view qfilt.xml @ 1:2ab93e1952c5 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/qfilt commit c9f251e99e052ab4d87ed5fd89e466cdf387742b-dirty

<?xml version="1.0"?>
<tool id="qfilt" version="1.0.0" name="qfilt">
    <description>filter sequencing data using simple heuristics</description>
    <requirements>
        <requirement type="package" version="0.0.1">qfilt</requirement>
    </requirements>
    <stdio>
        <exit_code range="1:"/>
    </stdio>
    <command><![CDATA[
        qfilt -o '$filtered_output'
        #if str($options.advanced) == 'advanced':
            -q $options.qscore -l $options.length
            -s $options.split
            #if $options.replace and $options.remove:
                 -P $options.replace -R $options.remove
            #elif $options.mode:
                -m $options.mode
            #end if
            #if $options.prefix:
                -t $options.mismatch
                -T $options.prefix
            #end if
            -f $options.format
            $options.tolerate_homopolymeric $options.tolerate_ambiguous
        #end if
        -Q '$input_fastq'
    ]]></command>
    <inputs>

        <param name="input_fastq" argument="-Q" type="data" format="fastq" label="Input FASTA" help="FASTQ File" />

        <conditional name="options">

            <param name="advanced" type="select" label="Additional options">
                <option value="defaults">Use defaults</option>
                <option value="advanced">Specify additional parameters</option>
            </param>

            <when value="defaults"/>

            <when value="advanced">
                <param name="qscore" argument="-q" type="integer" value="20" label="QScore" help="minimum per-base quality score below which a read will be split or truncated" />
                <param name="length" argument="-l" type="integer" value="50" label="Length" help="minimum retained fragment LENGTH" />
                <param name="mode" argument="-m" type="integer" value="0" label="Mode" help="MODE is a 3-bitmask (an integer in [0-7], default=0)" />
                <param name="split" argument="-s" type="text" label="Split" help="when encountering a low q-score, split instead of truncate" />
                <param name="tolerate_homopolymeric" argument="-p" type="boolean" truevalue="-p" falsevalue="" label="Tolerate Homopolymeric" help="tolerate low q-score homopolymeric regions" />
                <param name="tolerate_ambiguous" argument="-a" type="boolean" truevalue="-a" falsevalue="" label="Tolerate Ambiguous" help="tolerate low q-score ambiguous nucleotides" />
                <param name="replace" argument="-P" type="text" label="Replace" help="rather than splitting or truncating, replace low quality bases with CHAR this option OVERRIDES all -m mode options" />
                <param name="remove" argument="-R" type="text" label="Remove" help="rather than splitting or truncating, remove reads which contain more than COUNT low quality bases this option only works in COMBINATION with the -P (punch) option" />
                <param name="prefix" argument="-T" type="text" label="Prefix" help="if supplied, only reads with this PREFIX are retained, and the PREFIX is stripped from each contributing read" />
                <param name="mismatch" argument="-t" type="integer" value="0" label="Mismatch" help="if PREFIX is supplied, prefix matching tolerates at most MISMATCH mismatches" />
                <param name="format" argument="-f" type="select" label="Format" help="output in FASTA or FASTQ format (default=FASTA)" >
                    <option value="FASTA">FASTA</option>
                    <option value="FASTQ">FASTQ</option>
                </param>
            </when>

        </conditional>

    </inputs>
    <outputs>
        <data format="fasta" name="filtered_output"/>
    </outputs>
    <tests>
        <test>
            <param name="input_fastq" value="qfilt-in1.fastq" />
            <output file="qfilt-out1.fa" ftype="fasta" name="filtered_output" />
        </test>
        <test>
            <param name="input_fastq" value="qfilt-in1.fastq" />
            <param name="advanced" value="advanced" />
            <param name="tolerate_homopolymeric" value="False" />
            <output file="qfilt-out2.fa" ftype="fasta" name="filtered_output" />
        </test>
    </tests>
    <help><![CDATA[
qfilt
=====

This simple program is meant to filter sequencing data,
optionally removing or splitting reads with poor quality scores
and to optionally _only_ retain fragments from reads that are tagged with a given 5' sequence.

### OUTPUT: ####

#### stderr: ####

    run settings:
        input fasta:         data/test.fna
        input qual:          data/test.qual
        min q-score:         15
        min fragment length: 30
        run mode:            0 (truncate/don't tolerate homopolymers/don't tolerate ambigs)
        5' tag:              ATATCGCGAGGA
        max tag mismatches:  0

    run summary:
        total bases       :  29570
        original reads    :  305
        q10               :  0.995502
        q20               :  0.860298
        q30               :  0.728745
        mean q-score      :  33.2273
        contributing reads:  5
        retained fragments:  5

    original read length distribution:
        mean:                96.9508
        median:              77
        variance             3743.03
        standard deviation:  61.1803
        min:                 49
        2.5%:                54
        97.5%:               332
        max:                 497

    retained fragment length distribution:
        mean:                41
        median:              37
        variance             72.5
        standard deviation:  8.51469
        min:                 33
        2.5%:                33
        97.5%:               54
        max:                 54

#### stdout: ####

    >GM98SRO01B77KU rank=0000671 x=796.0 y=1996.0 length=58
    CCACGCGTATCGATGTCGACTTTTTTTTCTTTTCTTACATAGTAG
    >GM98SRO01BA3RP rank=0000953 x=419.5 y=1603.5 length=87
    CTGATGCTGCACCAACTGTACTCCCTCGCGATA
    >GM98SRO01E1BKW rank=0001233 x=1948.0 y=846.0 length=66
    TACAGTTGGTGCAGCATCAGAAAAGTACGACATCGATACGCGTGGTCCTCGCGA
    >GM98SRO01DVVNY rank=0001304 x=1476.0 y=636.5 length=84
    ACGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA
    >GM98SRO01D6FIX rank=0001416 x=1596.0 y=1415.0 length=91
    CGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA
    ]]></help>
    <citations>
        <citation type="bibtex">
            @UNPUBLISHED{spond,
                author = "Sergei Kosakovsky Pond",
                title = "HyPhy: Hypothesis Testing using Phylogenies",
                year = "2000",
                note = "http://hyphy.org/",
                url = "http://hyphy.org/"}
        </citation>
    </citations>
</tool>