Mercurial > repos > sanbi-uwc > lofreq

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/lofreq_call.xml	Tue Sep 05 09:57:57 2017 -0400
@@ -0,0 +1,170 @@
+<tool id="lofreq_call" name="LoFreq Calling Variants" version="0.1.0">
+    <requirements>
+        <requirement type="package" version="2.1.2">lofreq</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range="1:" />
+    </stdio>
+    <command><![CDATA[
+        lofreq call
+        -f "$input1"
+        -o "$output1"
+        #if $region and str($region) != '':
+          -r "$region"
+        #end if
+        #if $region-bed-file and str($region-bed-file) != '':
+          -l "$region-bed-file"
+        #end if
+        --min-bq "$min-bq"
+        --min-alt-bq "$min-alt-bq"
+        --def-alt-bq "$def-alt-bq"
+        --min-jq "$min-jq"
+        --min-alt-jq "$min-alt-jq"
+        --def-alt-jq "$def-alt-jq"
+        #if $base_alignment_and_indel_alignment and str($base_alignment_and_indel_alignment) != '':
+          #echo " "
+          #echo ' '.join(str($base_alignment_and_indel_alignment).split(','))
+        #end if
+        --min-mq "$min-bq"
+        --max-mq "$max-mq"
+        --def-nm-q "$def-nm-q"
+        --min-cov "$min-cov"
+        --max-depth "$max-depth"
+        $merge_mapping_quality
+        #if $sq_vcf and str($sq_vcf) != '':
+          -S "$sq_vcf"
+        #end if
+        #if $indels and str($indels) != '':
+          #echo " "
+          #echo ' '.join(str($indels).split(','))
+        #end if
+        #if $misc and str($misc) != '':
+          #echo " "
+          #echo ' '.join(str($misc).split(','))
+        #end if
+        "$input2"
+    ]]></command>
+    <inputs>
+        <param type="data" name="input2" format="bam" label="Input Bam File"/>
+        <param type="data" name="input1" format="fa,fasta" label="Indexed reference fasta file (gzip supported)" help="Indexed reference fasta file (gzip supported)"/>
+        <param name="region" type="text" label="Limit calls to this region (chrom:start-end)">
+            <help>
+               Limit calls to this region (chrom:start-end).
+            </help>
+            <validator type="regex" message="No whitespace allowed">^\S*$</validator>
+        </param>
+        <param format="bed" name="region-bed-file" type="data" optional="true" label="List of positions (chr pos) or regions (BED) file"/>
+	    <param name="min-bq" type="integer" label="Skip any base with baseQ smaller than" value="6" help="Skip any base with baseQ smaller than [INT]" />
+        <param name="min-alt-bq" type="integer" label="Skip alternate bases with baseQ smaller than" value="6" help=" Skip alternate bases with baseQ smaller than [INT]" />
+        <param name="def-alt-bq" type="integer" label="Overwrite baseQs of alternate bases (that passed bq filter) with this value (-1: use median ref-bq; 0: keep)" value="0" help="Overwrite baseQs of alternate bases (that passed bq filter) with this value (-1: use median ref-bq; 0: keep) [INT]" />
+        <param name="min-jq" type="integer" label="Skip any base with joinedQ smaller than" value="0" help="Skip any base with joinedQ smaller than [INT]" />
+        <param name="min-alt-jq" type="integer" label="Skip alternate bases with joinedQ smaller than" value="0" help="Skip alternate bases with joinedQ smaller than [INT]" />
+        <param name="def-alt-jq" type="integer" label="Overwrite joinedQs of alternate bases (that passed jq filter) with this value (-1: use median ref-bq; 0: keep)" value="0" help="Overwrite joinedQs of alternate bases (that passed jq filter) with this value (-1: use median ref-bq; 0: keep)" />
+
+        <param name="base_alignment_and_indel_alignment" type="select" display="checkboxes" multiple="true" label="Base-alignment (BAQ) and indel-aligment (IDAQ) qualities Options">
+            <option value="--no-baq">Disable use of base-alignment quality (BAQ)</option>
+            <option value="--no-idap">Don't use IDAQ values (NOT recommended under ANY circumstances other than debugging)</option>
+            <option value="--del-baq">Delete pre-existing BAQ values, i.e. compute even if already present in BAM</option>
+            <option value="--no-ext-baq"> Use 'normal' BAQ (samtools default) instead of extended BAQ (both computed on the fly if not already present in lb tag)</option>
+        </param>
+        <param name="min-mq" type="integer" label="Skip reads with mapping quality smaller than" value="0" help="Skip reads with mapping quality smaller than [INT]" />
+        <param name="max-mq" type="integer" label="Cap mapping quality at " value="0" help="Cap mapping quality at [INT]" />
+        <param name="def-nm-q" type="integer" label="If >= 0, then replace non-match base qualities with this default value [-1] " value="0" help="   If >= 0, then replace non-match base qualities with this default value [-1]" />
+        <param name="min-cov" type="integer" label="Test only positions having at least this coverage " value="1" help="(note: without --no-default-filter default filters (incl. coverage) kick in after predictions are done)" />
+        <param name="max-depth" type="integer" label=" Cap coverage at this depth" value="1000000" help="Cap coverage at this depth [1000000] [INT]" />
+
+        <param name="merge_mapping_quality" type="boolean" truevalue="" falsevalue="--no-mq" checked="true" label="Don't merge mapping quality in LoFreq's model"/>
+        <param format="vcf" name="sq_vcf" type="data" optional="true" label="Ignore variants in this vcf file for source quality computation."/>
+        <param name="indels" type="select" display="checkboxes" multiple="true" label="Indels Options">
+            <option value="--call-indels">Enable indel calls (note: preprocess your file to include indel alignment qualities!)</option>
+            <option value="--only-indels">Only call indels; no SNVs</option>
+        </param>
+
+        <param name="misc" type="select" display="checkboxes" multiple="true" label="Misc Options">
+            <option value="--src-qual">Enable computation of source quality</option>
+            <option value="--sig">P-Value cutoff / significance level [0.010000]</option>
+            <option value="--bonf">Bonferroni factor. 'dynamic' (increase per actually performed test) or INT ['dynamic']</option>
+            <option value="--illumina-1.3">Assume the quality is Illumina-1.3-1.7/ASCII+64 encoded</option>
+            <option value="--use-orphan">Count anomalous read pairs (i.e. where mate is not aligned properly)</option>
+            <option value="--plp-summary-only">No variant calling. Just output pileup summary per column</option>
+            <option value="--no-default-filter">Don't run default 'lofreq filter' automatically after calling variants</option>
+            <option value="--force-overwrite">Overwrite any existing output</option>
+            <option value="--verbose">Be verbose</option>
+            <option value="--debug">Enable debugging</option>
+        </param>
+
+    </inputs>
+    <outputs>
+        <data name="output1" format="vcf" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input1" value="ref.fa"/>
+            <param name="input2" value="aln.bam"/>
+            <output name="output1" file="vars.vcf"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+        lofreq call: call variants from BAM file
+
+Usage: lofreq call [options] in.bam
+
+Options:
+- Reference:
+       -f | --ref FILE              Indexed reference fasta file (gzip supported) [null]
+- Output:
+       -o | --out FILE              Vcf output file [- = stdout]
+- Regions:
+       -r | --region STR            Limit calls to this region (chrom:start-end) [null]
+       -l | --bed FILE              List of positions (chr pos) or regions (BED) [null]
+- Base-call quality:
+       -q | --min-bq INT            Skip any base with baseQ smaller than INT [6]
+       -Q | --min-alt-bq INT        Skip alternate bases with baseQ smaller than INT [6]
+       -R | --def-alt-bq INT        Overwrite baseQs of alternate bases (that passed bq filter) with this value (-1: use median ref-bq; 0: keep) [0]
+       -j | --min-jq INT            Skip any base with joinedQ smaller than INT [0]
+       -J | --min-alt-jq INT        Skip alternate bases with joinedQ smaller than INT [0]
+       -K | --def-alt-jq INT        Overwrite joinedQs of alternate bases (that passed jq filter) with this value (-1: use median ref-bq; 0: keep) [0]
+- Base-alignment (BAQ) and indel-aligment (IDAQ) qualities:
+       -B | --no-baq                Disable use of base-alignment quality (BAQ)
+       -A | --no-idaq               Don't use IDAQ values (NOT recommended under ANY circumstances other than debugging)
+       -D | --del-baq               Delete pre-existing BAQ values, i.e. compute even if already present in BAM
+       -e | --no-ext-baq            Use 'normal' BAQ (samtools default) instead of extended BAQ (both computed on the fly if not already present in lb tag)
+- Mapping quality:
+       -m | --min-mq INT            Skip reads with mapping quality smaller than INT [0]
+       -M | --max-mq INT            Cap mapping quality at INT [255]
+       -N | --no-mq                 Don't merge mapping quality in LoFreq's model
+- Indels:
+            --call-indels           Enable indel calls (note: preprocess your file to include indel alignment qualities!)
+            --only-indels           Only call indels; no SNVs
+- Source quality:
+       -s | --src-qual              Enable computation of source quality
+       -S | --ign-vcf FILE          Ignore variants in this vcf file for source quality computation. Multiple files can be given separated by commas
+       -T | --def-nm-q INT          If >= 0, then replace non-match base qualities with this default value [-1]
+- P-values:
+       -a | --sig                   P-Value cutoff / significance level [0.010000]
+       -b | --bonf                  Bonferroni factor. 'dynamic' (increase per actually performed test) or INT ['dynamic']
+- Misc.:
+       -C | --min-cov INT           Test only positions having at least this coverage [1]
+                                    (note: without --no-default-filter default filters (incl. coverage) kick in after predictions are done)
+       -d | --max-depth INT         Cap coverage at this depth [1000000]
+            --illumina-1.3          Assume the quality is Illumina-1.3-1.7/ASCII+64 encoded
+            --use-orphan            Count anomalous read pairs (i.e. where mate is not aligned properly)
+            --plp-summary-only      No variant calling. Just output pileup summary per column
+            --no-default-filter     Don't run default 'lofreq filter' automatically after calling variants
+            --force-overwrite       Overwrite any existing output
+            --verbose               Be verbose
+            --debug                 Enable debugging
+
+    ]]></help>
+    <citations>
+        <citation type="bibtex">
+@misc{githublofreq,
+  author = {LastTODO, FirstTODO},
+  year = {TODO},
+  title = {lofreq},
+  publisher = {GitHub},
+  journal = {GitHub repository},
+  url = {https://github.com/CSB5/lofreq},
+}</citation>
+    </citations>
+</tool>
\ No newline at end of file
Binary file test-data/aln.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ref.fa	Tue Sep 05 09:57:57 2017 -0400
@@ -0,0 +1,56 @@
+>seq1
+CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCT
+GTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCAC
+GGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAG
+TCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTC
+AGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAA
+CAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACC
+AAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCT
+CTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAGCTCCCTGTCACCCA
+ATGGACCTGTGATATCTGGATTCTGGGAAATTCTTCATCCTGGACCCTGAGAGATTCTGC
+AGCCCAGCTCCAGATTGCTTGTGGTCTGACAGGCTGCAACTGTGAGCCATCACAATGAAC
+AACAGGAAGAAAAGGTCTTTCAAAAGGTGATGTGTGTTCTCATCAACCTCATACACACAC
+ATGGTTTAGGGGTATAATACCTCTACATGGCTGATTATGAAAACAATGTTCCCCAGATAC
+CATCCCTGTCTTACTTCCAGCTCCCCAGAGGGAAAGCTTTCAACGCTTCTAGCCATTTCT
+TTTGGCATTTGCCTTCAGACCCTACACGAATGCGTCTCTACCACAGGGGGCTGCGCGGTT
+TCCCATCATGAAGCACTGAACTTCCACGTCTCATCTAGGGGAACAGGGAGGTGCACTAAT
+GCGCTCCACGCCCAAGCCCTTCTCACAGTTTCTGCCCCCAGCATGGTTGTACTGGGCAAT
+ACATGAGATTATTAGGAAATGCTTTACTGTCATAACTATGAAGAGACTATTGCCAGATGA
+ACCACACATTAATACTATGTTTCTTATCTGCACATTACTACCCTGCAATTAATATAATTG
+TGTCCATGTACACACGCTGTCCTATGTACTTATCATGACTCTATCCCAAATTCCCAATTA
+CGTCCTATCTTCTTCTTAGGGAAGAACAGCTTAGGTATCAATTTGGTGTTCTGTGTAAAG
+TCTCAGGGAGCCGTCCGTGTCCTCCCATCTGGCCTCGTCCACACTGGTTCTCTTGAAAGC
+TTGGGCTGTAATGATGCCCCTTGGCCATCACCCAGTCCCTGCCCCATCTCTTGTAATCTC
+TCTCCTTTTTGCTGCATCCCTGTCTTCCTCTGTCTTGATTTACTTGTTGTTGGTTTTCTG
+TTTCTTTGTTTGATTTGGTGGAAGACATAATCCCACGCTTCCTATGGAAAGGTTGTTGGG
+AGATTTTTAATGATTCCTCAATGTTAAAATGTCTATTTTTGTCTTGACACCCAACTAATA
+TTTGTCTGAGCAAAACAGTCTAGATGAGAGAGAACTTCCCTGGAGGTCTGATGGCGTTTC
+TCCCTCGTCTTCTTA
+>seq2
+TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAG
+CTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCT
+TATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTT
+CAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAA
+AAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTT
+AGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATAC
+ATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAG
+GAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTATAAAGGAAATCCCAT
+CAGAATAACAATGGGCTTCTCAGCAGAAACCTTACAAGCCAGAAGAGATTGGATCTAATT
+TTTGGACTTCTTAAAGAAAAAAAAACCTGTCAAACACGAATGTTATGCCCTGCTAAACTA
+AGCATCATAAATGAAGGGGAAATAAAGTCAAGTCTTTCCTGACAAGCAAATGCTAAGATA
+ATTCATCATCACTAAACCAGTCCTATAAGAAATGCTCAAAAGAATTGTAAAAGTCAAAAT
+TAAAGTTCAATACTCACCATCATAAATACACACAAAAGTACAAAACTCACAGGTTTTATA
+AAACAATTGAGACTACAGAGCAACTAGGTAAAAAATTAACATTACAACAGGAACAAAACC
+TCATATATCAATATTAACTTTGAATAAAAAGGGATTAAATTCCCCCACTTAAGAGATATA
+GATTGGCAGAACAGATTTAAAAACATGAACTAACTATATGCTGTTTACAAGAAACTCATT
+AATAAAGACATGAGTTCAGGTAAAGGGGTGGAAAAAGATGTTCTACGCAAACAGAAACCA
+AATGAGAGAAGGAGTAGCTATACTTATATCAGATAAAGCACACTTTAAATCAACAACAGT
+AAAATAAAACAAAGGAGGTCATCATACAATGATAAAAAGATCAATTCAGCAAGAAGATAT
+AACCATCCTACTAAATACATATGCACCTAACACAAGACTACCCAGATTCATAAAACAAAT
+ACTACTAGACCTAAGAGGGATGAGAAATTACCTAATTGGTACAATGTACAATATTCTGAT
+GATGGTTACACTAAAAGCCCATACTTTACTGCTACTCAATATATCCATGTAACAAATCTG
+CGCTTGTACTTCTAAATCTATAAAAAAATTAAAATTTAACAAAAGTAAATAAAACACATA
+GCTAAAACTAAAAAAGCAAAAACAAAAACTATGCTAAGTATTGGTAAAGATGTGGGGAAA
+AAAGTAAACTCTCAAATATTGCTAGTGGGAGTATAAATTGTTTTCCACTTTGGAAAACAA
+TTTGGTAATTTCGTTTTTTTTTTTTTCTTTTCTCTTTTTTTTTTTTTTTTTTTTGCATGC
+CAGAAAAAAATATTTACAGTAACT