Mercurial > repos > veg > qfilt
diff qfilt.xml @ 1:2ab93e1952c5 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/qfilt commit c9f251e99e052ab4d87ed5fd89e466cdf387742b-dirty
| author | veg |
|---|---|
| date | Wed, 18 Apr 2018 16:53:05 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/qfilt.xml Wed Apr 18 16:53:05 2018 -0400 @@ -0,0 +1,151 @@ +<?xml version="1.0"?> +<tool id="qfilt" version="1.0.0" name="qfilt"> + <description>filter sequencing data using simple heuristics</description> + <requirements> + <requirement type="package" version="0.0.1">qfilt</requirement> + </requirements> + <stdio> + <exit_code range="1:"/> + </stdio> + <command><![CDATA[ + qfilt -o '$filtered_output' + #if str($options.advanced) == 'advanced': + -q $options.qscore -l $options.length + -s $options.split + #if $options.replace and $options.remove: + -P $options.replace -R $options.remove + #elif $options.mode: + -m $options.mode + #end if + #if $options.prefix: + -t $options.mismatch + -T $options.prefix + #end if + -f $options.format + $options.tolerate_homopolymeric $options.tolerate_ambiguous + #end if + -Q '$input_fastq' + ]]></command> + <inputs> + + <param name="input_fastq" argument="-Q" type="data" format="fastq" label="Input FASTA" help="FASTQ File" /> + + <conditional name="options"> + + <param name="advanced" type="select" label="Additional options"> + <option value="defaults">Use defaults</option> + <option value="advanced">Specify additional parameters</option> + </param> + + <when value="defaults"/> + + <when value="advanced"> + <param name="qscore" argument="-q" type="integer" value="20" label="QScore" help="minimum per-base quality score below which a read will be split or truncated" /> + <param name="length" argument="-l" type="integer" value="50" label="Length" help="minimum retained fragment LENGTH" /> + <param name="mode" argument="-m" type="integer" value="0" label="Mode" help="MODE is a 3-bitmask (an integer in [0-7], default=0)" /> + <param name="split" argument="-s" type="text" label="Split" help="when encountering a low q-score, split instead of truncate" /> + <param name="tolerate_homopolymeric" argument="-p" type="boolean" truevalue="-p" falsevalue="" label="Tolerate Homopolymeric" help="tolerate low q-score homopolymeric regions" /> + <param name="tolerate_ambiguous" argument="-a" type="boolean" truevalue="-a" falsevalue="" label="Tolerate Ambiguous" help="tolerate low q-score ambiguous nucleotides" /> + <param name="replace" argument="-P" type="text" label="Replace" help="rather than splitting or truncating, replace low quality bases with CHAR this option OVERRIDES all -m mode options" /> + <param name="remove" argument="-R" type="text" label="Remove" help="rather than splitting or truncating, remove reads which contain more than COUNT low quality bases this option only works in COMBINATION with the -P (punch) option" /> + <param name="prefix" argument="-T" type="text" label="Prefix" help="if supplied, only reads with this PREFIX are retained, and the PREFIX is stripped from each contributing read" /> + <param name="mismatch" argument="-t" type="integer" value="0" label="Mismatch" help="if PREFIX is supplied, prefix matching tolerates at most MISMATCH mismatches" /> + <param name="format" argument="-f" type="select" label="Format" help="output in FASTA or FASTQ format (default=FASTA)" > + <option value="FASTA">FASTA</option> + <option value="FASTQ">FASTQ</option> + </param> + </when> + + </conditional> + + </inputs> + <outputs> + <data format="fasta" name="filtered_output"/> + </outputs> + <tests> + <test> + <param name="input_fastq" value="qfilt-in1.fastq" /> + <output file="qfilt-out1.fa" ftype="fasta" name="filtered_output" /> + </test> + <test> + <param name="input_fastq" value="qfilt-in1.fastq" /> + <param name="advanced" value="advanced" /> + <param name="tolerate_homopolymeric" value="False" /> + <output file="qfilt-out2.fa" ftype="fasta" name="filtered_output" /> + </test> + </tests> + <help><![CDATA[ +qfilt +===== + +This simple program is meant to filter sequencing data, +optionally removing or splitting reads with poor quality scores +and to optionally _only_ retain fragments from reads that are tagged with a given 5' sequence. + +### OUTPUT: #### + +#### stderr: #### + + run settings: + input fasta: data/test.fna + input qual: data/test.qual + min q-score: 15 + min fragment length: 30 + run mode: 0 (truncate/don't tolerate homopolymers/don't tolerate ambigs) + 5' tag: ATATCGCGAGGA + max tag mismatches: 0 + + run summary: + total bases : 29570 + original reads : 305 + q10 : 0.995502 + q20 : 0.860298 + q30 : 0.728745 + mean q-score : 33.2273 + contributing reads: 5 + retained fragments: 5 + + original read length distribution: + mean: 96.9508 + median: 77 + variance 3743.03 + standard deviation: 61.1803 + min: 49 + 2.5%: 54 + 97.5%: 332 + max: 497 + + retained fragment length distribution: + mean: 41 + median: 37 + variance 72.5 + standard deviation: 8.51469 + min: 33 + 2.5%: 33 + 97.5%: 54 + max: 54 + +#### stdout: #### + + >GM98SRO01B77KU rank=0000671 x=796.0 y=1996.0 length=58 + CCACGCGTATCGATGTCGACTTTTTTTTCTTTTCTTACATAGTAG + >GM98SRO01BA3RP rank=0000953 x=419.5 y=1603.5 length=87 + CTGATGCTGCACCAACTGTACTCCCTCGCGATA + >GM98SRO01E1BKW rank=0001233 x=1948.0 y=846.0 length=66 + TACAGTTGGTGCAGCATCAGAAAAGTACGACATCGATACGCGTGGTCCTCGCGA + >GM98SRO01DVVNY rank=0001304 x=1476.0 y=636.5 length=84 + ACGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA + >GM98SRO01D6FIX rank=0001416 x=1596.0 y=1415.0 length=91 + CGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA + ]]></help> + <citations> + <citation type="bibtex"> + @UNPUBLISHED{spond, + author = "Sergei Kosakovsky Pond", + title = "HyPhy: Hypothesis Testing using Phylogenies", + year = "2000", + note = "http://hyphy.org/", + url = "http://hyphy.org/"} + </citation> + </citations> +</tool>