Mercurial > repos > willmclaren > ensembl_vep
view variant_effect_predictor/Bio/EnsEMBL/Utils/Sequence.pm @ 1:d6778b5d8382 draft default tip
Deleted selected files
author | willmclaren |
---|---|
date | Fri, 03 Aug 2012 10:05:43 -0400 |
parents | 21066c0abaf5 |
children |
line wrap: on
line source
=head1 LICENSE Copyright (c) 1999-2012 The European Bioinformatics Institute and Genome Research Limited. All rights reserved. This software is distributed under a modified Apache license. For license details, please see http://www.ensembl.org/info/about/code_licence.html =head1 CONTACT Please email comments or questions to the public Ensembl developers list at <dev@ensembl.org>. Questions may also be sent to the Ensembl help desk at <helpdesk@ensembl.org>. =cut =head1 NAME Bio::EnsEMBL::Utils::Sequence - Utility functions for sequences =head1 SYNOPSIS use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp expand); my $seq = 'ACTTTAAAGGCTATCCCAATATG'; print "my sequence = $seq\n"; reverse_comp( \$seq ); print "my reverse comp = $seq\n"; my $compressed_seq = '(AC)3'; print "my expanded seq is = expand($compressed_seq)"; =head1 METHODS =cut package Bio::EnsEMBL::Utils::Sequence; use strict; use warnings; use Exporter; use vars qw(@ISA @EXPORT_OK); @ISA = qw(Exporter); @EXPORT_OK = qw(&reverse_comp &expand); =head2 reverse_comp Arg [1] : reference to a string $seqref Example : use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp); $seq = 'ACCTGAA'; reverse_comp(\$seq); print $seq; Description: Does an in place reverse compliment of a passed in string reference. The string is passed by reference rather than by value for memory efficiency. Returntype : none Exceptions : none Caller : SequenceAdaptor, SliceAdaptor =cut sub reverse_comp { my $seqref = shift; $$seqref = reverse( $$seqref ); $$seqref =~ tr/acgtrymkswhbvdnxACGTRYMKSWHBVDNX/tgcayrkmswdvbhnxTGCAYRKMSWDVBHNX/; return; } =head2 expand Arg [1] : reference to a string $seqref Example : use Bio::EnsEMBL::Utils::Sequence qw(expand); $seq = '(AC)3'; expand(\$seq); print $seq; Description: Expands a genomic sequence. The string is passed by reference rather than by value for memory efficiency. Returntype : none Exceptions : none Caller : SequenceAdaptor, SliceAdaptor =cut sub expand { my $seq_ref = shift; $$seq_ref =~ s/(\w*)\((\w+)\)(\d+)/$1.$2 x $3/eg if ($$seq_ref =~ /\(/);#expressions with parenthesis, expand the alleles return; } 1;