Mercurial > repos > yhoogstrate > segmentation_fold
annotate test-data/test_09.dbn @ 3:59ab674be4b5 draft
planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit 4b12ac5efae0802d2614747a639475d8778a68b4-dirty
| author | yhoogstrate |
|---|---|
| date | Mon, 29 Feb 2016 10:43:37 -0500 |
| parents | 3125baf6e705 |
| children | 21e619c46cb5 |
| rev | line source |
|---|---|
|
0
3125baf6e705
planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit b37cb65736e2a6e76b94a9fa12a5887046437e36
yhoogstrate
parents:
diff
changeset
|
1 >Sequence length: 37bp, dE: -30.8072 kcal/mole |
|
3125baf6e705
planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit b37cb65736e2a6e76b94a9fa12a5887046437e36
yhoogstrate
parents:
diff
changeset
|
2 UUCCAGGUGUAGCGGUGAAAUGCGUAGAGAUCUGGAG |
|
3
59ab674be4b5
planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit 4b12ac5efae0802d2614747a639475d8778a68b4-dirty
yhoogstrate
parents:
0
diff
changeset
|
3 ((((((((((((((......)))...))))))))))) |
