Mercurial > repos > serranop > usearch
view usearch_fastq_mergepairs.xml @ 36:eca87767a73c draft default tip
Uploaded
author | serranop |
---|---|
date | Sat, 14 Sep 2013 13:54:52 -0400 |
parents | 311ab474a270 |
children |
line wrap: on
line source
<tool id="usearch_fastq_mergepairs" name="usearch fastq_mergepairs" version="0.0.2"> <description>merging of paired reads</description> <version_command>usearch -version</version_command> <command interpreter='bash'>usearch_wrapper.sh usearch -fastq_mergepairs '$input_forward' -reverse '$input_reverse' #if $minovlen.value != 0 -fastq_minovlen $minovlen #end if #if $minmergelen.value != 0 -fastq_minmergelen $minmergelen #end if #if $maxmergelen.value != 0 -fastq_maxmergelen $maxmergelen #end if #if $maxdiffs.value != 0 -fastq_maxdiffs $maxdiffs #end if #if $truncqual.value != 0 -fastq_truncqual $truncqual #end if #if $minlen.value != 0 -fastq_minlen $minlen #end if $allowmergestagger -fastq_ascii $ascii -fastq_qmin $qmin -fastq_qmax $qmax -fastq_qmaxout $qmaxout #if $out_format.value == "fastq" -fastqout $output #else -fastaout $output #end if </command> <inputs> <param name="input_forward" type="data" format="fastq,fastqsanger,fastqcssanger" label="1. File with forward reads" /> <param name="input_reverse" type="data" format="fastq,fastqsanger,fastqcssanger" label="2. File with reverse reads" /> <param name="minovlen" type="integer" value="0" label="3. Minimum length of the overlap" help="'0' means no minimum." /> <param name="minmergelen" type="integer" value="0" label="4. Minimum length of the merged read" help="'0' means no minimum." /> <param name="maxmergelen" type="integer" value="0" label="5. Maximum length of the merged read" help="'0' means no maximum." /> <param name="maxdiffs" type="integer" value="0" label="6. Maximum number of mismatches allowed in the overlap region" help="'0' means any number of mismatches allowed." /> <param name="truncqual" type="integer" value="0" label="7. Truncate the forward and reverse reads at the first Q that is equal or less than this value, if present" help="'0' means no quality truncation. This truncation is performed before aligning the pair. With Illumina paired reads, it is recommended to set this to 2 or higher, as low-quality tails will otherwise often cause alignment of the pair to fail." /> <param name="minlen" type="integer" value="0" label="8. Minimum length of the forward and reverse read, after truncating per option 7 if applicable" help="'0' means no minimum." /> <param name="allowmergestagger" type="boolean" truevalue="-fastq_allowmergestagger" falsevalue="" checked="false" label="9. Allow merge of a pair where the alignment is staggered" help="By default, pairs with staggered alignments are discarded." /> <param name="ascii" type="integer" value="33" label="10. ASCII_BASE constant" help="See http://drive5.com/usearch/manual/fastq_params.html" /> <param name="qmin" type="integer" value="0" label="11. Minimum Q score" /> <param name="qmax" type="integer" value="41" label="12. Maximum Q score for input files" /> <param name="qmaxout" type="integer" value="41" label="13. Maximum Q score for output files" /> <param name="out_format" type="select" label="Output format"> <option value="fastq">FASTQ</option> <option value="fasta">FASTA</option> </param> </inputs> <outputs> <data format="fastq" name="output" label="Merge output"> <change_format> <when input="out_format" value="fasta" format="fasta" /> </change_format> </data> </outputs> <tests> <test> <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastq" /> <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastq" /> <param name="qmax" value="65" /> <output name="output" file="fastq_mergepairs_output1.fastq" /> </test> <test> <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastq" /> <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastq" /> <param name="minovlen" value="30" /> <param name="qmax" value="65" /> <param name="out_format" value="fasta" /> <output name="output" file="fastq_mergepairs_output2.fasta" /> </test> </tests> <help> **What it Does** Performs merging of paired reads. Forward and reverse must be in 1:1 correspondence and must appear in the same order in both files. The labels for the forward and reverse read in a given pair must be identical except for a single position where a '1' appears in the forward read label and a '2' appears in the reverse read label. ----- **Input formats** Forward reads:: @IRIS:7:1:29:952#0/1 TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAG +IRIS:7:1:29:952#0/1 aaabaaaaaaaaaaa`aaY`aa^aaa^a_a_`aa`` Reverse reads:: @IRIS:7:1:29:952#0/2 GACTCCAAAACACTAACCAACCTTCTTCTTGCTTCT +IRIS:7:1:29:952#0/2 aaaabaaaabaaaabbaaaa````__`__^__``__ ----- **Output** A multiple-fastq file, for example:: @IRIS:7:1:29:952#0/1 TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTC + aaJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJaa ------ **Manual** * USEARCH fastq_mergepairs options: http://drive5.com/usearch/manual/fastq_mergepairs.html * FASTQ format options: http://drive5.com/usearch/manual/fastq_params.html **Citation** Please cite one of these papers if you use USEARCH in published work. Edgar,RC (2010) Search and clustering orders of magnitude faster than BLAST, Bioinformatics 26(19), 2460-2461. doi: 10.1093/bioinformatics/btq461 </help> </tool>