view usearch_fastq_mergepairs.xml @ 29:29cb532fc1ee draft

Uploaded

<tool id="usearch_fastq_mergepairs" name="usearch fastq_mergepairs" version="0.0.2">
    <description>merging of paired reads</description>
    <version_command>usearch -version</version_command>
    <command interpreter='bash'>usearch_wrapper.sh
usearch
-quiet
-fastq_mergepairs '$input_forward'
-reverse '$input_reverse'
#if $minovlen.value != 0
    -fastq_minovlen $minovlen
#end if
#if $minmergelen.value != 0
    -fastq_minmergelen $minmergelen
#end if
#if $maxmergelen.value != 0
    -fastq_maxmergelen $maxmergelen
#end if
#if $maxdiffs.value != 0
    -fastq_maxdiffs $maxdiffs
#end if
#if $truncqual.value != 0
    -fastq_truncqual $truncqual
#end if
#if $minlen.value != 0
    -fastq_minlen $minlen
#end if
$allowmergestagger
-fastq_ascii $ascii
-fastq_qmin $qmin
-fastq_qmax $qmax
-fastq_qmaxout $qmaxout
#if $output_format.format == "fastq"
    -fastqout $output
#else
    -fastaout $output
#end if
    </command>
    <inputs>
        <!-- INPUT OPTIONS -->
        <param name="input_forward"		type="data" format="fastq,fastqsanger,fastqcssanger" label="1. File with forward reads" />
        <param name="input_reverse" 	type="data" format="fastq,fastqsanger,fastqcssanger" label="2. File with reverse reads" />
        <param name="minovlen" 			type="integer" value="0" label="3. Minimum length of the overlap" help="'0' means no minimum." />
        <param name="minmergelen" 		type="integer" value="0" label="4. Minimum length of the merged read" help="'0' means no minimum." />
        <param name="maxmergelen" 		type="integer" value="0" label="5. Maximum length of the merged read" help="'0' means no maximum." />
        <param name="maxdiffs" 			type="integer" value="0" label="6. Maximum number of mismatches allowed in the overlap region" help="'0' means any number of mismatches allowed" />
        <param name="truncqual" 		type="integer" value="0" label="7. Truncate the forward and reverse reads at the first Q that is equal or less than this value, if present."
			   help="'0' means no quality truncation. This truncation is performed before aligning the pair. With Illumina paired reads, it is recommended to set this to 2 or higher, as low-quality tails will otherwise often cause alignment of the pair to fail." />
        <param name="minlen" 			type="integer" value="0" label="8. Minimum length of the forward and reverse read, after truncating per option 7 if applicable" help="'0' means no minimum." />
        <param name="allowmergestagger" type="boolean" truevalue="-fastq_allowmergestagger" falsevalue="" checked="false" label="9. Allow merge of a pair where the alignment is staggered" help="By default, pairs with staggered alignments are discarded." />
        <param name="ascii"	 			type="integer" value="33" label="10. ASCII_BASE constant" help="See http://drive5.com/usearch/manual/fastq_params.html" />
        <param name="qmin" 				type="integer" value="0" label="11. Minimum Q score" />
        <param name="qmax" 				type="integer" value="41" label="12. Maximum Q score for input files" />
        <param name="qmaxout" 			type="integer" value="41" label="13. Maximum Q score for output files" />

        <!-- OUTPUT OPTIONS -->
        <conditional name="output_format">
            <param name="format" type="select" label="Output format">
                <option value="fastq" selected="true">FASTQ</option>
                <option value="fasta">FASTA</option>
            </param>
            <when value="fastq"></when>
            <when value="fasta"></when>
        </conditional>
   </inputs>
    <outputs>
		<data format="fastq" name="output" label="Merge output">
			<change_format>
				<when input="format" value="fasta" format="fasta" />
			</change_format>
		</data>
    </outputs>
    <tests>
        <test>
          <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastqsanger" />
          <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastqsanger" />
          <param name="qmax" value="65" />
          <output name="output" file="fastq_mergepairs_output.fq" />
        </test>
    </tests>
    <help>
**What it Does**

Performs merging of paired reads.

The FASTQ filename for the forward reads is specified by the -fastq_mergepairs option, and the reverse read filename is specified by the -reverse option. Output files are specified by -fastqout (for FASTQ) and / or -fastaout (for FASTA).

Forward and reverse must be in 1:1 correspondence and must appear in the same order in both files. The labels for the forward and reverse read in a given pair must be identical except for a single position where a '1' appears in the forward read label and a '2' appears in the reverse read label.

-----

**Input formats**

Forward read::

    @IRIS:7:1:29:952#0/1
    TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAG
    +IRIS:7:1:29:952#0/1
    aaabaaaaaaaaaaa`aaY`aa^aaa^a_a_`aa``

Reverse read::

    @IRIS:7:1:29:952#0/2
    GACTCCAAAACACTAACCAACCTTCTTCTTGCTTCT
    +IRIS:7:1:29:952#0/2
    aaaabaaaabaaaabbaaaa````__`__^__``__

-----

**Output**

A multiple-fastq file, for example::

    @IRIS:7:1:29:952#0/1
    TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTC
    +
    aaJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJaa

------

**Manual**

USEARCH `fastq_mergepairs' command options: http://drive5.com/usearch/manual/fastq_mergepairs.html
FASTQ format options: http://drive5.com/usearch/manual/fastq_params.html

**Citation**

Please cite one of these papers if you use USEARCH in published work.

Edgar,RC (2010) Search and clustering orders of magnitude faster than BLAST, Bioinformatics 26(19), 2460-2461.
doi: 10.1093/bioinformatics/btq461
    </help>
</tool>