length,j,offset):
-		m = 0
-		
-		out = ""
-		
-		for i in range(length):
-			k = i + offset
-			
-			if(k >= self.regions[j].getSpanningLength()):
-				j += 1
-				
-				out += str(m)+"M"
-				out += (str(self.regions[j].start - self.regions[j-1].stop-1))+"N"
-				m = 1
-				
-				offset = -k
-			else:
-				m += 1
-		
-		out += str(m) + "M"
-		
-		
-		return out
-	
-	def getRegionSpanningLength(self):
-		length = {'total':0,'iter':[]}
-		for r in self.regions:
-			l = r.getSpanningLength()
-			length['iter'].append(l)
-			length['total'] += l
-		return length
-	
-	def getTotalmRNA(self):
-		mRNA = ""
-		for r in self.regions:
-			mRNA += r.sequence
-		return mRNA
-
-#rs = ReadSynthesizer('chr6')
-#rs.addRegion(Region(100,149,'ccaggactggtttctgtaagaaacagcaggagctgtggcagcggcgaaag'))
-#rs.addRegion(Region(151,152,'at'))
-#rs.produceReads(3,50)
-
-
-rs = ReadSynthesizer('chr6')
-rs.addRegion(Region(154360546,154360969,'ccaggactggtttctgtaagaaacagcaggagctgtggcagcggcgaaaggaagcggctgaggcgcttggaacccgaaaagtctcggtgctcctggctacctcgcacagcggtgcccgcccggccgtcagtaccatggacagcagcgctgcccccacgaacgccagcaattgcactgatgccttggcgtactcaagttgctccccagcacccagccccggttcctgggtcaacttgtcccacttagatggcGacctgtccgacccatgcggtccgaaccgcaccgacctgggcgggagagacagcctgtgccctccgaccggcagtccctccatgatcacggccatcacgatcatggccctctactccatcgtgtgcgtggtggggctcttcggaaacttcctggtcatgtatgtgattgtcag'))
-rs.addRegion(Region(154410961,154411313,'atacaccaagatgaagactgccaccaacatctacattttcaaccttgctctggcagatgccttagccaccagtaccctgcccttccagagtgtgaattacctaatgggaacatggccatttggaaccatcctttgcaagatagtgatctccatagattactataacatgttcaccagcatattcaccctctgcaccatgagtgttgatcgatacattgcagtctgccaccctgtcaaggccttagatttccgtactccccgaaatgccaaaattatcaatgtctgcaactggatcctctcttcagccattggtcttcctgtaatgttcatggctacaacaaaatacaggcaag'))
-rs.addRegion(Region(154412087,154412607,'gttccatagattgtacactaacattctctcatccaacctggtactgggaaaacctgctgaagatctgtgttttcatcttcgccttcattatgccagtgctcatcattaccgtgtgctatggactgatgatcttgcgcctcaagagtgtccgcatgctctctggctccaaagaaaaggacaggaatcttcgaaggatcaccaggatggtgctggtggtggtggctgtgttcatcgtctgctggactcccattcacatttacgtcatcattaaagccttggttacaatcccagaaactacgttccagactgtttcttggcacttctgcattgctctaggttacacaaacagctgcctcaacccagtcctttatgcatttctggatgaaaacttcaaacgatgcttcagagagttctgtatcccaacctcttccaacattgagcaacaaaactccactcgaattcgtcagaacactagagaccacccctccacggccaatacagtggatagaactaatcatcag'))
-rs.addRegion(Region(154428600,154428787,'gtggaattgaacctggactgtcactgtgaaaatgcaaagccttggccactgagctacaatgcagggcagtctccatttcccttcccaggaagagtctagagcattaattttgagtttgcaaaggcttgtaactatttcatatgatttttagagctgactatgacatgaaccctaaaattcctgttccc'))
-rs.produceReads(3,50)
-
-
-
-
-
-

--- a/tool_data_table_conf.xml.sample	Wed Mar 05 05:42:06 2014 -0500
+++ b/tool_data_table_conf.xml.sample	Wed Mar 05 05:42:55 2014 -0500
@@ -2,7 +2,7 @@
 <tables>
 	<!-- Locations of all fasta files under genome directory -->
 	<table name="all_fasta" comment_char="#">
-		<columns>name, dbkey, display_name, value</columns>
+		<columns>value, dbkey, name, path</columns>
 		<file path="tool-data/all_fasta.loc" /> 
 	</table>
 </tables>
\ No newline at end of file

--- a/varscan_mpileup2snp_from_bam.xml	Wed Mar 05 05:42:06 2014 -0500
+++ b/varscan_mpileup2snp_from_bam.xml	Wed Mar 05 05:42:55 2014 -0500
@@ -119,10 +119,10 @@
 			</when>
 			<when value="indexed_filtered">
 				<param name="reference_genome" type="select" label="Reference Genome used during alignment (fasta)" >
-					<options from_file="all_fasta.loc">
-						<column name="name" index="0"/>
+					<options from_data_table="all_fasta">
+						<column name="name"  index="2"/>
 						<column name="dbkey" index="1"/>
-						<column name="value" index="3"/>
+						<column name="value" index="3"/><!-- Value is the path of the fasta file -->
 						<filter type="data_meta" ref="alignments" multiple="false" key="dbkey" column="1" />
 						<validator type="no_options" message="No indexes are available for the selected input dataset" />
 					</options>
@@ -130,10 +130,10 @@
 			</when>
 			<when value="indexed_all">
 				<param name="reference_genome" type="select" label="Reference Genome used during alignment (fasta)" >
-					<options from_file="all_fasta.loc">
-						<column name="name" index="0"/>
+					<options from_data_table="all_fasta">
+						<column name="name"  index="2"/>
 						<column name="dbkey" index="1"/>
-						<column name="value" index="3"/>
+						<column name="value" index="3"/><!-- Value is the path of the fasta file -->
 						<validator type="no_options" message="No indexes are available for the selected input dataset" />
 					</options>
 				</param>