Mercurial > repos > sanbi-uwc > lofreq
changeset 0:022deab2faf6 draft
planemo upload for repository https://github.com/SANBI-SA/tools-sanbi-uwc/tree/master/tools/lofreq commit 5b7700f349511e79316cd2ebc2d27eb7c11398e4
| author | sanbi-uwc |
|---|---|
| date | Tue, 05 Sep 2017 09:57:57 -0400 |
| parents | |
| children | fe68e1ac1290 |
| files | lofreq_call.xml test-data/aln.bam test-data/ref.fa |
| diffstat | 3 files changed, 226 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/lofreq_call.xml Tue Sep 05 09:57:57 2017 -0400 @@ -0,0 +1,170 @@ +<tool id="lofreq_call" name="LoFreq Calling Variants" version="0.1.0"> + <requirements> + <requirement type="package" version="2.1.2">lofreq</requirement> + </requirements> + <stdio> + <exit_code range="1:" /> + </stdio> + <command><![CDATA[ + lofreq call + -f "$input1" + -o "$output1" + #if $region and str($region) != '': + -r "$region" + #end if + #if $region-bed-file and str($region-bed-file) != '': + -l "$region-bed-file" + #end if + --min-bq "$min-bq" + --min-alt-bq "$min-alt-bq" + --def-alt-bq "$def-alt-bq" + --min-jq "$min-jq" + --min-alt-jq "$min-alt-jq" + --def-alt-jq "$def-alt-jq" + #if $base_alignment_and_indel_alignment and str($base_alignment_and_indel_alignment) != '': + #echo " " + #echo ' '.join(str($base_alignment_and_indel_alignment).split(',')) + #end if + --min-mq "$min-bq" + --max-mq "$max-mq" + --def-nm-q "$def-nm-q" + --min-cov "$min-cov" + --max-depth "$max-depth" + $merge_mapping_quality + #if $sq_vcf and str($sq_vcf) != '': + -S "$sq_vcf" + #end if + #if $indels and str($indels) != '': + #echo " " + #echo ' '.join(str($indels).split(',')) + #end if + #if $misc and str($misc) != '': + #echo " " + #echo ' '.join(str($misc).split(',')) + #end if + "$input2" + ]]></command> + <inputs> + <param type="data" name="input2" format="bam" label="Input Bam File"/> + <param type="data" name="input1" format="fa,fasta" label="Indexed reference fasta file (gzip supported)" help="Indexed reference fasta file (gzip supported)"/> + <param name="region" type="text" label="Limit calls to this region (chrom:start-end)"> + <help> + Limit calls to this region (chrom:start-end). + </help> + <validator type="regex" message="No whitespace allowed">^\S*$</validator> + </param> + <param format="bed" name="region-bed-file" type="data" optional="true" label="List of positions (chr pos) or regions (BED) file"/> + <param name="min-bq" type="integer" label="Skip any base with baseQ smaller than" value="6" help="Skip any base with baseQ smaller than [INT]" /> + <param name="min-alt-bq" type="integer" label="Skip alternate bases with baseQ smaller than" value="6" help=" Skip alternate bases with baseQ smaller than [INT]" /> + <param name="def-alt-bq" type="integer" label="Overwrite baseQs of alternate bases (that passed bq filter) with this value (-1: use median ref-bq; 0: keep)" value="0" help="Overwrite baseQs of alternate bases (that passed bq filter) with this value (-1: use median ref-bq; 0: keep) [INT]" /> + <param name="min-jq" type="integer" label="Skip any base with joinedQ smaller than" value="0" help="Skip any base with joinedQ smaller than [INT]" /> + <param name="min-alt-jq" type="integer" label="Skip alternate bases with joinedQ smaller than" value="0" help="Skip alternate bases with joinedQ smaller than [INT]" /> + <param name="def-alt-jq" type="integer" label="Overwrite joinedQs of alternate bases (that passed jq filter) with this value (-1: use median ref-bq; 0: keep)" value="0" help="Overwrite joinedQs of alternate bases (that passed jq filter) with this value (-1: use median ref-bq; 0: keep)" /> + + <param name="base_alignment_and_indel_alignment" type="select" display="checkboxes" multiple="true" label="Base-alignment (BAQ) and indel-aligment (IDAQ) qualities Options"> + <option value="--no-baq">Disable use of base-alignment quality (BAQ)</option> + <option value="--no-idap">Don't use IDAQ values (NOT recommended under ANY circumstances other than debugging)</option> + <option value="--del-baq">Delete pre-existing BAQ values, i.e. compute even if already present in BAM</option> + <option value="--no-ext-baq"> Use 'normal' BAQ (samtools default) instead of extended BAQ (both computed on the fly if not already present in lb tag)</option> + </param> + <param name="min-mq" type="integer" label="Skip reads with mapping quality smaller than" value="0" help="Skip reads with mapping quality smaller than [INT]" /> + <param name="max-mq" type="integer" label="Cap mapping quality at " value="0" help="Cap mapping quality at [INT]" /> + <param name="def-nm-q" type="integer" label="If >= 0, then replace non-match base qualities with this default value [-1] " value="0" help=" If >= 0, then replace non-match base qualities with this default value [-1]" /> + <param name="min-cov" type="integer" label="Test only positions having at least this coverage " value="1" help="(note: without --no-default-filter default filters (incl. coverage) kick in after predictions are done)" /> + <param name="max-depth" type="integer" label=" Cap coverage at this depth" value="1000000" help="Cap coverage at this depth [1000000] [INT]" /> + + <param name="merge_mapping_quality" type="boolean" truevalue="" falsevalue="--no-mq" checked="true" label="Don't merge mapping quality in LoFreq's model"/> + <param format="vcf" name="sq_vcf" type="data" optional="true" label="Ignore variants in this vcf file for source quality computation."/> + <param name="indels" type="select" display="checkboxes" multiple="true" label="Indels Options"> + <option value="--call-indels">Enable indel calls (note: preprocess your file to include indel alignment qualities!)</option> + <option value="--only-indels">Only call indels; no SNVs</option> + </param> + + <param name="misc" type="select" display="checkboxes" multiple="true" label="Misc Options"> + <option value="--src-qual">Enable computation of source quality</option> + <option value="--sig">P-Value cutoff / significance level [0.010000]</option> + <option value="--bonf">Bonferroni factor. 'dynamic' (increase per actually performed test) or INT ['dynamic']</option> + <option value="--illumina-1.3">Assume the quality is Illumina-1.3-1.7/ASCII+64 encoded</option> + <option value="--use-orphan">Count anomalous read pairs (i.e. where mate is not aligned properly)</option> + <option value="--plp-summary-only">No variant calling. Just output pileup summary per column</option> + <option value="--no-default-filter">Don't run default 'lofreq filter' automatically after calling variants</option> + <option value="--force-overwrite">Overwrite any existing output</option> + <option value="--verbose">Be verbose</option> + <option value="--debug">Enable debugging</option> + </param> + + </inputs> + <outputs> + <data name="output1" format="vcf" /> + </outputs> + <tests> + <test> + <param name="input1" value="ref.fa"/> + <param name="input2" value="aln.bam"/> + <output name="output1" file="vars.vcf"/> + </test> + </tests> + <help><![CDATA[ + lofreq call: call variants from BAM file + +Usage: lofreq call [options] in.bam + +Options: +- Reference: + -f | --ref FILE Indexed reference fasta file (gzip supported) [null] +- Output: + -o | --out FILE Vcf output file [- = stdout] +- Regions: + -r | --region STR Limit calls to this region (chrom:start-end) [null] + -l | --bed FILE List of positions (chr pos) or regions (BED) [null] +- Base-call quality: + -q | --min-bq INT Skip any base with baseQ smaller than INT [6] + -Q | --min-alt-bq INT Skip alternate bases with baseQ smaller than INT [6] + -R | --def-alt-bq INT Overwrite baseQs of alternate bases (that passed bq filter) with this value (-1: use median ref-bq; 0: keep) [0] + -j | --min-jq INT Skip any base with joinedQ smaller than INT [0] + -J | --min-alt-jq INT Skip alternate bases with joinedQ smaller than INT [0] + -K | --def-alt-jq INT Overwrite joinedQs of alternate bases (that passed jq filter) with this value (-1: use median ref-bq; 0: keep) [0] +- Base-alignment (BAQ) and indel-aligment (IDAQ) qualities: + -B | --no-baq Disable use of base-alignment quality (BAQ) + -A | --no-idaq Don't use IDAQ values (NOT recommended under ANY circumstances other than debugging) + -D | --del-baq Delete pre-existing BAQ values, i.e. compute even if already present in BAM + -e | --no-ext-baq Use 'normal' BAQ (samtools default) instead of extended BAQ (both computed on the fly if not already present in lb tag) +- Mapping quality: + -m | --min-mq INT Skip reads with mapping quality smaller than INT [0] + -M | --max-mq INT Cap mapping quality at INT [255] + -N | --no-mq Don't merge mapping quality in LoFreq's model +- Indels: + --call-indels Enable indel calls (note: preprocess your file to include indel alignment qualities!) + --only-indels Only call indels; no SNVs +- Source quality: + -s | --src-qual Enable computation of source quality + -S | --ign-vcf FILE Ignore variants in this vcf file for source quality computation. Multiple files can be given separated by commas + -T | --def-nm-q INT If >= 0, then replace non-match base qualities with this default value [-1] +- P-values: + -a | --sig P-Value cutoff / significance level [0.010000] + -b | --bonf Bonferroni factor. 'dynamic' (increase per actually performed test) or INT ['dynamic'] +- Misc.: + -C | --min-cov INT Test only positions having at least this coverage [1] + (note: without --no-default-filter default filters (incl. coverage) kick in after predictions are done) + -d | --max-depth INT Cap coverage at this depth [1000000] + --illumina-1.3 Assume the quality is Illumina-1.3-1.7/ASCII+64 encoded + --use-orphan Count anomalous read pairs (i.e. where mate is not aligned properly) + --plp-summary-only No variant calling. Just output pileup summary per column + --no-default-filter Don't run default 'lofreq filter' automatically after calling variants + --force-overwrite Overwrite any existing output + --verbose Be verbose + --debug Enable debugging + + ]]></help> + <citations> + <citation type="bibtex"> +@misc{githublofreq, + author = {LastTODO, FirstTODO}, + year = {TODO}, + title = {lofreq}, + publisher = {GitHub}, + journal = {GitHub repository}, + url = {https://github.com/CSB5/lofreq}, +}</citation> + </citations> +</tool> \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/ref.fa Tue Sep 05 09:57:57 2017 -0400 @@ -0,0 +1,56 @@ +>seq1 +CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCT +GTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCAC +GGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAG +TCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTC +AGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAA +CAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACC +AAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCT +CTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAGCTCCCTGTCACCCA +ATGGACCTGTGATATCTGGATTCTGGGAAATTCTTCATCCTGGACCCTGAGAGATTCTGC +AGCCCAGCTCCAGATTGCTTGTGGTCTGACAGGCTGCAACTGTGAGCCATCACAATGAAC +AACAGGAAGAAAAGGTCTTTCAAAAGGTGATGTGTGTTCTCATCAACCTCATACACACAC +ATGGTTTAGGGGTATAATACCTCTACATGGCTGATTATGAAAACAATGTTCCCCAGATAC +CATCCCTGTCTTACTTCCAGCTCCCCAGAGGGAAAGCTTTCAACGCTTCTAGCCATTTCT +TTTGGCATTTGCCTTCAGACCCTACACGAATGCGTCTCTACCACAGGGGGCTGCGCGGTT +TCCCATCATGAAGCACTGAACTTCCACGTCTCATCTAGGGGAACAGGGAGGTGCACTAAT +GCGCTCCACGCCCAAGCCCTTCTCACAGTTTCTGCCCCCAGCATGGTTGTACTGGGCAAT +ACATGAGATTATTAGGAAATGCTTTACTGTCATAACTATGAAGAGACTATTGCCAGATGA +ACCACACATTAATACTATGTTTCTTATCTGCACATTACTACCCTGCAATTAATATAATTG +TGTCCATGTACACACGCTGTCCTATGTACTTATCATGACTCTATCCCAAATTCCCAATTA +CGTCCTATCTTCTTCTTAGGGAAGAACAGCTTAGGTATCAATTTGGTGTTCTGTGTAAAG +TCTCAGGGAGCCGTCCGTGTCCTCCCATCTGGCCTCGTCCACACTGGTTCTCTTGAAAGC +TTGGGCTGTAATGATGCCCCTTGGCCATCACCCAGTCCCTGCCCCATCTCTTGTAATCTC +TCTCCTTTTTGCTGCATCCCTGTCTTCCTCTGTCTTGATTTACTTGTTGTTGGTTTTCTG +TTTCTTTGTTTGATTTGGTGGAAGACATAATCCCACGCTTCCTATGGAAAGGTTGTTGGG +AGATTTTTAATGATTCCTCAATGTTAAAATGTCTATTTTTGTCTTGACACCCAACTAATA +TTTGTCTGAGCAAAACAGTCTAGATGAGAGAGAACTTCCCTGGAGGTCTGATGGCGTTTC +TCCCTCGTCTTCTTA +>seq2 +TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAG +CTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCT +TATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTT +CAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAA +AAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTT +AGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATAC +ATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAG +GAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTATAAAGGAAATCCCAT +CAGAATAACAATGGGCTTCTCAGCAGAAACCTTACAAGCCAGAAGAGATTGGATCTAATT +TTTGGACTTCTTAAAGAAAAAAAAACCTGTCAAACACGAATGTTATGCCCTGCTAAACTA +AGCATCATAAATGAAGGGGAAATAAAGTCAAGTCTTTCCTGACAAGCAAATGCTAAGATA +ATTCATCATCACTAAACCAGTCCTATAAGAAATGCTCAAAAGAATTGTAAAAGTCAAAAT +TAAAGTTCAATACTCACCATCATAAATACACACAAAAGTACAAAACTCACAGGTTTTATA +AAACAATTGAGACTACAGAGCAACTAGGTAAAAAATTAACATTACAACAGGAACAAAACC +TCATATATCAATATTAACTTTGAATAAAAAGGGATTAAATTCCCCCACTTAAGAGATATA +GATTGGCAGAACAGATTTAAAAACATGAACTAACTATATGCTGTTTACAAGAAACTCATT +AATAAAGACATGAGTTCAGGTAAAGGGGTGGAAAAAGATGTTCTACGCAAACAGAAACCA +AATGAGAGAAGGAGTAGCTATACTTATATCAGATAAAGCACACTTTAAATCAACAACAGT +AAAATAAAACAAAGGAGGTCATCATACAATGATAAAAAGATCAATTCAGCAAGAAGATAT +AACCATCCTACTAAATACATATGCACCTAACACAAGACTACCCAGATTCATAAAACAAAT +ACTACTAGACCTAAGAGGGATGAGAAATTACCTAATTGGTACAATGTACAATATTCTGAT +GATGGTTACACTAAAAGCCCATACTTTACTGCTACTCAATATATCCATGTAACAAATCTG +CGCTTGTACTTCTAAATCTATAAAAAAATTAAAATTTAACAAAAGTAAATAAAACACATA +GCTAAAACTAAAAAAGCAAAAACAAAAACTATGCTAAGTATTGGTAAAGATGTGGGGAAA +AAAGTAAACTCTCAAATATTGCTAGTGGGAGTATAAATTGTTTTCCACTTTGGAAAACAA +TTTGGTAATTTCGTTTTTTTTTTTTTCTTTTCTCTTTTTTTTTTTTTTTTTTTTGCATGC +CAGAAAAAAATATTTACAGTAACT
