Mercurial > repos > veg > qfilt
view qfilt.xml @ 1:2ab93e1952c5 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/qfilt commit c9f251e99e052ab4d87ed5fd89e466cdf387742b-dirty
author | veg |
---|---|
date | Wed, 18 Apr 2018 16:53:05 -0400 |
parents | |
children |
line wrap: on
line source
<?xml version="1.0"?> <tool id="qfilt" version="1.0.0" name="qfilt"> <description>filter sequencing data using simple heuristics</description> <requirements> <requirement type="package" version="0.0.1">qfilt</requirement> </requirements> <stdio> <exit_code range="1:"/> </stdio> <command><![CDATA[ qfilt -o '$filtered_output' #if str($options.advanced) == 'advanced': -q $options.qscore -l $options.length -s $options.split #if $options.replace and $options.remove: -P $options.replace -R $options.remove #elif $options.mode: -m $options.mode #end if #if $options.prefix: -t $options.mismatch -T $options.prefix #end if -f $options.format $options.tolerate_homopolymeric $options.tolerate_ambiguous #end if -Q '$input_fastq' ]]></command> <inputs> <param name="input_fastq" argument="-Q" type="data" format="fastq" label="Input FASTA" help="FASTQ File" /> <conditional name="options"> <param name="advanced" type="select" label="Additional options"> <option value="defaults">Use defaults</option> <option value="advanced">Specify additional parameters</option> </param> <when value="defaults"/> <when value="advanced"> <param name="qscore" argument="-q" type="integer" value="20" label="QScore" help="minimum per-base quality score below which a read will be split or truncated" /> <param name="length" argument="-l" type="integer" value="50" label="Length" help="minimum retained fragment LENGTH" /> <param name="mode" argument="-m" type="integer" value="0" label="Mode" help="MODE is a 3-bitmask (an integer in [0-7], default=0)" /> <param name="split" argument="-s" type="text" label="Split" help="when encountering a low q-score, split instead of truncate" /> <param name="tolerate_homopolymeric" argument="-p" type="boolean" truevalue="-p" falsevalue="" label="Tolerate Homopolymeric" help="tolerate low q-score homopolymeric regions" /> <param name="tolerate_ambiguous" argument="-a" type="boolean" truevalue="-a" falsevalue="" label="Tolerate Ambiguous" help="tolerate low q-score ambiguous nucleotides" /> <param name="replace" argument="-P" type="text" label="Replace" help="rather than splitting or truncating, replace low quality bases with CHAR this option OVERRIDES all -m mode options" /> <param name="remove" argument="-R" type="text" label="Remove" help="rather than splitting or truncating, remove reads which contain more than COUNT low quality bases this option only works in COMBINATION with the -P (punch) option" /> <param name="prefix" argument="-T" type="text" label="Prefix" help="if supplied, only reads with this PREFIX are retained, and the PREFIX is stripped from each contributing read" /> <param name="mismatch" argument="-t" type="integer" value="0" label="Mismatch" help="if PREFIX is supplied, prefix matching tolerates at most MISMATCH mismatches" /> <param name="format" argument="-f" type="select" label="Format" help="output in FASTA or FASTQ format (default=FASTA)" > <option value="FASTA">FASTA</option> <option value="FASTQ">FASTQ</option> </param> </when> </conditional> </inputs> <outputs> <data format="fasta" name="filtered_output"/> </outputs> <tests> <test> <param name="input_fastq" value="qfilt-in1.fastq" /> <output file="qfilt-out1.fa" ftype="fasta" name="filtered_output" /> </test> <test> <param name="input_fastq" value="qfilt-in1.fastq" /> <param name="advanced" value="advanced" /> <param name="tolerate_homopolymeric" value="False" /> <output file="qfilt-out2.fa" ftype="fasta" name="filtered_output" /> </test> </tests> <help><![CDATA[ qfilt ===== This simple program is meant to filter sequencing data, optionally removing or splitting reads with poor quality scores and to optionally _only_ retain fragments from reads that are tagged with a given 5' sequence. ### OUTPUT: #### #### stderr: #### run settings: input fasta: data/test.fna input qual: data/test.qual min q-score: 15 min fragment length: 30 run mode: 0 (truncate/don't tolerate homopolymers/don't tolerate ambigs) 5' tag: ATATCGCGAGGA max tag mismatches: 0 run summary: total bases : 29570 original reads : 305 q10 : 0.995502 q20 : 0.860298 q30 : 0.728745 mean q-score : 33.2273 contributing reads: 5 retained fragments: 5 original read length distribution: mean: 96.9508 median: 77 variance 3743.03 standard deviation: 61.1803 min: 49 2.5%: 54 97.5%: 332 max: 497 retained fragment length distribution: mean: 41 median: 37 variance 72.5 standard deviation: 8.51469 min: 33 2.5%: 33 97.5%: 54 max: 54 #### stdout: #### >GM98SRO01B77KU rank=0000671 x=796.0 y=1996.0 length=58 CCACGCGTATCGATGTCGACTTTTTTTTCTTTTCTTACATAGTAG >GM98SRO01BA3RP rank=0000953 x=419.5 y=1603.5 length=87 CTGATGCTGCACCAACTGTACTCCCTCGCGATA >GM98SRO01E1BKW rank=0001233 x=1948.0 y=846.0 length=66 TACAGTTGGTGCAGCATCAGAAAAGTACGACATCGATACGCGTGGTCCTCGCGA >GM98SRO01DVVNY rank=0001304 x=1476.0 y=636.5 length=84 ACGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA >GM98SRO01D6FIX rank=0001416 x=1596.0 y=1415.0 length=91 CGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA ]]></help> <citations> <citation type="bibtex"> @UNPUBLISHED{spond, author = "Sergei Kosakovsky Pond", title = "HyPhy: Hypothesis Testing using Phylogenies", year = "2000", note = "http://hyphy.org/", url = "http://hyphy.org/"} </citation> </citations> </tool>