Mercurial > repos > serranop > usearch
diff usearch_fastq_mergepairs.xml @ 2:fff15877fea7 draft
Uploaded tool XML and test data
author | serranop |
---|---|
date | Fri, 13 Sep 2013 13:04:45 -0400 |
parents | |
children | 4e8832829f07 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/usearch_fastq_mergepairs.xml Fri Sep 13 13:04:45 2013 -0400 @@ -0,0 +1,81 @@ +<tool id="usearch_fastq_mergepairs" name="usearch fastq_mergepairs" version="0.0.1"> + <description>merging of paired reads</description> + <version_command>usearch -version</version_command> + <command interpreter='bash'>usearch + -fastq_mergepairs '$input_forward' + -reverse '$input_reverse' + -fastq_qmaxout $qmaxout + -fastqout '$output' + </command> + <inputs> + <param name='input_forward' type='data' format='fastq,fastqsanger,fastqcssanger' label='The FASTQ filename for the forward reads' /> + <param name='input_reverse' type='data' format='fastq,fastqsanger,fastqcssanger' label='The FASTQ filename for the reverse reads' /> + <param name='qmaxout' type='integer' value='41' label='Maximum Q score (input files).' /> + </inputs> + <outputs> + <data name='output' format='fastq' label="Merge result" /> + </outputs> + <tests> + <test> + <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastqsanger" /> + <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastqsanger" /> + <param name="qmaxout" value="65" /> + <output name="output" file="fastq_mergepairs_output.fq" /> + </test> + </tests> + <help> +**What it Does** + +Performs merging of paired reads. + +The FASTQ filename for the forward reads is specified by the -fastq_mergepairs option, and the reverse read filename is specified by the -reverse option. Output files are specified by -fastqout (for FASTQ) and / or -fastaout (for FASTA). + +Forward and reverse must be in 1:1 correspondence and must appear in the same order in both files. The labels for the forward and reverse read in a given pair must be identical except for a single position where a '1' appears in the forward read label and a '2' appears in the reverse read label. + +----- + +**Input formats** + +Forward read:: + + @IRIS:7:1:29:952#0/1 + TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAG + +IRIS:7:1:29:952#0/1 + aaabaaaaaaaaaaa`aaY`aa^aaa^a_a_`aa`` + +Reverse read:: + + @IRIS:7:1:29:952#0/2 + GACTCCAAAACACTAACCAACCTTCTTCTTGCTTCT + +IRIS:7:1:29:952#0/2 + aaaabaaaabaaaabbaaaa````__`__^__``__ + +----- + +**Output** + +A multiple-fastq file, for example:: + + @IRIS:7:1:29:952#0/1 + TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTC + + + aaJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJaa + +------ + +**Author** + +Robert C. Edgar (robert@drive5.com) + +**Manual** + +http://drive5.com/usearch/manual/fastq_mergepairs.html + +**Citation** + +Please cite one of these papers if you use USEARCH in published work. + +Edgar,RC (2010) Search and clustering orders of magnitude faster than BLAST, Bioinformatics 26(19), 2460-2461. +doi: 10.1093/bioinformatics/btq461 + </help> +</tool>