Mercurial > repos > tmcgowan > fastqc
changeset 0:d91b89b552f3 draft default tip
Imported from capsule None
| author | tmcgowan |
|---|---|
| date | Fri, 12 Sep 2014 11:55:50 -0400 |
| parents | |
| children | |
| files | rgFastQC.py rgFastQC.xml tool_dependencies.xml |
| diffstat | 3 files changed, 173 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgFastQC.py Fri Sep 12 11:55:50 2014 -0400 @@ -0,0 +1,66 @@ +""" +Rewrite of rgFastQC.py for v. 0.11.2 of FastQC + +""" +import re +import os +import sys +import subprocess +import optparse +import shutil +import tempfile +import zipfile +import gzip +import glob + +class FastQCRunner(object): + + def __init__(self,opts=None): + assert opts <> None + self.opts = opts + + def prepare_command_line(self): + self.fastqinfilename = re.sub(ur'[^a-zA-Z0-9_\-\.]', '_', os.path.basename(self.opts.inputfilename)) + command_line = [opts.executable, '--outdir %s' % opts.outputdir] + if opts.contaminants <> None : + command_line.append('--contaminants %s' % opts.contaminants) + command_line.append('--quiet %s' % self.fastqinfilename) + self.command_line = ' '.join(command_line) + + def copy_working_file_to_dataset(self): + result_file = glob.glob('*html') + os.system('cp %s %s' % (result_file[0], self.opts.htmloutput)) + + + def run_fastqc(self): + + dummy,tlog = tempfile.mkstemp(prefix='rgFastQC',suffix=".log",dir=self.opts.outputdir) + sout = open(tlog, 'w') + + self.prepare_command_line() + sout.write(self.command_line) + sout.write('\n') + sout.write("Creating symlink\n") + os.symlink(self.opts.input, self.fastqinfilename) + sout.write("check_call\n") + subprocess.check_call(self.command_line, shell=True) + sout.write("Copying working %s file to %s \n" % (self.fastqinfilename, self.opts.htmloutput)) + self.copy_working_file_to_dataset() + sout.write("Finished") + sout.close() + + +if __name__ == '__main__': + op = optparse.OptionParser() + op.add_option('-i', '--input', default=None) + op.add_option('-j', '--inputfilename', default=None) + op.add_option('-o', '--htmloutput', default=None) + op.add_option('-d', '--outputdir', default="/tmp/shortread") + op.add_option('-f', '--informat', default='fastq') + op.add_option('-n', '--namejob', default='rgFastQC') + op.add_option('-c', '--contaminants', default=None) + op.add_option('-e', '--executable', default='fastqc') + opts, args = op.parse_args() + + fastqc_runner = FastQCRunner(opts) + fastqc_runner.run_fastqc() \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgFastQC.xml Fri Sep 12 11:55:50 2014 -0400 @@ -0,0 +1,101 @@ +<tool name="FastQC:Read QC" id="fastqc" version="0.60"> + <description>reports using FastQC</description> + <command interpreter="python"> + rgFastQC.py -i "$input_file" -d . -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$JAVA_JAR_PATH/fastqc" +#if $contaminants.dataset and str($contaminants) > '' +-c "$contaminants" +#end if + </command> + <requirements> + <requirement type="package" version="0.11.2">FastQC</requirement> + </requirements> + <inputs> + <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> + <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" + help="Letters and numbers only please - other characters will be removed"> + <sanitizer invalid_char=""> + <valid initial="string.letters,string.digits"/> + </sanitizer> + </param> + <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" + help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> + </inputs> + <outputs> + <data format="html" name="html_file" label="${out_prefix}_${input_file.name}.html" /> + </outputs> + <tests> + <test> + <param name="input_file" value="1000gsample.fastq" /> + <param name="out_prefix" value="fastqc_out" /> + <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> + <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> + </test> + </tests> + <help> + +.. class:: infomark + +**Purpose** + +FastQC aims to provide a simple way to do some quality control checks on raw +sequence data coming from high throughput sequencing pipelines. +It provides a modular set of analyses which you can use to give a quick +impression of whether your data has any problems of +which you should be aware before doing any further analysis. + +The main functions of FastQC are: + +- Import of data from BAM, SAM or FastQ files (any variant) +- Providing a quick overview to tell you in which areas there may be problems +- Summary graphs and tables to quickly assess your data +- Export of results to an HTML based permanent report +- Offline operation to allow automated generation of reports without running the interactive application + + +----- + + +.. class:: infomark + +**FastQC** + +This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_ +Kindly acknowledge it as well as this tool if you use it. +FastQC incorporates the Picard-tools_ libraries for sam/bam processing. + +The contaminants file parameter was borrowed from the independently developed +fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson. + +----- + +.. class:: infomark + +**Inputs and outputs** + +FastQC_ is the best place to look for documentation - it's very good. +A summary follows below for those in a tearing hurry. + +This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check. +It will also take an optional file containing a list of contaminants information, in the form of +a tab-delimited file with 2 columns, name and sequence. + +The tool produces a single HTML output file that contains all of the results, including the following: + +- Basic Statistics +- Per base sequence quality +- Per sequence quality scores +- Per base sequence content +- Per base GC content +- Per sequence GC content +- Per base N content +- Sequence Length Distribution +- Sequence Duplication Levels +- Overrepresented sequences +- Kmer Content + +All except Basic Statistics and Overrepresented sequences are plots. + .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ + .. _Picard-tools: http://picard.sourceforge.net/index.shtml + +</help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Fri Sep 12 11:55:50 2014 -0400 @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="FastQC" version="0.11.2"> + <repository changeset_revision="9b285cb34c00" name="package_fastqc_0_11_2" owner="tmcgowan" toolshed="https://testtoolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>
