Mercurial > repos > serranop > usearch
diff usearch_fastq_mergepairs.xml @ 33:bb844274de30 draft
Uploaded
author | serranop |
---|---|
date | Sat, 14 Sep 2013 13:15:52 -0400 |
parents | 790c5a9be6fc |
children | b26aa9ab77db |
line wrap: on
line diff
--- a/usearch_fastq_mergepairs.xml Sat Sep 14 12:42:37 2013 -0400 +++ b/usearch_fastq_mergepairs.xml Sat Sep 14 13:15:52 2013 -0400 @@ -36,45 +36,48 @@ #end if </command> <inputs> - <!-- INPUT OPTIONS --> - <param name="input_forward" type="data" format="fastq,fastqsanger,fastqcssanger" label="1. File with forward reads" /> - <param name="input_reverse" type="data" format="fastq,fastqsanger,fastqcssanger" label="2. File with reverse reads" /> - <param name="minovlen" type="integer" value="0" label="3. Minimum length of the overlap" help="'0' means no minimum." /> - <param name="minmergelen" type="integer" value="0" label="4. Minimum length of the merged read" help="'0' means no minimum." /> - <param name="maxmergelen" type="integer" value="0" label="5. Maximum length of the merged read" help="'0' means no maximum." /> - <param name="maxdiffs" type="integer" value="0" label="6. Maximum number of mismatches allowed in the overlap region" help="'0' means any number of mismatches allowed." /> - <param name="truncqual" type="integer" value="0" label="7. Truncate the forward and reverse reads at the first Q that is equal or less than this value, if present" - help="'0' means no quality truncation. This truncation is performed before aligning the pair. With Illumina paired reads, it is recommended to set this to 2 or higher, as low-quality tails will otherwise often cause alignment of the pair to fail." /> - <param name="minlen" type="integer" value="0" label="8. Minimum length of the forward and reverse read, after truncating per option 7 if applicable" help="'0' means no minimum." /> + <param name="input_forward" type="data" format="fastq,fastqsanger,fastqcssanger" label="1. File with forward reads" /> + <param name="input_reverse" type="data" format="fastq,fastqsanger,fastqcssanger" label="2. File with reverse reads" /> + <param name="minovlen" type="integer" value="0" label="3. Minimum length of the overlap" help="'0' means no minimum." /> + <param name="minmergelen" type="integer" value="0" label="4. Minimum length of the merged read" help="'0' means no minimum." /> + <param name="maxmergelen" type="integer" value="0" label="5. Maximum length of the merged read" help="'0' means no maximum." /> + <param name="maxdiffs" type="integer" value="0" label="6. Maximum number of mismatches allowed in the overlap region" help="'0' means any number of mismatches allowed." /> + <param name="truncqual" type="integer" value="0" label="7. Truncate the forward and reverse reads at the first Q that is equal or less than this value, if present" + help="'0' means no quality truncation. This truncation is performed before aligning the pair. With Illumina paired reads, it is recommended to set this to 2 or higher, as low-quality tails will otherwise often cause alignment of the pair to fail." /> + <param name="minlen" type="integer" value="0" label="8. Minimum length of the forward and reverse read, after truncating per option 7 if applicable" help="'0' means no minimum." /> <param name="allowmergestagger" type="boolean" truevalue="-fastq_allowmergestagger" falsevalue="" checked="false" label="9. Allow merge of a pair where the alignment is staggered" help="By default, pairs with staggered alignments are discarded." /> - <param name="ascii" type="integer" value="33" label="10. ASCII_BASE constant" help="See http://drive5.com/usearch/manual/fastq_params.html" /> - <param name="qmin" type="integer" value="0" label="11. Minimum Q score" /> - <param name="qmax" type="integer" value="41" label="12. Maximum Q score for input files" /> - <param name="qmaxout" type="integer" value="41" label="13. Maximum Q score for output files" /> - <conditional name="cond_format"> - <param name="out_format" type="select" label="Output format"> - <option value="fastq" selected="true">FASTQ</option> - <option value="fasta">FASTA</option> - </param> - <when value="fastq"></when> - <when value="fasta"></when> - </conditional> + <param name="ascii" type="integer" value="33" label="10. ASCII_BASE constant" help="See http://drive5.com/usearch/manual/fastq_params.html" /> + <param name="qmin" type="integer" value="0" label="11. Minimum Q score" /> + <param name="qmax" type="integer" value="41" label="12. Maximum Q score for input files" /> + <param name="qmaxout" type="integer" value="41" label="13. Maximum Q score for output files" /> + <param name="out_format" type="select" label="Output format"> + <option value="fastq">FASTQ</option> + <option value="fasta">FASTA</option> + </param> </inputs> <outputs> - <data format="fastq" name="output" label="Merge output"> - <change_format> - <when input="out_format" value="fasta" format="fasta" /> - </change_format> - </data> + <data format="fastq" name="output" label="Merge output"> + <change_format> + <when input="out_format" value="fasta" format="fasta" /> + </change_format> + </data> </outputs> <tests> <test> - <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastqsanger" /> - <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastqsanger" /> + <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastq" /> + <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastq" /> <param name="qmax" value="65" /> - <output name="output" file="fastq_mergepairs_output.fq" /> + <output name="output" file="fastq_mergepairs_output1.fastq" /> </test> - </tests> + <test> + <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastq" /> + <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastq" /> + <param name="minovlen" value="30" /> + <param name="qmax" value="65" /> + <param name="out_format" value="fasta" /> + <output name="output" file="fastq_mergepairs_output2.fasta" /> + </test> + </tests> <help> **What it Does** @@ -89,14 +92,14 @@ **Input formats** -Forward read:: +Forward reads:: @IRIS:7:1:29:952#0/1 TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAG +IRIS:7:1:29:952#0/1 aaabaaaaaaaaaaa`aaY`aa^aaa^a_a_`aa`` -Reverse read:: +Reverse reads:: @IRIS:7:1:29:952#0/2 GACTCCAAAACACTAACCAACCTTCTTCTTGCTTCT @@ -118,7 +121,7 @@ **Manual** -* USEARCH fastq_mergepairs command options: http://drive5.com/usearch/manual/fastq_mergepairs.html +* USEARCH fastq_mergepairs options: http://drive5.com/usearch/manual/fastq_mergepairs.html * FASTQ format options: http://drive5.com/usearch/manual/fastq_params.html **Citation**