annotate test-data/test_11.dbn @ 3:59ab674be4b5 draft

planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit 4b12ac5efae0802d2614747a639475d8778a68b4-dirty
author yhoogstrate
date Mon, 29 Feb 2016 10:43:37 -0500
parents 3125baf6e705
children 21e619c46cb5
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
3
59ab674be4b5 planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit 4b12ac5efae0802d2614747a639475d8778a68b4-dirty
yhoogstrate
parents: 0
diff changeset
1 >Sequence length: 53bp, dE: -46.6072 kcal/mole
0
3125baf6e705 planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit b37cb65736e2a6e76b94a9fa12a5887046437e36
yhoogstrate
parents:
diff changeset
2 GGUGGUCUCGAGCCCUAGACAGCCGGUUUUUUCCGGCCGAGGUUUGAGGCGCC
3
59ab674be4b5 planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit 4b12ac5efae0802d2614747a639475d8778a68b4-dirty
yhoogstrate
parents: 0
diff changeset
3 ((((.(((((((((...((.((((((......)))))))))))))))))))))