Mercurial > repos > willmclaren > ensembl_vep
view variant_effect_predictor/Bio/EnsEMBL/Compara/GenomicAlign.pm @ 1:d6778b5d8382 draft default tip
Deleted selected files
author | willmclaren |
---|---|
date | Fri, 03 Aug 2012 10:05:43 -0400 |
parents | 21066c0abaf5 |
children |
line wrap: on
line source
=head1 LICENSE Copyright (c) 1999-2012 The European Bioinformatics Institute and Genome Research Limited. All rights reserved. This software is distributed under a modified Apache license. For license details, please see http://www.ensembl.org/info/about/code_licence.html =head1 CONTACT Please email comments or questions to the public Ensembl developers list at <dev@ensembl.org>. Questions may also be sent to the Ensembl help desk at <helpdesk@ensembl.org>. =head1 NAME Bio::EnsEMBL::Compara::GenomicAlign - Defines one of the sequences involved in a genomic alignment =head1 SYNOPSIS use Bio::EnsEMBL::Compara::GenomicAlign; my $genomic_align = new Bio::EnsEMBL::Compara::GenomicAlign( -adaptor => $genomic_align_adaptor, -genomic_align_block => $genomic_align_block, -method_link_species_set => $method_link_species_set, -dnafrag => $dnafrag, -dnafrag_start => 100001, -dnafrag_end => 100050, -dnafrag_strand => -1, -aligned_sequence => "TTGCAGGTAGGCCATCTGCAAGC----TGAGGAGCAAGGACTCCAGTCGGAGTC" -visible => 1, ); SET VALUES $genomic_align->adaptor($adaptor); $genomic_align->dbID(12); $genomic_align->genomic_align_block($genomic_align_block); $genomic_align->genomic_align_block_id(1032); $genomic_align->method_link_species_set($method_link_species_set); $genomic_align->method_link_species_set_id(3); $genomic_align->dnafrag($dnafrag); $genomic_align->dnafrag_id(134); $genomic_align->dnafrag_start(100001); $genomic_align->dnafrag_end(100050); $genomic_align->dnafrag_strand(-1); $genomic_align->aligned_sequence("TTGCAGGTAGGCCATCTGCAAGC----TGAGGAGCAAGGACTCCAGTCGGAGTC"); $genomic_align->original_sequence("TTGCAGGTAGGCCATCTGCAAGCTGAGGAGCAAGGACTCCAGTCGGAGTC"); $genomic_align->cigar_line("23M4D27M"); $genomic_align->visible(1); GET VALUES $adaptor = $genomic_align->adaptor; $dbID = $genomic_align->dbID; $genomic_align_block = $genomic_align->genomic_block; $genomic_align_block_id = $genomic_align->genomic_align_block_id; $method_link_species_set = $genomic_align->method_link_species_set; $method_link_species_set_id = $genomic_align->method_link_species_set_id; $dnafrag = $genomic_align->dnafrag; $dnafrag_id = $genomic_align->dnafrag_id; $dnafrag_start = $genomic_align->dnafrag_start; $dnafrag_end = $genomic_align->dnafrag_end; $dnafrag_strand = $genomic_align->dnafrag_strand; $aligned_sequence = $genomic_align->aligned_sequence; $original_sequence = $genomic_align->original_sequence; $cigar_line = $genomic_align->cigar_line; $visible = $genomic_align->visible; $slice = $genomic_align->get_Slice(); =head1 DESCRIPTION The GenomicAlign object stores information about a single sequence within an alignment. =head1 OBJECT ATTRIBUTES =over =item dbID corresponds to genomic_align.genomic_align_id =item adaptor Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor object to access DB =item genomic_align_block_id corresponds to genomic_align_block.genomic_align_block_id (ext. reference) =item genomic_align_block Bio::EnsEMBL::Compara::DBSQL::GenomicAlignBlock object corresponding to genomic_align_block_id =item method_link_species_set_id corresponds to method_link_species_set.method_link_species_set_id (external ref.) =item method_link_species_set Bio::EnsEMBL::Compara::DBSQL::MethodLinkSpeciesSet object corresponding to method_link_species_set_id =item dnafrag_id corresponds to dnafrag.dnafrag_id (external ref.) =item dnafrag Bio::EnsEMBL::Compara::DnaFrag object corresponding to dnafrag_id =item dnafrag_start corresponds to genomic_align.dnafrag_start =item dnafrag_end corresponds to genomic_align.dnafrag_end =item dnafrag_strand corresponds to genomic_align.dnafrag_strand =item cigar_line corresponds to genomic_align.cigar_line =item visible corresponds to genomic_align.visible =item aligned_sequence corresponds to the sequence rebuilt using dnafrag and cigar_line =item original_sequence corresponds to the original sequence. It can be rebuilt from the aligned_sequence, the dnafrag object or can be used in conjuction with cigar_line to get the aligned_sequence. =back =head1 APPENDIX The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ =cut # Let the code begin... package Bio::EnsEMBL::Compara::GenomicAlign; use strict; use Bio::EnsEMBL::Utils::Exception qw(throw warning deprecate verbose); use Bio::EnsEMBL::Utils::Argument qw(rearrange); use Scalar::Util qw(weaken); use Bio::EnsEMBL::Compara::BaseGenomicAlignSet; use Bio::EnsEMBL::Compara::MethodLinkSpeciesSet; use Bio::EnsEMBL::Mapper; =head2 new (CONSTRUCTOR) Arg [-DBID] : (opt.) int $dbID (the database internal ID for this object) Arg [-ADAPTOR] : (opt.) Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor $adaptor (the adaptor for connecting to the database) Arg [-GENOMIC_ALIGN_BLOCK] : (opt.) Bio::EnsEMBL::Compara::GenomicAlignBlock $genomic_align_block (the block to which this Bio::EnsEMBL::Compara::GenomicAlign object belongs to) Arg [-GENOMIC_ALIGN_BLOCK_ID] : (opt.) int $genomic_align_block_id (the database internal ID for the $genomic_align_block) Arg [-METHOD_LINK_SPECIES_SET] : (opt.) Bio::EnsEMBL::Compara::MethodLinkSpeciesSet $mlss (this defines the type of alignment and the set of species used to get this GenomicAlignBlock) Arg [-METHOD_LINK_SPECIES_SET_ID] : (opt.) int $mlss_id (the database internal ID for the $mlss) Arg [-DNAFRAG] : (opt.) Bio::EnsEMBL::Compara::DnaFrag $dnafrag (the genomic sequence object to which this object refers to) Arg [-DNAFRAG_ID] : (opt.) int $dnafrag_id (the database internal ID for the $dnafrag) Arg [-DNAFRAG_START] : (opt.) int $dnafrag_start (the starting position of this Bio::EnsEMBL::Compara::GenomicAling within its corresponding $dnafrag) Arg [-DNAFRAG_END] : (opt.) int $dnafrag_end (the ending position of this Bio::EnsEMBL::Compara::GenomicAling within its corresponding $dnafrag) Arg [-DNAFRAG_STRAND] : (opt.) int $dnafrag_strand (1 or -1; defines in which strand of its corresponding $dnafrag this Bio::EnsEMBL::Compara::GenomicAlign is) Arg [-ALIGNED_SEQUENCE] : (opt.) string $aligned_sequence (the sequence of this object, including gaps and all) Arg [-CIGAR_LINE] : (opt.) string $cigar_line (a compressed way of representing the indels in the $aligned_sequence of this object) Arg [-VISIBLE] : (opt.) int $visible. Used in self alignments to ensure only one Bio::EnsEMBL::Compara::GenomicAlignBlock is visible when you have more than 1 block covering the same region. Example : my $genomic_align = new Bio::EnsEMBL::Compara::GenomicAlign( -adaptor => $genomic_align_adaptor, -genomic_align_block => $genomic_align_block, -method_link_species_set => $method_link_species_set, -dnafrag => $dnafrag, -dnafrag_start => 100001, -dnafrag_end => 100050, -dnafrag_strand => -1, -aligned_sequence => "TTGCAGGTAGGCCATCTGCAAGC----TGAGGAGCAAGGACTCCAGTCGGAGTC" -visible => 1, ); Description : Creates a new Bio::EnsEMBL::Compara::GenomicAlign object Returntype : Bio::EnsEMBL::Compara::GenomicAlign object Exceptions : none Caller : general Status : Stable =cut sub new { my($class, @args) = @_; my $self = {}; bless $self,$class; my ($cigar_line, $adaptor, $dbID, $genomic_align_block, $genomic_align_block_id, $method_link_species_set, $method_link_species_set_id, $dnafrag, $dnafrag_id, $dnafrag_start, $dnafrag_end, $dnafrag_strand, $aligned_sequence, $visible, $node_id ) = rearrange([qw( CIGAR_LINE ADAPTOR DBID GENOMIC_ALIGN_BLOCK GENOMIC_ALIGN_BLOCK_ID METHOD_LINK_SPECIES_SET METHOD_LINK_SPECIES_SET_ID DNAFRAG DNAFRAG_ID DNAFRAG_START DNAFRAG_END DNAFRAG_STRAND ALIGNED_SEQUENCE VISIBLE NODE_ID)], @args); $self->adaptor( $adaptor ) if defined $adaptor; $self->cigar_line( $cigar_line ) if defined $cigar_line; $self->dbID($dbID) if (defined($dbID)); $self->genomic_align_block($genomic_align_block) if (defined($genomic_align_block)); $self->genomic_align_block_id($genomic_align_block_id) if (defined($genomic_align_block_id)); $self->method_link_species_set($method_link_species_set) if (defined($method_link_species_set)); $self->method_link_species_set_id($method_link_species_set_id) if (defined($method_link_species_set_id)); $self->dnafrag($dnafrag) if (defined($dnafrag)); $self->dnafrag_id($dnafrag_id) if (defined($dnafrag_id)); $self->dnafrag_start($dnafrag_start) if (defined($dnafrag_start)); $self->dnafrag_end($dnafrag_end) if (defined($dnafrag_end)); $self->dnafrag_strand($dnafrag_strand) if (defined($dnafrag_strand)); $self->aligned_sequence($aligned_sequence) if (defined($aligned_sequence)); $self->visible($visible) if (defined($visible)); $self->node_id($node_id) if (defined($node_id)); return $self; } =head2 new_fast Arg [1] : hash reference $hashref Example : none Description: This is an ultra fast constructor which requires knowledge of the objects internals to be used. Returntype : Exceptions : none Caller : Status : Stable =cut sub new_fast { my $class = shift; my $hashref = shift; return bless $hashref, $class; } =head2 copy (CONSTRUCTOR) Arg : -none- Example : my $new_genomic_align = $genomic_align->copy(); Description : Create a new object with the same attributes as this one. Returntype : Bio::EnsEMBL::Compara::GenomicAlign (or subclassed) object Exceptions : Status : Stable =cut sub copy { my ($self) = @_; my $new_copy = {}; bless $new_copy, ref($self); while (my ($key, $value) = each %$self) { $new_copy->{$key} = $value; } return $new_copy; } =head2 adaptor Arg [1] : Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor Example : $adaptor = $genomic_align->adaptor; Example : $genomic_align->adaptor($adaptor); Description: Getter/Setter for the adaptor this object uses for database interaction. Returntype : Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor Exceptions : thrown if $adaptor is not a Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor object Caller : object->methodname Status : Stable =cut sub adaptor { my $self = shift; if (@_) { $self->{'adaptor'} = shift; throw($self->{'adaptor'}." is not a Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor object") if ($self->{'adaptor'} and !UNIVERSAL::isa($self->{'adaptor'}, "Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor")); } return $self->{'adaptor'}; } =head2 dbID Arg [1] : integer $dbID Example : $dbID = $genomic_align->dbID; Example : $genomic_align->dbID(12); Description: Getter/Setter for the attribute dbID Returntype : integer Exceptions : none Caller : object->methodname Status : Stable =cut sub dbID { my ($self, $dbID) = @_; if (defined($dbID)) { $self->{'dbID'} = $dbID; } return $self->{'dbID'}; } =head2 genomic_align_block Arg [1] : Bio::EnsEMBL::Compara::GenomicAlignBlock $genomic_align_block Example : $genomic_align_block = $genomic_align->genomic_align_block; Example : $genomic_align->genomic_align_block($genomic_align_block); Description: Getter/Setter for the attribute genomic_align_block Returntype : Bio::EnsEMBL::Compara::GenomicAlignBlock object. If no argument is given, the genomic_align_block is not defined but both the genomic_align_block_id and the adaptor are, it tries to fetch the data using the genomic_align_block_id. Exception : throws if $genomic_align_block is not a Bio::EnsEMBL::Compara::GenomicAlignBlock object or if $genomic_align_block does not match a previously defined genomic_align_block_id Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub genomic_align_block { my ($self, $genomic_align_block) = @_; if (defined($genomic_align_block)) { throw("$genomic_align_block is not a Bio::EnsEMBL::Compara::BaseGenomicAlignSet object") if (!$genomic_align_block->isa("Bio::EnsEMBL::Compara::BaseGenomicAlignSet")); weaken($self->{'genomic_align_block'} = $genomic_align_block); ## Add adaptor to genomic_align_block object if possible and needed if (!defined($genomic_align_block->{'adaptor'}) and !defined($genomic_align_block->{'_adaptor'}) and defined($self->{'adaptor'})) { $genomic_align_block->adaptor($self->adaptor->db->get_GenomicAlignBlockAdaptor); } if ($genomic_align_block->isa("Bio::EnsEMBL::Compara::GenomicAlignBlock")) { if ($self->{'genomic_align_block_id'}) { if (!$self->{'genomic_align_block'}->{'dbID'}) { $self->{'genomic_align_block'}->dbID($self->{'genomic_align_block_id'}); } # warning("Defining both genomic_align_block_id and genomic_align_block"); throw("dbID of genomic_align_block object does not match previously defined". " genomic_align_block_id. If you want to override a". " Bio::EnsEMBL::Compara::GenomicAlign object, you can reset the ". "genomic_align_block_id using \$genomic_align->genomic_align_block_id(0)") if ($self->{'genomic_align_block'}->{'dbID'} != $self->{'genomic_align_block_id'}); } else { $self->{'genomic_align_block_id'} = $genomic_align_block->{'dbID'}; } } } elsif (!defined($self->{'genomic_align_block'})) { # Try to get the genomic_align_block from other sources... if (defined($self->genomic_align_block_id) and defined($self->{'adaptor'})) { # ...from the genomic_align_block_id. Uses genomic_align_block_id function # and not the attribute in the <if> clause because the attribute can be retrieved from other # sources if it has not been set before. my $genomic_align_block_adaptor = $self->{'adaptor'}->db->get_GenomicAlignBlockAdaptor; $self->{'genomic_align_block'} = $genomic_align_block_adaptor->fetch_by_dbID( $self->{'genomic_align_block_id'}); } else { # warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->genomic_align_block". # " You either have to specify more information (see perldoc for". # " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'genomic_align_block'}; } =head2 genomic_align_block_id Arg [1] : integer $genomic_align_block_id Example : $genomic_align_block_id = $genomic_align->genomic_align_block_id; Example : $genomic_align->genomic_align_block_id(1032); Description: Getter/Setter for the attribute genomic_align_block_id. If no argument is given and the genomic_align_block_id is not defined, it tries to get the data from other sources like the corresponding Bio::EnsEMBL::Compara::GenomicAlignBlock object or the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. Use 0 as argument to clear this attribute. Returntype : integer Exceptions : thrown if $genomic_align_block_id does not match a previously defined genomic_align_block Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub genomic_align_block_id { my ($self, $genomic_align_block_id) = @_; if (defined($genomic_align_block_id)) { $self->{'genomic_align_block_id'} = ($genomic_align_block_id or undef); if (defined($self->{'genomic_align_block'}) and $self->{'genomic_align_block_id'}) { # warning("Defining both genomic_align_block_id and genomic_align_block"); throw("genomic_align_block_id does not match previously defined genomic_align_block object") if ($self->{'genomic_align_block'} and $self->{'genomic_align_block'}->dbID != $self->{'genomic_align_block_id'}); } } elsif (!($self->{'genomic_align_block_id'})) { # Try to get the ID from other sources... if (defined($self->{'genomic_align_block'})) { if ($self->{genomic_align_block}->isa("Bio::EnsEMBL::Compara::GenomicAlignBlock")and defined($self->{'genomic_align_block'}->dbID)) { # ...from the corresponding Bio::EnsEMBL::Compara::GenomicAlignBlock object $self->{'genomic_align_block_id'} = $self->{'genomic_align_block'}->dbID; } } elsif (defined($self->{'adaptor'}) and defined($self->{'dbID'})) { # ...from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } else { # warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->genomic_align_block_id". # " You either have to specify more information (see perldoc for". # " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'genomic_align_block_id'}; } =head2 method_link_species_set Arg [1] : Bio::EnsEMBL::Compara::MethodLinkSpeciesSet $method_link_species_set Example : $method_link_species_set = $genomic_align->method_link_species_set; Example : $genomic_align->method_link_species_set($method_link_species_set); Description: Getter/Setter for the attribute method_link_species_set. If no argument is given and the method_link_species_set is not defined, it tries to get the data from other sources like the corresponding Bio::EnsEMBL::Compara::GenomicAlignBlock object or from the method_link_species_set_id. Returntype : Bio::EnsEMBL::Compara::MethodLinkSpeciesSet object Exceptions : thrown if $method_link_species_set is not a Bio::EnsEMBL::Compara::MethodLinkSpeciesSet object or if $method_link_species_set does not match a previously defined method_link_species_set_id Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub method_link_species_set { my ($self, $method_link_species_set) = @_; if (defined($method_link_species_set)) { throw("$method_link_species_set is not a Bio::EnsEMBL::Compara::MethodLinkSpeciesSet object") if (!$method_link_species_set->isa("Bio::EnsEMBL::Compara::MethodLinkSpeciesSet")); $self->{'method_link_species_set'} = $method_link_species_set; if ($self->{'method_link_species_set_id'}) { if (!$self->{'method_link_species_set'}->dbID) { $self->{'method_link_species_set'}->dbID($self->{'method_link_species_set_id'}); } else { $self->{'method_link_species_set_id'} = $self->{'method_link_species_set'}->dbID(); } } else { $self->{'method_link_species_set_id'} = $self->{'method_link_species_set'}->dbID; } } elsif (!defined($self->{'method_link_species_set'})) { # Try to get the object from other sources... if (defined($self->genomic_align_block) and ($self->{'genomic_align_block'}->method_link_species_set)) { # ...from the corresponding Bio::EnsEMBL::Compara::GenomicAlignBlock object. Uses genomic_align_block # function and not the attribute in the <if> clause because the attribute can be retrieved from other # sources if it has not been already defined. $self->{'method_link_species_set'} = $self->genomic_align_block->method_link_species_set; } elsif (defined($self->method_link_species_set_id) and defined($self->{'adaptor'})) { # ...from the method_link_species_set_id. Uses method_link_species_set_id function and not the attribute # in the <if> clause because the attribute can be retrieved from other sources if it has not been # already defined. my $method_link_species_set_adaptor = $self->adaptor->db->get_MethodLinkSpeciesSetAdaptor; $self->{'method_link_species_set'} = $method_link_species_set_adaptor->fetch_by_dbID( $self->{'method_link_species_set_id'}); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->method_link_species_set". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'method_link_species_set'}; } =head2 method_link_species_set_id Arg [1] : integer $method_link_species_set_id Example : $method_link_species_set_id = $genomic_align->method_link_species_set_id; Example : $genomic_align->method_link_species_set_id(3); Description: Getter/Setter for the attribute method_link_species_set_id. If no argument is given and the method_link_species_set_id is not defined, it tries to get the data from other sources like the corresponding Bio::EnsEMBL::Compara::MethodLinkSpeciesSet object or the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. Use 0 as argument to clear this attribute. Returntype : integer Exceptions : thrown if $method_link_species_set_id does not match a previously defined method_link_species_set Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub method_link_species_set_id { my ($self, $method_link_species_set_id) = @_; if (defined($method_link_species_set_id)) { $self->{'method_link_species_set_id'} = $method_link_species_set_id; if (defined($self->{'method_link_species_set'}) and $self->{'method_link_species_set_id'}) { $self->{'method_link_species_set'} = undef; } } elsif (!$self->{'method_link_species_set_id'}) { # Try to get the ID from other sources... if (defined($self->{'method_link_species_set'}) and $self->{'method_link_species_set'}->dbID) { # ...from the corresponding Bio::EnsEMBL::Compara::MethodLinkSpeciesSet object $self->{'method_link_species_set_id'} = $self->{'method_link_species_set'}->dbID; } elsif (defined($self->{'dbID'}) and defined($self->{'adaptor'})) { # ...from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->method_link_species_set_id". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'method_link_species_set_id'}; } =head2 genome_db Arg [1] : Bio::EnsEMBL::Compara::GenomeDB $genome_db Example : $genome_db = $genomic_align->genome_db; Example : $genomic_align->genome_db($genome_db); Description: Getter/Setter for the attribute genome_db of the dnafrag. This method is a short cut for $genomic_align->dnafrag->genome_db() Returntype : Bio::EnsEMBL::Compara::DnaFrag object Exceptions : thrown if $genomic_align->dnafrag is not defined and cannot be fetched from other sources. Caller : object->methodname Status : Stable =cut sub genome_db { my ($self, $genome_db) = @_; if (defined($genome_db)) { throw("$genome_db is not a Bio::EnsEMBL::Compara::GenomeDB object") if (!UNIVERSAL::isa($genome_db, "Bio::EnsEMBL::Compara::GenomeDB")); my $dnafrag = $self->dnafrag(); if (!$dnafrag) { throw("Cannot set genome_db if dnafrag does not exist"); } else { $self->dnafrag->genome_db($genome_db); } } return $self->dnafrag->genome_db; } =head2 dnafrag Arg [1] : Bio::EnsEMBL::Compara::DnaFrag $dnafrag Example : $dnafrag = $genomic_align->dnafrag; Example : $genomic_align->dnafrag($dnafrag); Description: Getter/Setter for the attribute dnafrag. If no argument is given, the dnafrag is not defined but both the dnafrag_id and the adaptor are, it tries to fetch the data using the dnafrag_id Returntype : Bio::EnsEMBL::Compara::DnaFrag object Exceptions : thrown if $dnafrag is not a Bio::EnsEMBL::Compara::DnaFrag object or if $dnafrag does not match a previously defined dnafrag_id Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub dnafrag { my ($self, $dnafrag) = @_; if (defined($dnafrag)) { throw("$dnafrag is not a Bio::EnsEMBL::Compara::DnaFrag object") if (!$dnafrag->isa("Bio::EnsEMBL::Compara::DnaFrag")); $self->{'dnafrag'} = $dnafrag; if ($self->{'dnafrag_id'}) { if (!$self->{'dnafrag'}->dbID) { $self->{'dnafrag'}->dbID($self->{'dnafrag_id'}); } # warning("Defining both dnafrag_id and dnafrag"); throw("dnafrag object does not match previously defined dnafrag_id") if ($self->{'dnafrag'}->dbID != $self->{'dnafrag_id'}); } else { $self->{'dnafrag_id'} = $self->{'dnafrag'}->dbID; } } elsif (!defined($self->{'dnafrag'})) { # Try to get data from other sources... if (defined($self->dnafrag_id) and defined($self->{'adaptor'})) { # ...from the dnafrag_id. Use dnafrag_id function and not the attribute in the <if> # clause because the attribute can be retrieved from other sources if it has not been already defined. my $dnafrag_adaptor = $self->adaptor->db->get_DnaFragAdaptor; $self->{'dnafrag'} = $dnafrag_adaptor->fetch_by_dbID($self->{'dnafrag_id'}); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->dnafrag". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'dnafrag'}; } =head2 dnafrag_id Arg [1] : integer $dnafrag_id Example : $dnafrag_id = $genomic_align->dnafrag_id; Example : $genomic_align->dnafrag_id(134); Description: Getter/Setter for the attribute dnafrag_id. If no argument is given and the dnafrag_id is not defined, it tries to get the ID from other sources like the corresponding Bio::EnsEMBL::Compara::DnaFrag object or the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. Use 0 as argument to clear this attribute. Returntype : integer Exceptions : thrown if $dnafrag_id does not match a previously defined dnafrag Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub dnafrag_id { my ($self, $dnafrag_id) = @_; if (defined($dnafrag_id)) { $self->{'dnafrag_id'} = $dnafrag_id; if (defined($self->{'dnafrag'}) and $self->{'dnafrag_id'}) { # warning("Defining both dnafrag_id and dnafrag"); throw("dnafrag_id does not match previously defined dnafrag object") if ($self->{'dnafrag'} and $self->{'dnafrag'}->dbID != $self->{'dnafrag_id'}); } } elsif (!($self->{'dnafrag_id'})) { # Try to get the ID from other sources... if (defined($self->{'dnafrag'}) and defined($self->{'dnafrag'}->dbID)) { # ...from the corresponding Bio::EnsEMBL::Compara::DnaFrag object $self->{'dnafrag_id'} = $self->{'dnafrag'}->dbID; } elsif (defined($self->{'adaptor'}) and defined($self->{'dbID'})) { # ...from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->dnafrag_id". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'dnafrag_id'}; } =head2 dnafrag_start Arg [1] : integer $dnafrag_start Example : $dnafrag_start = $genomic_align->dnafrag_start; Example : $genomic_align->dnafrag_start(1233354); Description: Getter/Setter for the attribute dnafrag_start. If no argument is given, the dnafrag_start is not defined but both the dbID and the adaptor are, it tries to fetch and set all the direct attributes from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. Returntype : integer Exceptions : none Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub dnafrag_start { my ($self, $dnafrag_start) = @_; if (defined($dnafrag_start)) { $self->{'dnafrag_start'} = $dnafrag_start; } elsif (!defined($self->{'dnafrag_start'})) { if (defined($self->{'dbID'}) and defined($self->{'adaptor'})) { # Try to get the values from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->dnafrag_start". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'dnafrag_start'}; } =head2 dnafrag_end Arg [1] : integer $dnafrag_end Example : $dnafrag_end = $genomic_align->dnafrag_end; Example : $genomic_align->dnafrag_end(1235320); Description: Getter/Setter for the attribute dnafrag_end. If no argument is given, the dnafrag_end is not defined but both the dbID and the adaptor are, it tries to fetch and set all the direct attributes from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. Returntype : integer Exceptions : none Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub dnafrag_end { my ($self, $dnafrag_end) = @_; if (defined($dnafrag_end)) { $self->{'dnafrag_end'} = $dnafrag_end; } elsif (!defined($self->{'dnafrag_end'})) { if (defined($self->{'dbID'}) and defined($self->{'adaptor'})) { # Try to get the values from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->dnafrag_end". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'dnafrag_end'}; } =head2 dnafrag_strand Arg [1] : integer $dnafrag_strand (1 or -1) Example : $dnafrag_strand = $genomic_align->dnafrag_strand; Example : $genomic_align->dnafrag_strand(1); Description: Getter/Setter for the attribute dnafrag_strand. If no argument is given, the dnafrag_strand is not defined but both the dbID and the adaptor are, it tries to fetch and set all the direct attributes from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. Returntype : integer Exceptions : none Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub dnafrag_strand { my ($self, $dnafrag_strand) = @_; if (defined($dnafrag_strand)) { $self->{'dnafrag_strand'} = $dnafrag_strand; } elsif (!defined($self->{'dnafrag_strand'})) { if (defined($self->{'dbID'}) and defined($self->{'adaptor'})) { # Try to get the values from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->dnafrag_strand". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'dnafrag_strand'}; } =head2 aligned_sequence Arg [1...] : string $aligned_sequence or string @flags Example : $aligned_sequence = $genomic_align->aligned_sequence Example : $aligned_sequence = $genomic_align->aligned_sequence("+FIX_SEQ"); Example : $genomic_align->aligned_sequence("ACTAGTTAGCT---TATCT--TTAAA") Description: With no arguments, rebuilds the alignment string for this sequence using the cigar_line information and the original sequence if needed. This sequence depends on the strand defined by the dnafrag_strand attribute. Flags : +FIX_SEQ With this flag, the method will return a sequence that could be directly aligned with the original_sequence of the reference genomic_align. Returntype : string $aligned_sequence Exceptions : thrown if sequence contains unknown symbols Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub aligned_sequence { my ($self, @aligned_sequence_or_flags) = @_; my $aligned_sequence; my $fix_seq = 0; my $fake_seq = 0; foreach my $flag (@aligned_sequence_or_flags) { if ($flag =~ /^\+/) { if ($flag eq "+FIX_SEQ") { $fix_seq = 1; } elsif ($flag eq "+FAKE_SEQ") { $fake_seq = 1; } else { warning("Unknow flag $flag when calling". " Bio::EnsEMBL::Compara::GenomicAlign::aligned_sequence()"); } } else { $aligned_sequence = $flag; } } if (defined($aligned_sequence)) { $aligned_sequence =~ s/[\r\n]+$//; if ($aligned_sequence) { ## Check sequence throw("Unreadable sequence ($aligned_sequence)") if ($aligned_sequence !~ /^[\-\.A-Z]+$/i); $self->{'aligned_sequence'} = $aligned_sequence; } else { $self->{'aligned_sequence'} = undef; } } elsif (!defined($self->{'aligned_sequence'})) { # Try to get the aligned_sequence from other sources... if (defined($self->cigar_line) and $fake_seq) { # ...from the corresponding cigar_line (using a fake seq) $aligned_sequence = _get_fake_aligned_sequence_from_cigar_line( $self->{'cigar_line'}); } elsif (defined($self->cigar_line) and defined($self->original_sequence)) { my $original_sequence = $self->original_sequence; # ...from the corresponding orginial_sequence and cigar_line $aligned_sequence = _get_aligned_sequence_from_original_sequence_and_cigar_line( $original_sequence, $self->{'cigar_line'}); $self->{'aligned_sequence'} = $aligned_sequence; } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->aligned_sequence". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } $aligned_sequence = $self->{'aligned_sequence'} if (defined($self->{'aligned_sequence'})); if ($aligned_sequence and $fix_seq) { $aligned_sequence = _get_aligned_sequence_from_original_sequence_and_cigar_line( $aligned_sequence, $self->genomic_align_block->reference_genomic_align->cigar_line, $fix_seq); } return $aligned_sequence; } =head2 length Arg [1] : -none- Example : $length = $genomic_align->length; Description: get the length of the aligned sequence. This method will try to get the length from the aligned_sequence if already set or by parsing the cigar_line otherwise Returntype : int Exceptions : none Warning : Caller : object->methodname Status : Stable =cut sub length { my $self = shift; if ($self->{aligned_sequence}) { return length($self->{aligned_sequence}); } elsif ($self->{cigar_line}) { my $length = 0; my $cigar_line = $self->{cigar_line}; my @cig = ( $cigar_line =~ /(\d*[GMDXI])/g ); for my $cigElem ( @cig ) { my $cigType = substr( $cigElem, -1, 1); my $cigCount = substr( $cigElem, 0 , -1); $cigCount = 1 if ($cigCount eq ""); $length += $cigCount unless ($cigType eq "I"); } return $length; } return undef; } =head2 cigar_line Arg [1] : string $cigar_line Example : $cigar_line = $genomic_align->cigar_line; Example : $genomic_align->cigar_line("35M2D233M7D23MD100M"); Description: get/set for attribute cigar_line. If no argument is given, the cigar line has not been defined yet but the aligned sequence was, it calculates the cigar line based on the aligned (gapped) sequence. If no argument is given, the cigar_line is not defined but both the dbID and the adaptor are, it tries to fetch and set all the direct attributes from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. You can reset this attribute using an empty string as argument. The cigar_line depends on the strand defined by the dnafrag_strand attribute. Returntype : string Exceptions : none Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub cigar_line { my ($self, $arg) = @_; if (defined($arg)) { if ($arg) { $self->{'cigar_line'} = $arg; } else { $self->{'cigar_line'} = undef; } } elsif (!defined($self->{'cigar_line'})) { # Try to get the cigar_line from other sources... if (defined($self->{'aligned_sequence'})) { # ...from the aligned sequence my $cigar_line = _get_cigar_line_from_aligned_sequence($self->{'aligned_sequence'}); $self->cigar_line($cigar_line); } elsif (defined($self->{'dbID'}) and defined($self->{'adaptor'})) { # ...from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->cigar_line". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'cigar_line'}; } =head2 visible Arg [1] : int $visible Example : $visible = $genomic_align->visible Example : $genomic_align->visible(1); Description: get/set for attribute visible. If no argument is given, visible is not defined but both the dbID and the adaptor are, it tries to fetch and set all the direct attributes from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. Returntype : int Exceptions : none Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub visible { my ($self, $visible) = @_; if (defined($visible)) { $self->{'visible'} = $visible; } elsif (!defined($self->{'visible'})) { if (defined($self->{'dbID'}) and defined($self->{'adaptor'})) { # Try to get the values from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->visible". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'visible'}; } =head2 node_id Arg [1] : [optional] int $node_id Example : $node_id = $genomic_align->node_id; Example : $genomic_align->node_id(5530000000004); Description: get/set for the node_id.This links the Bio::EnsEMBL::Compara::GenomicAlign to the Bio::EnsEMBL::Compara::GenomicAlignTree. The default value is NULL. If no argument is given, the node_id is not defined but both the dbID and the adaptor are, it tries to fetch and set all the direct attributes from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object. Returntype : int Exceptions : none Warning : warns if getting data from other sources fails. Caller : object->methodname Status : At risk =cut sub node_id { my ($self, $node_id) = @_; if (defined($node_id)) { $self->{'node_id'} = $node_id; } elsif (!defined($self->{'node_id'})) { if (defined($self->{'dbID'}) and defined($self->{'adaptor'})) { # Try to get the values from the database using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object $self->adaptor->retrieve_all_direct_attributes($self); } } return $self->{'node_id'}; } =head2 genomic_align_group Arg [2] : [optional] Bio::EnsEMBL::Compara::GenomicAlignGroup $genomic_align_group Example : $genomic_align_group = $genomic_align->genomic_align_group(); Example : $genomic_align->genomic_align_group($genomic_align_group); Description: get/set for the Bio::EnsEMBL::Compara::GenomicAlginGroup object corresponding to this Bio::EnsEMBL::Compara::GenomicAlign object Returntype : int Exceptions : none Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub genomic_align_group { my ($self, $genomic_align_group) = @_; deprecate("Removed genomic_align_group table"); } =head2 genomic_align_group_id Arg [2] : [optional] int $genomic_align_group_id Example : $genomic_align_group_id = $genomic_align->genomic_align_group_id(); Example : $genomic_align->genomic_align_group_id(18); Description: get/set for the genomic_align_group_id corresponding to this Bio::EnsEMBL::Compara::GenomicAlign object Returntype : int Exceptions : none Warning : warns if getting data from other sources fails. Caller : object->methodname Status : Stable =cut sub genomic_align_group_id { my ($self, $genomic_align_group_id) = @_; deprecate("Removed genomic_align_group table"); } =head2 original_sequence Arg [1] : none Example : $original_sequence = $genomic_align->original_sequence Description: get/set original sequence. If no argument is given and the original_sequence is not defined, it tries to fetch the data from other sources like the aligned sequence or the the Bio::EnsEMBL::Compara:DnaFrag object. You can reset this attribute using an empty string as argument. This sequence depends on the strand defined by the dnafrag_strand attribute. Returntype : string $original_sequence Exceptions : Caller : object->methodname Status : Stable =cut sub original_sequence { my ($self, $original_sequence) = @_; if (defined($original_sequence)) { if ($original_sequence) { $self->{'original_sequence'} = $original_sequence; } else { $self->{'original_sequence'} = undef; } } elsif (!defined($self->{'original_sequence'})) { # Try to get the data from other sources... if ($self->{'aligned_sequence'} and $self->{'cigar_line'} !~ /I/) { # ...from the aligned sequence $self->{'original_sequence'} = $self->{'aligned_sequence'}; $self->{'original_sequence'} =~ s/\-//g; } elsif (!defined($self->{'original_sequence'}) and defined($self->dnafrag) and defined($self->dnafrag_start) and defined($self->dnafrag_end) and defined($self->dnafrag_strand) and defined($self->dnafrag->slice)) { # ...from the dnafrag object. Uses dnafrag, dnafrag_start and dnafrag_methods instead of the attibutes # in the <if> clause because the attributes can be retrieved from other sources if they have not been # already defined. $self->{'original_sequence'} = $self->dnafrag->slice->subseq( $self->dnafrag_start, $self->dnafrag_end, $self->dnafrag_strand ); } else { warning("Fail to get data from other sources in Bio::EnsEMBL::Compara::GenomicAlign->genomic_align_groups". " You either have to specify more information (see perldoc for". " Bio::EnsEMBL::Compara::GenomicAlign) or to set it up directly"); } } return $self->{'original_sequence'}; } =head2 _get_cigar_line_from_aligned_sequence Arg [1] : string $aligned_sequence Example : $cigar_line = _get_cigar_line_from_aligned_sequence("CGT-AACTGATG--TTA") Description: get cigar line from gapped sequence Returntype : string $cigar_line Exceptions : Caller : methodname Status : Stable =cut sub _get_cigar_line_from_aligned_sequence { my ($aligned_sequence) = @_; my $cigar_line = ""; my @pieces = grep {$_} split(/(\-+)|(\.+)/, $aligned_sequence); foreach my $piece (@pieces) { my $mode; if ($piece =~ /\-/) { $mode = "D"; # D for gaps (deletions) } elsif ($piece =~ /\./) { $mode = "X"; # X for pads (in 2X genomes) } else { $mode = "M"; # M for matches/mismatches } if (CORE::length($piece) == 1) { $cigar_line .= $mode; } elsif (CORE::length($piece) > 1) { #length can be 0 if the sequence starts with a gap $cigar_line .= CORE::length($piece).$mode; } } return $cigar_line; } =head2 _get_aligned_sequence_from_original_sequence_and_cigar_line Arg [1] : string $original_sequence Arg [1] : string $cigar_line Example : $aligned_sequence = _get_aligned_sequence_from_original_sequence_and_cigar_line( "CGTAACTGATGTTA", "3MD8M2D3M") Description: get gapped sequence from original one and cigar line Returntype : string $aligned_sequence Exceptions : thrown if cigar_line does not match sequence length Caller : methodname Status : Stable =cut sub _get_aligned_sequence_from_original_sequence_and_cigar_line { my ($original_sequence, $cigar_line, $fix_seq) = @_; my $aligned_sequence = ""; return undef if (!defined($original_sequence) or !$cigar_line); my $seq_pos = 0; my @cig = ( $cigar_line =~ /(\d*[GMDXI])/g ); for my $cigElem ( @cig ) { my $cigType = substr( $cigElem, -1, 1 ); my $cigCount = substr( $cigElem, 0 ,-1 ); $cigCount = 1 unless ($cigCount =~ /^\d+$/); if( $cigType eq "M" ) { $aligned_sequence .= substr($original_sequence, $seq_pos, $cigCount); $seq_pos += $cigCount; } elsif( $cigType eq "I") { $seq_pos += $cigCount; } elsif( $cigType eq "X") { $aligned_sequence .= "." x $cigCount; } elsif( $cigType eq "G" || $cigType eq "D") { if ($fix_seq) { $seq_pos += $cigCount; } else { $aligned_sequence .= "-" x $cigCount; } } } throw("Cigar line ($seq_pos) does not match sequence length (".CORE::length($original_sequence).")") if ($seq_pos != CORE::length($original_sequence)); return $aligned_sequence; } =head2 _get_fake_aligned_sequence_from_cigar_line Arg [1] : string $cigar_line Example : $aligned_sequence = _get_fake_aligned_sequence_from_cigar_line( "3MD8M2D3M") Description: get gapped sequence of N\'s from the cigar line Returntype : string $fake_aligned_sequence or undef if no $cigar_line Exceptions : Caller : methodname Status : Stable =cut sub _get_fake_aligned_sequence_from_cigar_line { my ($cigar_line, $fix_seq) = @_; my $fake_aligned_sequence = ""; return undef if (!$cigar_line); my $seq_pos = 0; my @cig = ( $cigar_line =~ /(\d*[GMDXI])/g ); for my $cigElem ( @cig ) { my $cigType = substr( $cigElem, -1, 1 ); my $cigCount = substr( $cigElem, 0 ,-1 ); $cigCount = 1 if ($cigCount eq ""); if( $cigType eq "M" ) { $fake_aligned_sequence .= "N" x $cigCount; $seq_pos += $cigCount; } elsif( $cigType eq "I") { $seq_pos += $cigCount; } elsif( $cigType eq "X") { $fake_aligned_sequence .= "." x $cigCount; } elsif( $cigType eq "G" || $cigType eq "D") { if ($fix_seq) { $seq_pos += $cigCount; } else { $fake_aligned_sequence .= "-" x $cigCount; } } } return $fake_aligned_sequence; } =head2 _print Arg [1] : ref to a FILEHANDLE Example : $genomic_align->_print Description: print attributes of the object to the STDOUT or to the FILEHANDLE. Used for debuging purposes. Returntype : none Exceptions : Caller : object->methodname Status : At risk =cut sub _print { my ($self, $FILEH) = @_; my $verbose = verbose; verbose(0); $FILEH ||= \*STDOUT; print $FILEH "Bio::EnsEMBL::Compara::GenomicAlign object ($self) dbID = ".($self->dbID or "-undef-")." adaptor = ".($self->adaptor or "-undef-")." genomic_align_block = ".($self->genomic_align_block or "-undef-")." genomic_align_block_id = ".($self->genomic_align_block_id or "-undef-")." method_link_species_set = ".($self->method_link_species_set or "-undef-")." method_link_species_set_id = ".($self->method_link_species_set_id or "-undef-")." dnafrag = ".($self->dnafrag or "-undef-")." dnafrag_id = ".($self->dnafrag_id or "-undef-")." dnafrag_start = ".($self->dnafrag_start or "-undef-")." dnafrag_end = ".($self->dnafrag_end or "-undef-")." dnafrag_strand = ".($self->dnafrag_strand or "-undef-")." cigar_line = ".($self->cigar_line or "-undef-")." visible = ".($self->visible or "-undef-")." original_sequence = ".($self->original_sequence or "-undef-")." aligned_sequence = ".($self->aligned_sequence or "-undef-")." "; verbose($verbose); } =head2 display_id Args : none Example : my $id = $genomic_align->display_id; Description: returns string describing this genomic_align which can be used as display_id of a Bio::Seq object or in a fasta file. The actual form is taxon_id:genome_db_id:coord_system_name:dnafrag_name:dnafrag_start:dnafrag_end:dnafrag_strand e.g. 9606:1:chromosome:14:50000000:51000000:-1 Uses dnafrag information in addition to start and end. Returntype : string Exceptions : none Caller : general Status : Stable =cut sub display_id { my $self = shift; my $dnafrag = $self->dnafrag; return "" unless($dnafrag); my $id = join(':', $dnafrag->genome_db->taxon_id, $dnafrag->genome_db->dbID, $dnafrag->coord_system_name, $dnafrag->name, $self->dnafrag_start, $self->dnafrag_end, $self->dnafrag_strand); return $id; } =head2 reverse_complement Args : none Example : none Description: reverse complement the object modifing dnafrag_strand and cigar_line Returntype : none Exceptions : none Caller : general Status : Stable =cut sub reverse_complement { my ($self) = @_; # reverse strand #$self->dnafrag_strand($self->dnafrag_strand * -1); $self->dnafrag_strand($self->{'dnafrag_strand'} * -1); # reverse original and aligned sequences if cached my $original_sequence = $self->{'original_sequence'}; if ($original_sequence) { $original_sequence = reverse $original_sequence; $original_sequence =~ tr/ATCGatcg/TAGCtagc/; $self->original_sequence($original_sequence); } my $aligned_sequence = $self->{'aligned_sequence'}; if ($aligned_sequence) { $aligned_sequence = reverse $aligned_sequence; $aligned_sequence =~ tr/ATCGatcg/TAGCtagc/; $self->aligned_sequence($aligned_sequence); } # reverse cigar_string as consequence my $cigar_line = $self->{'cigar_line'}; #$cigar_line = join("", reverse grep {$_} split(/(\d*[GDMIX])/, $cigar_line)); $cigar_line = join("", reverse ($cigar_line=~(/(\d*[GDMIX])/g))); $self->cigar_line($cigar_line); } =head2 get_Mapper Arg[1] : [optional] integer $cache (default = FALSE) Arg[2] : [optional] boolean $condensed (default = FALSE) Example : $this_mapper = $genomic_align->get_Mapper(); Example : $mapper1 = $genomic_align1->get_Mapper(); $mapper2 = $genomic_align2->get_Mapper(); Description: creates and returns a Bio::EnsEMBL::Mapper to map coordinates from the original sequence of this Bio::EnsEMBL::Compara::GenomicAlign to the aligned sequence, i.e. the alignment. In order to map a sequence from this Bio::EnsEMBL::Compara::GenomicAlign object to another Bio::EnsEMBL::Compara::GenomicAlign of the same Bio::EnsEMBL::Compara::GenomicAlignBlock object, you may use this mapper to transform coordinates into the "alignment" coordinates and then to the other Bio::EnsEMBL::Compara::GenomicAlign coordinates using the corresponding Bio::EnsEMBL::Mapper. The coordinates of the "alignment" starts with the start position of the GenomicAlignBlock if available or 1 otherwise. With the $cache argument you can decide whether you want to cache the result or not. Result is *not* cached by default. Returntype : Bio::EnsEMBL::Mapper object Exceptions : throw if no cigar_line can be found Status : Stable =cut sub get_Mapper { my ($self, $cache, $condensed) = @_; my $mapper; $cache = 0 if (!defined($cache)); my $mode = "expanded"; if (defined($condensed) and $condensed) { $mode = "condensed"; } if (!defined($self->{$mode.'_mapper'})) { if ($mode eq "condensed") { $mapper = Bio::EnsEMBL::Mapper->new("sequence", "alignment"); my $rel_strand = $self->dnafrag_strand; # This call ensures all direct attribs have been fetched my $ref_cigar_line = $self->genomic_align_block->reference_genomic_align->cigar_line; my $aln_pos = (eval{$self->genomic_align_block->start} or 1); #if the reference genomic_align, I only need a simple 1 to 1 mapping if ($self eq $self->genomic_align_block->reference_genomic_align) { $mapper->add_map_coordinates( 'sequence', $self->{'dnafrag_start'}, $self->{'dnafrag_end'}, $self->{'dnafrag_strand'}, 'alignment', $self->genomic_align_block->start, $self->genomic_align_block->end, ); return $mapper if (!$cache); $self->{$mode.'_mapper'} = $mapper; return $self->{$mode.'_mapper'}; } my $aln_seq_pos = 0; my $seq_pos = 0; my $insertions = 0; my $target_cigar_pieces; @$target_cigar_pieces = $self->{'cigar_line'} =~ /(\d*[GMDXI])/g; my $ref_cigar_pieces; @$ref_cigar_pieces = $ref_cigar_line =~ /(\d*[GMDXI])/g; my $i = 0; my $j = 0; my ($ref_num, $ref_type) = $ref_cigar_pieces->[$i] =~ /(\d*)([GMDXI])/; $ref_num = 1 if (!defined($ref_num) or $ref_num eq ""); my ($target_num, $target_type) = $target_cigar_pieces->[$j] =~ /(\d*)([GMDXI])/; $target_num = 1 if (!defined($target_num) or $target_num eq ""); while ($i < @$ref_cigar_pieces and $j<@$target_cigar_pieces) { while ($ref_type eq "I") { $aln_pos += $ref_num; $i++; last if ($i >= @$ref_cigar_pieces); ($ref_num, $ref_type) = $ref_cigar_pieces->[$i] =~ /(\d*)([GMDXI])/; $ref_num = 1 if (!defined($ref_num) or $ref_num eq ""); } while ($target_type eq "I") { $seq_pos += $target_num; $j++; last if ($j >= @$target_cigar_pieces); ($target_num, $target_type) = $target_cigar_pieces->[$j] =~ /(\d*)([GMDXI])/; $target_num = 1 if (!defined($target_num) or $target_num eq ""); } my $length; if ($ref_num == $target_num) { $length = $ref_num; } elsif ($ref_num > $target_num) { $length = $target_num; } elsif ($ref_num < $target_num) { $length = $ref_num; } my $this_piece_of_cigar_line = $length.$target_type; if ($ref_type eq "M") { my $this_mapper; if ($rel_strand == 1) { _add_cigar_line_to_Mapper($this_piece_of_cigar_line, $aln_pos, $seq_pos + $self->dnafrag_start, 1, $mapper); } else { _add_cigar_line_to_Mapper($this_piece_of_cigar_line, $aln_pos, $self->dnafrag_end - $seq_pos, -1, $mapper); } $aln_pos += $length; } my $gaps = 0; if ($target_type eq "D" || $target_type eq "X") { $gaps += $length; } $seq_pos -= $gaps; $seq_pos += $length; if ($ref_num == $target_num) { $i++; $j++; last if ($i >= @$ref_cigar_pieces); last if ($j >= @$target_cigar_pieces); ($ref_num, $ref_type) = $ref_cigar_pieces->[$i] =~ /(\d*)([GMDXI])/; $ref_num = 1 if (!defined($ref_num) or $ref_num eq ""); ($target_num, $target_type) = $target_cigar_pieces->[$j] =~ /(\d*)([GMDXI])/; $target_num = 1 if (!defined($target_num) or $target_num eq ""); } elsif ($ref_num > $target_num) { $j++; $ref_num -= $target_num; last if ($j >= @$target_cigar_pieces); ($target_num, $target_type) = $target_cigar_pieces->[$j] =~ /(\d*)([GMDXI])/; $target_num = 1 if (!defined($target_num) or $target_num eq ""); } elsif ($ref_num < $target_num) { $i++; $target_num -= $ref_num; last if ($i >= @$ref_cigar_pieces); ($ref_num, $ref_type) = $ref_cigar_pieces->[$i] =~ /(\d*)([GMDXI])/; $ref_num = 1 if (!defined($ref_num) or $ref_num eq ""); } } } else { my $cigar_line = $self->cigar_line; if (!$cigar_line) { throw("[$self] has no cigar_line and cannot be retrieved by any means"); } my $alignment_position = (eval{$self->genomic_align_block->start} or 1); my $sequence_position = $self->dnafrag_start; my $rel_strand = $self->dnafrag_strand; if ($rel_strand == 1) { $sequence_position = $self->dnafrag_start; } else { $sequence_position = $self->dnafrag_end; } $mapper = _get_Mapper_from_cigar_line($cigar_line, $alignment_position, $sequence_position, $rel_strand); } return $mapper if (!$cache); $self->{$mode.'_mapper'} = $mapper; } return $self->{$mode.'_mapper'}; } sub get_MapperOLD { my ($self, $cache, $condensed) = @_; my $mapper; $cache = 0 if (!defined($cache)); my $mode = "expanded"; if (defined($condensed) and $condensed) { $mode = "condensed"; } if (!defined($self->{$mode.'_mapper'})) { if ($mode eq "condensed") { $mapper = Bio::EnsEMBL::Mapper->new("sequence", "alignment"); my $rel_strand = $self->dnafrag_strand; my $ref_cigar_line = $self->genomic_align_block->reference_genomic_align->cigar_line; my $this_aligned_seq = $self->aligned_sequence("+FAKE_SEQ"); my $aln_pos = (eval{$self->genomic_align_block->start} or 1); my $aln_seq_pos = 0; my $seq_pos = 0; my $target_cigar_pieces; @$target_cigar_pieces = $self->cigar_line =~ /(\d*[GMDXI])/g; my $insertions = 0; my $array_index = 0; my $this_target_pos = 0; foreach my $cigar_piece ($ref_cigar_line =~ /(\d*[GMDX])/g) { my ($cig_count, $cig_mode) = $cigar_piece =~ /(\d*)([GMDX])/; $cig_count = 1 if (!defined($cig_count) or $cig_count eq ""); #because of 2X genomes, need different method for extracting the #cigar_line #my $this_piece_of_cigar_line = _get_sub_cigar_line_slow($target_cigar_pieces, $aln_seq_pos, $cig_count); #quicker method which keeps track of how far through the #target_cigar_pieces array we are my $this_piece_of_cigar_line; ($this_piece_of_cigar_line,$array_index, $this_target_pos) = _get_sub_cigar_line($target_cigar_pieces, $aln_seq_pos, $cig_count, $array_index, $this_target_pos); #find number of each cigar_line mode in cigar_line my $num_cigar_elements = _count_cigar_elements($this_piece_of_cigar_line); if ($cig_mode eq "M") { my $this_mapper; if ($rel_strand == 1) { $this_mapper = _get_Mapper_from_cigar_line($this_piece_of_cigar_line, $aln_pos, $seq_pos + $self->dnafrag_start, 1); } else { $this_mapper = _get_Mapper_from_cigar_line($this_piece_of_cigar_line, $aln_pos, $self->dnafrag_end - $seq_pos, -1); } $mapper->add_Mapper($this_mapper); $aln_pos += $cig_count; $insertions = $num_cigar_elements->{"I"}; $seq_pos += $insertions; } my $gaps = $num_cigar_elements->{"D"}; $gaps += $num_cigar_elements->{"X"}; $seq_pos -= $gaps; $seq_pos += $cig_count; $aln_seq_pos += $cig_count; } } else { my $cigar_line = $self->cigar_line; if (!$cigar_line) { throw("[$self] has no cigar_line and cannot be retrieved by any means"); } my $alignment_position = (eval{$self->genomic_align_block->start} or 1); my $sequence_position = $self->dnafrag_start; my $rel_strand = $self->dnafrag_strand; if ($rel_strand == 1) { $sequence_position = $self->dnafrag_start; } else { $sequence_position = $self->dnafrag_end; } $mapper = _get_Mapper_from_cigar_line($cigar_line, $alignment_position, $sequence_position, $rel_strand); } return $mapper if (!$cache); $self->{$mode.'_mapper'} = $mapper; } return $self->{$mode.'_mapper'}; } =head2 _count_cigar_elements Arg[1] : string $cigar_line Example : $num_elements = _count_cigar_elements("5M3D2M5D") Description: Counts the number of each cigar_line mode in a cigar_line and stores them in a hash reference. In the above example $num_elements->{"M"} is 7, $num_elements->{"D"} is 8 Returntype : hash reference Exceptions : None Status : At risk =cut sub _count_cigar_elements { my ($cigar_line) = @_; my $this_count = 0; my $num_elements; #initialise each element to 0 foreach my $mode (qw(G M D X I)) { $num_elements->{$mode} = 0; } foreach my $cigar_piece ($cigar_line =~ /(\d*[GMDXI])/g) { my ($cig_count, $cig_mode) = $cigar_piece =~ /(\d*)([GMDXI])/; $cig_count = 1 if (!defined($cig_count) or $cig_count eq ""); $num_elements->{$cig_mode} += $cig_count; } return $num_elements; } =head2 _get_sub_cigar_line Arg[1] : ref to array of target cigar_line elements Arg[2] : int $offset start position Arg[3] : int $length amount to extract Arg[4] : int $start_array_index current element in target array Arg[5] : int $start_target_pos current position in target coords Example : my $new_cigar_line = _get_sub_cigar_line($target_cigar_pieces, $pos, $count); Description: Extracts a cigar_line of size $length starting at $offset Returntype : string Exceptions : None Status : At risk =cut sub _get_sub_cigar_line { my ($target_cigar_pieces, $offset, $length, $start_array_index, $start_target_pos) = @_; my $ref_pos = $offset + $length; my $i = $start_array_index; my $target_pos = $start_target_pos; #current target element my ($target_cig_count, $target_cig_mode) = $target_cigar_pieces->[$i] =~ /(\d*)([GMDXI])/; $target_cig_count = 1 if (!defined($target_cig_count) or $target_cig_count eq ""); my $new_cigar_line = ""; #check to see if previous target overlaps this ref_pos if ($offset) { if ($target_pos > $offset) { #need to only add on cig_count amount my $new_count; if ($target_pos - $offset < $length) { $new_count = ($target_pos - $offset); } else { $new_count = $length; } #$new_cigar_line .= $new_count . $target_cig_mode; $new_cigar_line .= _cigar_element($target_cig_mode,$new_count); #print "here1 $target_cig_mode $new_count\n"; } #increment to next target element $i++; } while ($target_pos < $ref_pos && $i < @$target_cigar_pieces) { ($target_cig_count, $target_cig_mode) = $target_cigar_pieces->[$i++] =~ /(\d*)([GMDXI])/; $target_cig_count = 1 if (!defined($target_cig_count) or $target_cig_count eq ""); #first piece if (!$target_pos) { if ($target_cig_count >= $length) { $new_cigar_line .= _cigar_element($target_cig_mode,$length); } else { $new_cigar_line .= _cigar_element($target_cig_mode,$target_cig_count); } } else { if ($target_cig_mode ne "I" && $target_cig_count + $target_pos > $ref_pos) { #if new target piece extends beyond ref_piece but is not I #(since this doesn't count to target_pos) need to shorten it my $count = $ref_pos - $target_pos; $new_cigar_line .= _cigar_element($target_cig_mode,$count); } else { $new_cigar_line .= _cigar_element($target_cig_mode,$target_cig_count); } } $target_pos += $target_cig_count unless $target_cig_mode eq "I"; } #need to check if the next element is an I which doesn't count to #target_pos but need to add it to cigar_line if ($i < @$target_cigar_pieces) { ($target_cig_count, $target_cig_mode) = $target_cigar_pieces->[$i] =~ /(\d*)([GMDXI])/; $target_cig_count = 1 if (!defined($target_cig_count) or $target_cig_count eq ""); if ($target_cig_mode eq "I") { $new_cigar_line .= _cigar_element($target_cig_mode,$target_cig_count); } } #decrement to return current target element if ( $i > 0) { $i--; } return ($new_cigar_line, $i, $target_pos); } sub _get_sub_cigar_line_slow { my ($target_cigar_pieces, $offset, $length) = @_; my $i = 0; my $ref_pos = $offset + $length; my ($target_cig_count, $target_cig_mode); my $target_pos = 0; #skip through target_cigar_line until get to correct position while ($target_pos < $offset && $i < @$target_cigar_pieces) { ($target_cig_count, $target_cig_mode) = $target_cigar_pieces->[$i++] =~ /(\d*)([GMDXI])/; $target_cig_count = 1 if (!defined($target_cig_count) or $target_cig_count eq ""); $target_pos += $target_cig_count unless $target_cig_mode eq "I"; } my $new_cigar_line = ""; #check to see if previous target overlaps this ref_pos if ($offset) { if ($target_pos > $offset) { #need to only add on cig_count amount my $new_count; if ($target_pos - $offset < $length) { $new_count = ($target_pos - $offset); } else { $new_count = $length; } #$new_cigar_line .= $new_count . $target_cig_mode; $new_cigar_line .= _cigar_element($target_cig_mode,$new_count); } } while ($target_pos < $ref_pos && $i < @$target_cigar_pieces) { ($target_cig_count, $target_cig_mode) = $target_cigar_pieces->[$i++] =~ /(\d*)([GMDXI])/; $target_cig_count = 1 if (!defined($target_cig_count) or $target_cig_count eq ""); #first piece if (!$target_pos) { if ($target_cig_count >= $length) { $new_cigar_line .= _cigar_element($target_cig_mode,$length); } else { $new_cigar_line .= _cigar_element($target_cig_mode,$target_cig_count); } } else { if ($target_cig_mode ne "I" && $target_cig_count + $target_pos > $ref_pos) { #if new target piece extends beyond ref_piece but is not I #(since this doesn't count to target_pos) need to shorten it my $count = $ref_pos - $target_pos; $new_cigar_line .= _cigar_element($target_cig_mode,$count); } else { $new_cigar_line .= _cigar_element($target_cig_mode,$target_cig_count); } } $target_pos += $target_cig_count unless $target_cig_mode eq "I"; } #need to check if the next element is an I which doesn't count to #target_pos but need to add it to cigar_line if ($i < @$target_cigar_pieces) { ($target_cig_count, $target_cig_mode) = $target_cigar_pieces->[$i++] =~ /(\d*)([GMDXI])/; $target_cig_count = 1 if (!defined($target_cig_count) or $target_cig_count eq ""); if ($target_cig_mode eq "I") { $new_cigar_line .= _cigar_element($target_cig_mode,$target_cig_count); } } return $new_cigar_line; } =head2 _cigar_element Arg[1] : char $mode valid cigar_line mode Arg[2] : int $length size of element Example : $elem = _cigar_element("M", 5); Description: Creates a valid cigar element Returntype : integer Exceptions : None Status : At risk =cut sub _cigar_element { my ($mode, $len) = @_; my $elem; if ($len == 1) { $elem = $mode; #} elsif ($len > 1) { #length can be 0 if the sequence starts with a gap } else { #length can be 0 if the sequence starts with a gap $elem = $len.$mode; } return $elem; } =head2 _get_Mapper_from_cigar_line Arg[1] : $cigar_line Arg[2] : $alignment_position Arg[3] : $sequence_position Arg[4] : $relative_strand Example : $this_mapper = _get_Mapper_from_cigar_line($cigar_line, $aln_pos, $seq_pos, 1); Description: creates a new Bio::EnsEMBL::Mapper object for mapping between sequence and alignment coordinate systems using the cigar_line and starting from the $alignment_position and sequence_position. Returntype : Bio::EnsEMBL::Mapper object Exceptions : None Status : Stable =cut sub _get_Mapper_from_cigar_line { my ($cigar_line, $alignment_position, $sequence_position, $rel_strand) = @_; my $mapper = Bio::EnsEMBL::Mapper->new("sequence", "alignment"); my @cigar_pieces = ($cigar_line =~ /(\d*[GMDXI])/g); if ($rel_strand == 1) { foreach my $cigar_piece (@cigar_pieces) { my $cigar_type = substr($cigar_piece, -1, 1); my $cigar_count = substr($cigar_piece, 0, -1); $cigar_count = 1 if ($cigar_count eq ""); next if ($cigar_count < 1); if( $cigar_type eq "M" ) { $mapper->add_map_coordinates( "sequence", #$self->dbID, $sequence_position, $sequence_position + $cigar_count - 1, $rel_strand, "alignment", #$self->genomic_align_block->dbID, $alignment_position, $alignment_position + $cigar_count - 1 ); $sequence_position += $cigar_count; $alignment_position += $cigar_count; } elsif( $cigar_type eq "I") { #add to sequence_position but not alignment_position $sequence_position += $cigar_count; } elsif( $cigar_type eq "G" || $cigar_type eq "D" || $cigar_type eq "X") { $alignment_position += $cigar_count; } } } else { foreach my $cigar_piece (@cigar_pieces) { my $cigar_type = substr($cigar_piece, -1, 1); my $cigar_count = substr($cigar_piece, 0 ,-1); $cigar_count = 1 if ($cigar_count eq ""); next if ($cigar_count < 1); if( $cigar_type eq "M" ) { $mapper->add_map_coordinates( "sequence", #$self->dbID, $sequence_position - $cigar_count + 1, $sequence_position, $rel_strand, "alignment", #$self->genomic_align_block->dbID, $alignment_position, $alignment_position + $cigar_count - 1 ); $sequence_position -= $cigar_count; $alignment_position += $cigar_count; } elsif( $cigar_type eq "I") { #add to sequence_position but not alignment_position $sequence_position -= $cigar_count; } elsif( $cigar_type eq "G" || $cigar_type eq "D" || $cigar_type eq "X") { $alignment_position += $cigar_count; } } } return $mapper; } sub _add_cigar_line_to_Mapper { my ($cigar_line, $alignment_position, $sequence_position, $rel_strand, $mapper) = @_; my @cigar_pieces = ($cigar_line =~ /(\d*[GMDXI])/g); if ($rel_strand == 1) { foreach my $cigar_piece (@cigar_pieces) { my $cigar_type = substr($cigar_piece, -1, 1 ); my $cigar_count = substr($cigar_piece, 0 ,-1 ); $cigar_count = 1 unless ($cigar_count =~ /^\d+$/); next if ($cigar_count < 1); if( $cigar_type eq "M" ) { $mapper->add_map_coordinates( "sequence", #$self->dbID, $sequence_position, $sequence_position + $cigar_count - 1, $rel_strand, "alignment", #$self->genomic_align_block->dbID, $alignment_position, $alignment_position + $cigar_count - 1 ); $sequence_position += $cigar_count; $alignment_position += $cigar_count; } elsif( $cigar_type eq "I") { #add to sequence_position but not alignment_position $sequence_position += $cigar_count; } elsif( $cigar_type eq "G" || $cigar_type eq "D" || $cigar_type eq "X") { $alignment_position += $cigar_count; } } } else { foreach my $cigar_piece (@cigar_pieces) { my $cigar_type = substr($cigar_piece, -1, 1 ); my $cigar_count = substr($cigar_piece, 0 ,-1 ); $cigar_count = 1 unless ($cigar_count =~ /^\d+$/); next if ($cigar_count < 1); if( $cigar_type eq "M" ) { $mapper->add_map_coordinates( "sequence", #$self->dbID, $sequence_position - $cigar_count + 1, $sequence_position, $rel_strand, "alignment", #$self->genomic_align_block->dbID, $alignment_position, $alignment_position + $cigar_count - 1 ); $sequence_position -= $cigar_count; $alignment_position += $cigar_count; } elsif( $cigar_type eq "I") { #add to sequence_position but not alignment_position $sequence_position -= $cigar_count; } elsif( $cigar_type eq "G" || $cigar_type eq "D" || $cigar_type eq "X") { $alignment_position += $cigar_count; } } } return $mapper; } =head2 get_Slice Arg[1] : -none- Example : $slice = $genomic_align->get_Slice(); Description: creates and returns a Bio::EnsEMBL::Slice which corresponds to this Bio::EnsEMBL::Compara::GenomicAlign Returntype : Bio::EnsEMBL::Slice object Exceptions : return -undef- if slice cannot be created (this is likely to happen if the Registry is misconfigured) Status : Stable =cut sub get_Slice { my ($self) = @_; my $slice = $self->dnafrag->slice; return undef if (!defined($slice)); $slice = $slice->sub_Slice( $self->dnafrag_start, $self->dnafrag_end, $self->dnafrag_strand ); return $slice; } =head2 restrict Arg[1] : int start Arg[1] : int end Example : my $genomic_align = $genomic_align->restrict(10, 20); Description: restrict (trim) this GenomicAlign to the start and end positions (in alignment coordinates). If no trimming is required, the original object is returned instead. Returntype : Bio::EnsEMBL::Compara::GenomicAlign object Exceptions : Status : At risk =cut sub restrict { my ($self, $start, $end, $aligned_seq_length) = @_; throw("Wrong arguments") if (!$start or !$end); my $restricted_genomic_align = $self->copy(); delete($restricted_genomic_align->{dbID}); delete($restricted_genomic_align->{genomic_align_block_id}); delete($restricted_genomic_align->{original_sequence}); delete($restricted_genomic_align->{aligned_sequence}); delete($restricted_genomic_align->{cigar_line}); $restricted_genomic_align->{original_dbID} = $self->dbID if ($self->dbID); # Need to calculate the original aligned sequence length myself if (!$aligned_seq_length) { my @cigar = grep {$_} split(/(\d*[GDMXI])/, $self->cigar_line); foreach my $num_type (@cigar) { my $type = substr($num_type, -1, 1, ""); $num_type = 1 if ($num_type eq ""); $aligned_seq_length += $num_type unless ($type eq "I"); } } my $final_aligned_length = $end - $start + 1; my $number_of_columns_to_trim_from_the_start = $start - 1; my $number_of_columns_to_trim_from_the_end = $aligned_seq_length - $end; my @cigar = grep {$_} split(/(\d*[GDMXI])/, $self->cigar_line); ## Trim start of cigar_line if needed if ($number_of_columns_to_trim_from_the_start >= 0) { my $counter_of_trimmed_columns_from_the_start = 0; my $counter_of_trimmed_base_pairs = 0; # num of bp we trim (from the start) ## Loop through the cigar pieces while (my $cigar = shift(@cigar)) { # Parse each cigar piece my $type = substr( $cigar, -1, 1 ); my $num = substr( $cigar, 0 ,-1 ); $num = 1 if ($num eq ""); # Insertions are not part of the alignment, don't count them if ($type ne "I") { $counter_of_trimmed_columns_from_the_start += $num; } # Matches and insertions are actual base pairs in the sequence if ($type eq "M" || $type eq "I") { $counter_of_trimmed_base_pairs += $num; } # If this cigar piece is too long and we overshoot the number of columns we want to trim, # we substitute this cigar piece by a shorter one if ($counter_of_trimmed_columns_from_the_start >= $number_of_columns_to_trim_from_the_start) { my $new_cigar_piece; # length of the new cigar piece my $length = $counter_of_trimmed_columns_from_the_start - $number_of_columns_to_trim_from_the_start; if ($length > 1) { $new_cigar_piece = $length.$type; } elsif ($length == 1) { $new_cigar_piece = $type; } unshift(@cigar, $new_cigar_piece) if ($new_cigar_piece); if ($type eq "M") { $counter_of_trimmed_base_pairs -= $length; } ## We don't want to start with an insertion. Trim it! while (@cigar and $cigar[0] =~ /[I]/) { my ($num, $type) = ($cigar[0] =~ /^(\d*)([DIGMX])/); #my $type = substr( $cigar, -1, 1 ); #my $num = substr( $cigar, 0 ,-1 ); $num = 1 if ($num eq ""); $counter_of_trimmed_base_pairs += $num; shift(@cigar); } last; } } if ($self->dnafrag_strand == 1) { $restricted_genomic_align->dnafrag_start($self->dnafrag_start + $counter_of_trimmed_base_pairs); } else { $restricted_genomic_align->dnafrag_end($self->dnafrag_end - $counter_of_trimmed_base_pairs); } } ## Trim end of cigar_line if needed if ($number_of_columns_to_trim_from_the_end >= 0) { my $counter_of_trimmed_columns_from_the_end = 0; my $counter_of_trimmed_base_pairs = 0; # num of bp we trim (from the start) ## Loop through the cigar pieces while (my $cigar = pop(@cigar)) { # Parse each cigar piece my $type = substr( $cigar, -1, 1 ); my $num = substr( $cigar, 0 ,-1 ); $num = 1 if ($num eq ""); # Insertions are not part of the alignment, don't count them if ($type ne "I") { $counter_of_trimmed_columns_from_the_end += $num; } # Matches and insertions are actual base pairs in the sequence if ($type eq "M" || $type eq "I") { $counter_of_trimmed_base_pairs += $num; } # If this cigar piece is too long and we overshoot the number of columns we want to trim, # we substitute this cigar piece by a shorter one if ($counter_of_trimmed_columns_from_the_end >= $number_of_columns_to_trim_from_the_end) { my $new_cigar_piece; # length of the new cigar piece my $length = $counter_of_trimmed_columns_from_the_end - $number_of_columns_to_trim_from_the_end; if ($length > 1) { $new_cigar_piece = $length.$type; } elsif ($length == 1) { $new_cigar_piece = $type; } push(@cigar, $new_cigar_piece) if ($new_cigar_piece); if ($type eq "M") { $counter_of_trimmed_base_pairs -= $length; } ## We don't want to end with an insertion. Trim it! while (@cigar and $cigar[-1] =~ /[I]/) { my ($num, $type) = ($cigar[-1] =~ /^(\d*)([DIGMX])/); #my $type = substr( $cigar, -1, 1 ); #my $num = substr( $cigar, 0 ,-1 ); $num = 1 if ($num eq ""); $counter_of_trimmed_base_pairs += $num; pop(@cigar); } last; } } if ($self->dnafrag_strand == 1) { $restricted_genomic_align->dnafrag_end($restricted_genomic_align->dnafrag_end - $counter_of_trimmed_base_pairs); } else { $restricted_genomic_align->dnafrag_start($restricted_genomic_align->dnafrag_start + $counter_of_trimmed_base_pairs); } } ## Save genomic_align's cigar_line $restricted_genomic_align->aligned_sequence(0); $restricted_genomic_align->cigar_line(join("", @cigar)); return $restricted_genomic_align; } 1;