changeset 0:6e985e2e0802 draft

planemo upload for repository https://github.com/SANBI-SA/tools-sanbi-uwc/tree/master/tools/gatk2 commit f53888603dbab77d16c36cceffe0f2060052d204
author sanbi-uwc
date Wed, 25 Jan 2017 08:00:49 -0500
parents
children 25b1bbfe9d13
files base_recalibrator.xml depth_of_coverage.xml gatk2_annotations.txt.sample gatk2_macros.xml gatk2_picard_index.loc.sample gatk2_wrapper.py haplotype_caller.xml indel_realigner.xml print_reads.xml readme.rst realigner_target_creator.xml reduce_reads.xml test-data/gatk/fake_phiX_reads_1.bam test-data/gatk/fake_phiX_variant_locations.bed test-data/gatk/fake_phiX_variant_locations.vcf test-data/gatk/gatk_analyze_covariates/gatk_analyze_covariates_out_1.html test-data/gatk/gatk_analyze_covariates/gatk_analyze_covariates_out_1.log.contains test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular test-data/gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam test-data/gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.log.contains test-data/gatk/gatk_print_reads/gatk_print_reads_out_1.log.contains test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.log.contains test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.log.contains test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.metrics test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.vcf test-data/gatk/gatk_validate_variants/gatk_validate_variants_out_1.log.contains test-data/gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.log.contains test-data/gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf test-data/gatk/gatk_variant_combine/gatk_variant_combine_out_1.log.contains test-data/gatk/gatk_variant_combine/gatk_variant_combine_out_1.vcf test-data/gatk/gatk_variant_eval/gatk_variant_eval_out_1.gatk_report test-data/gatk/gatk_variant_eval/gatk_variant_eval_out_1.log.contains test-data/gatk/gatk_variant_filtration/gatk_variant_filtration_out_1.log.contains test-data/gatk/gatk_variant_select/gatk_variant_select_out_1.log.contains test-data/gatk/gatk_variant_select/gatk_variant_select_out_1.vcf test-data/phiX.fasta tool_data_table_conf.xml.sample tool_dependencies.xml unified_genotyper.xml variant_annotator.xml variant_apply_recalibration.xml variant_combine.xml variant_eval.xml variant_filtration.xml variant_recalibrator.xml variant_select.xml variant_validate.xml
diffstat 57 files changed, 11113 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/base_recalibrator.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,307 @@
+<tool id="gatk2_base_recalibrator" name="Base Recalibrator" version="@VERSION@.0">
+  <description>calculates covariates used to recalibrate base quality scores of reads</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input"
+    #if str( $reference_source.input_bam.metadata.bam_index ) != "None":
+        -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index
+    #end if
+    -p '
+    @JAR_PATH@
+    -T "BaseRecalibrator"
+    \$GATK2_SITE_OPTIONS
+
+    ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975
+    --num_cpu_threads_per_data_thread \${GALAXY_SLOTS:-8}
+
+    ## we set non standards at every run and the user can choose which ones are preferred
+    ## in our select box both standard options (ContextCovariate, CycleCovariate) are selected by default
+    --no_standard_covs
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    #if str($input_recal) != 'None':
+        --BQSR "${input_recal}"
+    #end if
+    --out "${output_recal}"
+    #if str( $covariates ) != "None":
+        #for $cov in str( $covariates ).split( ',' ):
+            -cov "${cov}"
+        #end for
+    #end if
+   '
+
+    #set $snp_dataset_provided = False
+    #set $rod_binding_names = dict()
+    #for $rod_binding in $rod_bind:
+        #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom':
+            #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name
+        #else
+            #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector
+        #end if
+        #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'dbsnp':
+            #set $snp_dataset_provided = True
+        #end if
+        #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1
+        -d "--knownSites:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}"
+    #end for
+
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        #if $analysis_param_type.default_read_group_type.default_read_group_type_selector == "set":
+            --default_read_group "${analysis_param_type.default_read_group_type.default_read_group}"
+        #end if
+        #if str( $analysis_param_type.default_platform ) != "default":
+            --default_platform "${analysis_param_type.default_platform}"
+        #end if
+        #if str( $analysis_param_type.force_read_group_type.force_read_group_type_selector ) == "set":
+            --force_read_group "${analysis_param_type.force_read_group_type.force_read_group}"
+        #end if
+        #if str( $analysis_param_type.force_platform ) != "default":
+            --force_platform "${analysis_param_type.force_platform}"
+        #end if
+        ${analysis_param_type.exception_if_no_tile}
+        #if str( $analysis_param_type.solid_options_type.solid_options_type_selector ) == "set":
+            #if str( $analysis_param_type.solid_options_type.solid_recal_mode ) != "default":
+                --solid_recal_mode "${analysis_param_type.solid_options_type.solid_recal_mode}"
+            #end if
+            #if str( $analysis_param_type.solid_options_type.solid_nocall_strategy ) != "default":
+                --solid_nocall_strategy "${analysis_param_type.solid_options_type.solid_nocall_strategy}"
+            #end if
+        #end if
+        --window_size_nqs "${analysis_param_type.window_size_nqs}"
+        --homopolymer_nback "${analysis_param_type.homopolymer_nback}"
+        '
+    #end if
+    #if not $snp_dataset_provided:
+        -p '--run_without_dbsnp_potentially_ruining_quality'
+    #end if
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;">
+          <validator type="unspecified_build" />
+          <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->
+        </param>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" >
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options>
+            <filter type="data_meta" key="dbkey" ref="input_bam" />
+          </options>
+        </param>
+      </when>
+    </conditional>
+    <param name="input_recal" type="data" format="gatk_report" optional="true" label="Covariates table recalibration file" help="The input covariates table file which enables on-the-fly base quality score recalibration. Enables on-the-fly recalibrate of base qualities. The covariates tables are produced by the BaseQualityScoreRecalibrator tool. Please be aware that one should only run recalibration with the covariates file created on the same input bam(s) (-BQSR,--BQSR &amp;lt;recal_file&amp;gt;)" />
+
+    <param name="covariates" type="select" multiple="True" display="checkboxes" label="Covariates to be used in the recalibration" help="-cov,--covariate &amp;lt;covariate&amp;gt;" >
+      <!-- might we want to load the available covariates from an external configuration file, since additional ones can be added to local installs? -->
+      <option value="ContextCovariate" selected="true"/>
+      <option value="CycleCovariate" selected="true"/>
+      <option value="RepeatLengthCovariate" />
+      <option value="RepeatUnitCovariate" />
+      <option value="RepeatUnitAndLengthCovariate" />
+      <!--
+      Note: ReadGroupCovariate and QualityScoreCovariate are required covariates and will
+      be added for the user regardless of whether or not they were specified.
+      <option value="QualityScoreCovariate" />
+      <option value="ReadGroupCovariate" />
+      -->
+    </param>
+
+    <repeat name="rod_bind" title="Known Variants" help="Using data sets of known variants (-knownSites,--knownSites &amp;lt;knownSites&amp;gt;)">
+        <conditional name="rod_bind_type">
+          <param name="rod_bind_type_selector" type="select" label="Variant Type">
+            <option value="dbsnp" selected="True">dbSNP</option>
+            <option value="snps">SNPs</option>
+            <option value="indels">INDELs</option>
+            <option value="mask">Mask</option>
+            <option value="custom">Custom</option>
+          </param>
+          <when value="dbsnp">
+              <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" />
+          </when>
+          <when value="snps">
+              <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" />
+          </when>
+          <when value="indels">
+              <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" />
+          </when>
+          <when value="mask">
+              <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" />
+          </when>
+          <when value="custom">
+              <param name="custom_rod_name" type="text" value="Unknown" label="Customer's variant file"/>
+              <param name="input_rod" type="data" format="vcf,gatk_dbsnp,bed" label="Variant file" />
+          </when>
+        </conditional>
+    </repeat>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <conditional name="analysis_param_type">
+      <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options">
+        <option value="basic" selected="True">Basic</option>
+        <option value="advanced">Advanced</option>
+      </param>
+      <when value="basic">
+        <!-- Do nothing here -->
+      </when>
+      <when value="advanced">
+        <conditional name="default_read_group_type">
+          <param name="default_read_group_type_selector" type="select" label="Set default Read Group" help="--default_read_group">
+            <option value="default" selected="True">Don't Set</option>
+            <option value="set">Set</option>
+          </param>
+          <when value="default">
+            <!-- do nothing here -->
+          </when>
+          <when value="set">
+            <param name="default_read_group" type="text" value="Unknown" label="If a read has no read group then default to the provided String"/>
+          </when>
+        </conditional>
+        <param name="default_platform" type="select" label="Set default Platform" help="--default_platform">
+          <option value="default" selected="True">Don't Set</option>
+          <option value="illumina">illumina</option>
+          <option value="454">454</option>
+          <option value="solid">solid</option>
+        </param>
+        <conditional name="force_read_group_type">
+          <param name="force_read_group_type_selector" type="select" label="Force Read Group" help="--force_read_group">
+            <option value="default" selected="True">Don't Force</option>
+            <option value="set">Force</option>
+          </param>
+          <when value="default">
+            <!-- do nothing here -->
+          </when>
+          <when value="set">
+            <param name="force_read_group" type="text" value="Unknown" label="If provided, the read group ID of EVERY read will be forced to be the provided String."/>
+          </when>
+        </conditional>
+        <param name="force_platform" type="select" label="Force Platform" help="--force_platform">
+          <option value="default" selected="True">Don't Force</option>
+          <option value="illumina">illumina</option>
+          <option value="454">454</option>
+          <option value="solid">solid</option>
+        </param>
+        <param name="exception_if_no_tile" type="boolean" checked="False" truevalue="--exception_if_no_tile" falsevalue="" label="Throw an exception when no tile can be found" help="--exception_if_no_tile"/>
+        <conditional name="solid_options_type">
+          <param name="solid_options_type_selector" type="select" label="Set SOLiD specific options">
+            <option value="default" selected="True">Don't Set</option>
+            <option value="set">Set</option>
+          </param>
+          <when value="default">
+            <!-- do nothing here -->
+          </when>
+          <when value="set">
+            <param name="solid_recal_mode" type="select" label="How should we recalibrate solid bases in which the reference was inserted" help="-sMode,--solid_recal_mode &amp;lt;solid_recal_mode&amp;gt;">
+              <option value="default" selected="True">Don't set</option>
+              <option value="DO_NOTHING">DO_NOTHING</option>
+              <option value="SET_Q_ZERO">SET_Q_ZERO</option>
+              <option value="SET_Q_ZERO_BASE_N">SET_Q_ZERO_BASE_N</option>
+              <option value="REMOVE_REF_BIAS">REMOVE_REF_BIAS</option>
+            </param>
+            <param name="solid_nocall_strategy" type="select" label="Behavior of the recalibrator when it encounters no calls" help="-solid_nocall_strategy,--solid_nocall_strategy &amp;lt;solid_nocall_strategy&amp;gt;">
+              <option value="default" selected="True">Don't set</option>
+              <option value="THROW_EXCEPTION">THROW_EXCEPTION</option>
+              <option value="LEAVE_READ_UNRECALIBRATED">LEAVE_READ_UNRECALIBRATED</option>
+              <option value="PURGE_READ">PURGE_READ</option>
+            </param>
+          </when>
+        </conditional>
+        <param name="window_size_nqs" type="integer" value="5" label="Window size used by MinimumNQSCovariate" help="window_size_nqs"/>
+        <param name="homopolymer_nback" type="integer" value="7" label="number of previous bases to look at in HomopolymerCovariate" help="-nback,--homopolymer_nback &amp;lt;homopolymer_nback&amp;gt;" />
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <data format="gatk_report" name="output_recal" label="${tool.name} on ${on_string} (Covariate File)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" />
+          <param name="rod_bind_type_selector" value="dbsnp" />
+          <param name="input_rod" value="gatk/fake_phiX_variant_locations.bed" ftype="bed" />
+          <param name="standard_covs" value="True" />
+          <param name="covariates" value="ReadGroupCovariate,HomopolymerCovariate,MinimumNQSCovariate,PositionCovariate" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_recal" file="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" />
+          <output name="output_log" file="gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+.. class:: warningmark
+
+"This calculation is critically dependent on being able to skip over known variant sites. Please provide a dbSNP ROD or a VCF file containing known sites of genetic variation."
+However, if you do not provide this file, the '--run_without_dbsnp_potentially_ruining_quality' flag will be automatically used, and the command will be allowed to run.
+
+**What it does**
+
+This walker is designed to work as the first pass in a two-pass processing step. It does a by-locus traversal operating only at sites that are not in dbSNP. We assume that all reference mismatches we see are therefore errors and indicative of poor base quality. This walker generates tables based on various user-specified covariates (such as read group, reported quality score, cycle, and dinucleotide) Since there is a large amount of data one can then calculate an empirical probability of error given the particular covariates seen at this site, where p(error) = num mismatches / num observations The output file is a CSV list of (the several covariate values, num observations, num mismatches, empirical quality score) The first non-comment line of the output file gives the name of the covariates that were used for this calculation.  Note: ReadGroupCovariate and QualityScoreCovariate are required covariates and will be added for the user regardless of whether or not they were specified Note: This walker is designed to be used in conjunction with TableRecalibrationWalker.
+
+For more information on base quality score recalibration using the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_bqsr_BaseRecalibrator.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: BaseRecalibrator accepts an aligned BAM input file.
+
+
+**Outputs**
+
+The output is in CSV format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+
+ default_read_group                               If a read has no read group then default to the provided String.
+ default_platform                                 If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid.
+ force_read_group                                 If provided, the read group ID of EVERY read will be forced to be the provided String. This is useful to collapse all data into a single read group.
+ force_platform                                   If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid.
+ window_size_nqs                                  The window size used by MinimumNQSCovariate for its calculation
+ homopolymer_nback                                The number of previous bases to look at in HomopolymerCovariate
+ exception_if_no_tile                             If provided, TileCovariate will throw an exception when no tile can be found. The default behavior is to use tile = -1
+ solid_recal_mode                                 How should we recalibrate solid bases in whichthe reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS (DO_NOTHING|SET_Q_ZERO|SET_Q_ZERO_BASE_N|REMOVE_REF_BIAS)
+ solid_nocall_strategy                            Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ (THROW_EXCEPTION|LEAVE_READ_UNRECALIBRATED|PURGE_READ)
+ recal_file                                       Filename for the input covariates table recalibration .csv file
+ out                                              The output CSV file
+ standard_covs                                    Use the standard set of covariates in addition to the ones listed using the -cov argument
+ run_without_dbsnp_potentially_ruining_quality    If specified, allows the recalibrator to be used without a dbsnp rod. Very unsafe and for expert users only.
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/depth_of_coverage.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,732 @@
+<tool id="gatk2_depth_of_coverage" name="Depth of Coverage" version="@VERSION@.0">
+  <description>on BAM files</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">gatk2_wrapper.py
+   ##--max_jvm_heap_fraction "1"
+   --stdout "${output_log}"
+   @BAM_INPUTS@
+   -p '
+   @JAR_PATH@
+    -T "DepthOfCoverage"
+    \$GATK2_SITE_OPTIONS
+
+    @THREADS@
+
+    @INTERVAL_STATS@
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    #if str( $input_calculate_coverage_over_genes ) != "None":
+        --calculateCoverageOverGenes "${input_calculate_coverage_over_genes}"
+    #end if
+    #if str( $partition_type ) != "None":
+        #for $pt in str( $partition_type ).split( ',' ):
+            --partitionType "${pt}"
+        #end for
+    #end if
+    --out "${output_per_locus_coverage}"
+
+    #for $ct_group in $summary_coverage_threshold_group:
+        --summaryCoverageThreshold "${ct_group.summary_coverage_threshold}"
+    #end for
+    --outputFormat "${output_format}"
+   '
+
+    #include source=$standard_gatk_options#
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        ${analysis_param_type.ignore_deletion_sites}
+        ${analysis_param_type.include_deletions}
+        --maxBaseQuality "${analysis_param_type.max_base_quality}"
+        --maxMappingQuality "${analysis_param_type.max_mapping_quality}"
+        --minBaseQuality "${analysis_param_type.min_base_quality}"
+        --minMappingQuality "${analysis_param_type.min_mapping_quality}"
+        --nBins "${analysis_param_type.n_bins}"
+        ${analysis_param_type.omit_depth_output_at_each_base}
+        ${analysis_param_type.omit_interval_statistics}
+        ${analysis_param_type.omit_locus_table}
+        ${analysis_param_type.omit_per_sample_stats}
+        ${analysis_param_type.print_base_counts}
+        ${analysis_param_type.print_bin_endpoints_and_exit}
+        --start "${analysis_param_type.start}"
+        --stop "${analysis_param_type.stop}"
+        '
+    #end if
+    ##Move additional files to final location
+    #if str( $partition_type ) != "None":
+       #set $partition_types = str( $partition_type ).split( ',' )
+    #else:
+        #set $partition_types = [ 'sample' ]
+    #end if
+    #if 'sample' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ):
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_summary ${output_summary_sample}
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_statistics ${output_statistics_sample}
+        #end if
+        #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ):
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_interval_summary ${output_interval_summary_sample}
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_interval_statistics ${output_interval_statistics_sample}
+        #end if
+        #if str( $input_calculate_coverage_over_genes ) != "None":
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_gene_summary ${output_gene_summary_sample}
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_gene_statistics ${output_gene_statistics_sample}
+        #end if
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_cumulative_coverage_counts ${output_cumulative_coverage_counts_sample}
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_sample}
+        #end if
+    #end if
+
+    #if 'readgroup' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ):
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_summary ${output_summary_readgroup}
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_statistics ${output_statistics_readgroup}
+        #end if
+        #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ):
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_interval_summary ${output_interval_summary_readgroup}
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_interval_statistics ${output_interval_statistics_readgroup}
+        #end if
+        #if str( $input_calculate_coverage_over_genes ) != "None":
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_gene_summary ${output_gene_summary_readgroup}
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_gene_statistics ${output_gene_statistics_readgroup}
+        #end if
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_cumulative_coverage_counts ${output_cumulative_coverage_counts_readgroup}
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_readgroup}
+        #end if
+    #end if
+
+    #if 'library' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ):
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.library_summary ${output_summary_library}
+            &amp;&amp; mv ${output_per_locus_coverage}.library_statistics ${output_statistics_library}
+        #end if
+        #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ):
+            &amp;&amp; mv ${output_per_locus_coverage}.library_interval_summary ${output_interval_summary_library}
+            &amp;&amp; mv ${output_per_locus_coverage}.library_interval_statistics ${output_interval_statistics_library}
+        #end if
+        #if str( $input_calculate_coverage_over_genes ) != "None":
+            &amp;&amp; mv ${output_per_locus_coverage}.library_gene_summary ${output_gene_summary_library}
+            &amp;&amp; mv ${output_per_locus_coverage}.library_gene_statistics ${output_gene_statistics_library}
+        #end if
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.library_cumulative_coverage_counts ${output_cumulative_coverage_counts_library}
+            &amp;&amp; mv ${output_per_locus_coverage}.library_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_library}
+        #end if
+    #end if
+
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <expand macro="input_bams_cached" />
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> does not yet work in a repeat...-->
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <param name="input_bams" type="data" format="bam" label="BAM file" multiple="True" min="1" help="-I,--input_file &amp;lt;input_file&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+
+    <param name="input_calculate_coverage_over_genes" type="data" format="data" label="RefSeq Rod" optional="True" help="-geneList,--calculateCoverageOverGenes &amp;lt;calculateCoverageOverGenes&amp;gt;" />
+
+    <param name="partition_type" type="select" label="Partition type for depth of coverage" multiple="True" display="checkboxes" help="-pt,--partitionType &amp;lt;partitionType&amp;gt;">
+      <option value="sample" selected="True">sample</option>
+      <option value="readgroup">readgroup</option>
+      <option value="library">library</option>
+    </param>
+
+    <repeat name="summary_coverage_threshold_group" title="Summary coverage threshold" help="-ct,--summaryCoverageThreshold &amp;lt;summaryCoverageThreshold&amp;gt;">
+        <param name="summary_coverage_threshold" type="integer" value="15" label="for summary file outputs, report the % of bases covered to &gt;= this number" />
+    </repeat>
+
+    <param name="output_format" type="select" label="Output format" help="--outputFormat &amp;lt;outputFormat&amp;gt;" >
+      <option value="csv">csv</option>
+      <option value="table">table</option>
+      <option value="rtable" selected="True">rtable</option>
+    </param>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <expand macro="analysis_type_conditional">
+        <param name="ignore_deletion_sites" type="boolean" truevalue="--ignoreDeletionSites" falsevalue="" checked="False" label="Ignore sites consisting only of deletions" help="--ignoreDeletionSites" />
+        <param name="include_deletions" type="boolean" truevalue="--includeDeletions" falsevalue="" checked="False" label="Include information on deletions" help="-dels,--includeDeletions" />
+        <param name="max_base_quality" type="integer" value="127" label="Maximum quality of bases to count towards depth" help="--maxBaseQuality &amp;lt;maxBaseQuality&amp;gt;" />
+        <param name="min_base_quality" type="integer" value="-1" label="Minimum quality of bases to count towards depth" help="-mbq,--minBaseQuality &amp;lt;minBaseQuality&amp;gt;" />
+        <param name="max_mapping_quality" type="integer" value="2147483647" label="Maximum mapping quality of reads to count towards depth." help="--maxMappingQuality &amp;lt;maxMappingQuality&amp;gt;" />
+        <param name="min_mapping_quality" type="integer" value="127" label="Minimum mapping quality of reads to count towards depth" help="-mmq,--minMappingQuality &amp;lt;minMappingQuality&amp;gt;" />
+        <param name="n_bins" type="integer" value="499" label="Number of bins to use for granular binning" help="--nBins &amp;lt;nBins&amp;gt;" />
+        <param name="omit_depth_output_at_each_base" type="boolean" truevalue="--omitDepthOutputAtEachBase" falsevalue="" checked="False" label="Omit the output of the depth of coverage at each base" help="-omitBaseOutput,--omitDepthOutputAtEachBase" />
+        <param name="omit_interval_statistics" type="boolean" truevalue="--omitIntervalStatistics" falsevalue="" checked="False" label="Omit the per-interval statistics section" help="-omitIntervals,--omitIntervalStatistics" />
+        <param name="omit_locus_table" type="boolean" truevalue="--omitLocusTable" falsevalue="" checked="False" label="Do not calculate the per-sample per-depth counts of loci" help="-omitLocusTable,--omitLocusTable" />
+        <param name="omit_per_sample_stats" type="boolean" truevalue="--omitPerSampleStats" falsevalue="" checked="False" label="Omit the summary files per-sample." help="-omitSampleSummary,--omitPerSampleStats" />
+        <param name="print_base_counts" type="boolean" truevalue="--printBaseCounts" falsevalue="" checked="False" label="Add base counts to per-locus output" help="-baseCounts,--printBaseCounts" />
+        <param name="print_bin_endpoints_and_exit" type="boolean" truevalue="--printBinEndpointsAndExit" falsevalue="" checked="False" label="Print the bin values and exits immediately" help="--printBinEndpointsAndExit" />
+        <param name="start" type="integer" value="1" label="Starting (left endpoint) for granular binning" help="--start &amp;lt;start&amp;gt;" />
+        <param name="stop" type="integer" value="500" label="Ending (right endpoint) for granular binning" help="--stop &amp;lt;stop&amp;gt;" />
+    </expand>
+  </inputs>
+  <outputs>
+    <data format="tabular" name="output_per_locus_coverage" label="${tool.name} on ${on_string} (per locus coverage)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_summary_sample" label="${tool.name} on ${on_string} (output summary sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_statistics_sample" label="${tool.name} on ${on_string} (output statistics sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_summary_sample" label="${tool.name} on ${on_string} (output interval summary sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_statistics_sample" label="${tool.name} on ${on_string} (output interval statistics sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_summary_sample" label="${tool.name} on ${on_string} (output gene summary sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_statistics_sample" label="${tool.name} on ${on_string} (output gene statistics sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_counts_sample" label="${tool.name} on ${on_string} (output cumulative coverage counts sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_proportions_sample" label="${tool.name} on ${on_string} (output cumulative coverage proportions sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+
+    <data format="tabular" name="output_summary_readgroup" label="${tool.name} on ${on_string} (output summary readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_statistics_readgroup" label="${tool.name} on ${on_string} (output statistics readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_summary_readgroup" label="${tool.name} on ${on_string} (output interval summary readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_statistics_readgroup" label="${tool.name} on ${on_string} (output interval statistics readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_summary_readgroup" label="${tool.name} on ${on_string} (output gene summary readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'readgroup' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_statistics_readgroup" label="${tool.name} on ${on_string} (output gene statistics readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'readgroup' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_counts_readgroup" label="${tool.name} on ${on_string} (output cumulative coverage counts readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_proportions_readgroup" label="${tool.name} on ${on_string} (output cumulative coverage proportions readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+
+    <data format="tabular" name="output_summary_library" label="${tool.name} on ${on_string} (output summary library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_statistics_library" label="${tool.name} on ${on_string} (output statistics library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_summary_library" label="${tool.name} on ${on_string} (output interval summary library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_statistics_library" label="${tool.name} on ${on_string} (output interval statistics library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_summary_library" label="${tool.name} on ${on_string} (output gene summary library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'library' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_statistics_library" label="${tool.name} on ${on_string} (output gene statistics library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'library' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_counts_library" label="${tool.name} on ${on_string} (output cumulative coverage counts library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_proportions_library" label="${tool.name} on ${on_string} (output cumulative coverage proportions library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+
+    <data format="tabular" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <trackster_conf/>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" />
+          <param name="input_calculate_coverage_over_genes" />
+          <param name="partition_type" value="sample" />
+          <param name="summary_coverage_threshold_group" value="0" />
+          <param name="output_format" value="rtable" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_per_locus_coverage" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular" />
+          <output name="output_summary_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular" />
+          <output name="output_statistics_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular" />
+          <output name="output_cumulative_coverage_counts_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular" />
+          <output name="output_cumulative_coverage_proportions_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular" />
+          <output name="output_log" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+DepthOfCoverage processes a set of bam files to determine coverage at different levels of partitioning and aggregation. Coverage can be analyzed per locus, per interval, per gene, or in total; can be partitioned by sample, by read group, by technology, by center, or by library; and can be summarized by mean, median, quartiles, and/or percentage of bases covered to or beyond a threshold. Additionally, reads and bases can be filtered by mapping or base quality score.
+
+For more information on the GATK Depth of Coverage, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_coverage_DepthOfCoverage.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: DepthOfCoverage accepts aligned BAM input files.
+
+
+**Outputs**
+
+The output is in various table formats.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ calculateCoverageOverGenes     File     NA     Calculate the coverage statistics over this list of genes. Currently accepts RefSeq.
+ ignoreDeletionSites     boolean     false     Ignore sites consisting only of deletions
+ includeDeletions     boolean     false     Include information on deletions
+ maxBaseQuality     byte     127     Maximum quality of bases to count towards depth. Defaults to 127 (Byte.MAX_VALUE).
+ maxMappingQuality     int     2147483647     Maximum mapping quality of reads to count towards depth. Defaults to 2^31-1 (Integer.MAX_VALUE).
+ minBaseQuality     byte     -1     Minimum quality of bases to count towards depth. Defaults to -1.
+ minMappingQuality     int     -1     Minimum mapping quality of reads to count towards depth. Defaults to -1.
+ nBins     int     499     Number of bins to use for granular binning
+ omitDepthOutputAtEachBase     boolean     false     Will omit the output of the depth of coverage at each base, which should result in speedup
+ omitIntervalStatistics     boolean     false     Will omit the per-interval statistics section, which should result in speedup
+ omitLocusTable     boolean     false     Will not calculate the per-sample per-depth counts of loci, which should result in speedup
+ omitPerSampleStats     boolean     false     Omits the summary files per-sample. These statistics are still calculated, so this argument will not improve runtime.
+ outputFormat     String     rtable     the format of the output file (e.g. csv, table, rtable); defaults to r-readable table
+ partitionType     Set[Partition]     [sample]     Partition type for depth of coverage. Defaults to sample. Can be any combination of sample, readgroup, library.
+ printBaseCounts     boolean     false     Will add base counts to per-locus output.
+ printBinEndpointsAndExit     boolean     false     Prints the bin values and exits immediately. Use to calibrate what bins you want before running on data.
+ start     int     1     Starting (left endpoint) for granular binning
+ stop     int     500     Ending (right endpoint) for granular binning
+ summaryCoverageThreshold     int[]     [15]     for summary file outputs, report the % of bases coverd to >= this number. Defaults to 15; can take multiple arguments.
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk2_annotations.txt.sample	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,26 @@
+#unique_id	name	gatk_value	tools_valid_for
+AlleleBalance	AlleleBalance	AlleleBalance	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+AlleleBalanceBySample	AlleleBalanceBySample	AlleleBalanceBySample	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+BaseCounts	BaseCounts	BaseCounts	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+BaseQualityRankSumTest	BaseQualityRankSumTest	BaseQualityRankSumTest	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+ChromosomeCounts	ChromosomeCounts	ChromosomeCounts	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+Coverage	Coverage	Coverage	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+DepthPerAlleleBySample	DepthPerAlleleBySample	DepthPerAlleleBySample	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+FisherStrand	FisherStrand	FisherStrand	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+GCContent	GCContent	GCContent	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+HaplotypeScore	HaplotypeScore	HaplotypeScore	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+HardyWeinberg	HardyWeinberg	HardyWeinberg	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+HomopolymerRun	HomopolymerRun	HomopolymerRun	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+InbreedingCoeff	InbreedingCoeff	InbreedingCoeff	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+LowMQ	LowMQ	LowMQ	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+MVLikelihoodRatio	MVLikelihoodRatio	MVLikelihoodRatio	VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+MappingQualityRankSumTest	MappingQualityRankSumTest	MappingQualityRankSumTest	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+MappingQualityZero	MappingQualityZero	MappingQualityZero	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+MappingQualityZeroBySample	MappingQualityZeroBySample	MappingQualityZeroBySample	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+NBaseCount	NBaseCount	NBaseCount	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+QualByDepth	QualByDepth	QualByDepth	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+RMSMappingQuality	RMSMappingQuality	RMSMappingQuality	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+ReadPosRankSumTest	ReadPosRankSumTest	ReadPosRankSumTest	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+SampleList	SampleList	SampleList	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+SnpEff	SnpEff	SnpEff	VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+SpanningDeletions	SpanningDeletions	SpanningDeletions	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk2_macros.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,389 @@
+<macros>
+  <xml name="requirements">
+    <requirements>
+      <requirement type="package">gatk2</requirement>
+      <requirement type="package" version="0.1.19">samtools</requirement>
+      <requirement type="package" version="1.56.0">picard</requirement>
+      <requirement type="set_environment">GATK2_PATH</requirement>
+      <requirement type="set_environment">GATK2_SITE_OPTIONS</requirement>
+      <requirement type="set_environment">GATK2_JAVA_OPTIONS</requirement>
+      <yield />
+    </requirements>
+  </xml>
+  <xml name="version_command">
+    <version_command>java -jar "$GATK2_PATH/GenomeAnalysisTK.jar" --help|grep '^The Genome'</version_command>
+  </xml>
+  <token name="@THREADS@">
+    --num_threads \${GALAXY_SLOTS:-4}
+  </token>
+  <token name="@INTERVAL_STATS@">
+      --omitIntervalStatistics
+  </token>
+  <token name="@VERSION@">2.8</token>
+  <token name="@JAR_PATH@">
+    java \$GATK2_JAVA_OPTIONS -jar "\$GATK2_PATH/GenomeAnalysisTK.jar"
+  </token>
+  <token name="@DBSNP_OPTIONS@">
+    #if $dbsnp_rod_bind_type.dbsnp_rod_bind_type_selector == 'set_dbsnp'
+        -d "--dbsnp:${dbsnp_rod_bind_type.dbsnp_rod_name},%(file_type)s" "${dbsnp_rod_bind_type.dbsnp_input_rod}" "${dbsnp_rod_bind_type.dbsnp_input_rod.ext}" "input_dbsnp_${dbsnp_rod_bind_type.dbsnp_rod_name}"
+    #end if
+  </token>
+  <token name="@BAM_INPUTS@">
+   #for $i, $input_bam in enumerate( $reference_source.input_bams ):
+       -d "-I" "${input_bam}" "${input_bam.ext}" "gatk_input_${i}"
+       #if str( $input_bam.metadata.bam_index ) != "None":
+           -d "" "${input_bam.metadata.bam_index}" "bam_index" "gatk_input_${i}" ##hardcode galaxy ext type as bam_index
+       #end if
+   #end for
+  </token>
+  <xml name="input_variants" token_help="-input,--input &amp;lt;input&amp;gt;">
+    <param name="input_variants" type="data" format="vcf" label="Variant file to annotate" multiple="True" min="1" help="@HELP@"/>
+  </xml>
+  <xml name="input_bams_history">
+    <param name="input_bams" type="data" format="bam" label="BAM file" multiple="True" min="1" help="-I,--input_file &amp;lt;input_file&amp;gt;"/>
+  </xml>
+  <xml name="input_bams_cached">
+    <param name="input_bams" type="data" format="bam" label="BAM file" multiple="True" min="1" help="-I,--input_file &amp;lt;input_file&amp;gt;">
+      <validator type="unspecified_build" />
+      <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->
+    </param>
+  </xml>
+  <template name="standard_gatk_options">
+    ##start standard gatk options
+    #if $gatk_param_type.gatk_param_type_selector == "advanced":
+        #for $pedigree in $gatk_param_type.pedigree:
+            -p '--pedigree "${pedigree.pedigree_file}"'
+        #end for
+        #for $pedigree_string in $gatk_param_type.pedigree_string_repeat:
+            -p '--pedigreeString "${pedigree_string.pedigree_string}"'
+        #end for
+        -p '--pedigreeValidationType "${gatk_param_type.pedigree_validation_type}"'
+        #set default_read_filters = ['MalformedRead']
+        #for $read_filter in $gatk_param_type.read_filter:
+            -p '
+            #if $read_filter.read_filter_type.read_filter_type_selector not in $default_read_filters:
+                --read_filter "${read_filter.read_filter_type.read_filter_type_selector}"
+            #end if
+            #for $name, $param in $read_filter.read_filter_type.iteritems():
+                #if $name not in [ "__current_case__", "read_filter_type_selector" ]:
+                    #if hasattr( $param.input, 'truevalue' ):
+                        ${param}
+                    #else:
+                        --${name} "${param}"
+                    #end if
+                #end if
+            #end for
+            '
+        #end for
+        #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_interval_repeat ):
+            -d "--intervals" "${input_intervals.input_intervals}" "${input_intervals.input_intervals.ext}" "input_intervals_${interval_count}"
+        #end for
+
+        #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_exclude_interval_repeat ):
+            -d "--excludeIntervals" "${input_intervals.input_exclude_intervals}" "${input_intervals.input_exclude_intervals.ext}" "input_exlude_intervals_${interval_count}"
+        #end for
+
+        -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"'
+        -p '--interval_padding "${gatk_param_type.interval_padding}"'
+        -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"'
+        #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE":
+            -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"'
+        #end if
+        -p '
+        --baq "${gatk_param_type.baq}"
+        --baqGapOpenPenalty "${gatk_param_type.baq_gap_open_penalty}"
+        ${gatk_param_type.use_original_qualities}
+        --defaultBaseQualities "${gatk_param_type.default_base_qualities}"
+        --validation_strictness "${gatk_param_type.validation_strictness}"
+        --interval_merging "${gatk_param_type.interval_merging}"
+        ${gatk_param_type.disable_experimental_low_memory_sharding}
+        ${gatk_param_type.fix_misencoded_quality_scores}
+        ${gatk_param_type.non_deterministic_random_seed}
+        '
+        #for $rg_black_list_count, $rg_black_list in enumerate( $gatk_param_type.read_group_black_list_repeat ):
+            #if $rg_black_list.read_group_black_list_type.read_group_black_list_type_selector == "file":
+                -d "--read_group_black_list" "${rg_black_list.read_group_black_list_type.read_group_black_list}" "txt" "input_read_group_black_list_${rg_black_list_count}"
+            #else
+                -p '--read_group_black_list "${rg_black_list.read_group_black_list_type.read_group_black_list}"'
+            #end if
+        #end for
+    #end if
+
+    #if str( $reference_source.reference_source_selector ) == "history":
+        -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input"
+    #end if
+    ##end standard gatk options
+  </template>
+  <xml name="gatk_param_type_conditional">
+    <conditional name="gatk_param_type">
+      <param name="gatk_param_type_selector" type="select" label="Basic or Advanced GATK options">
+        <option value="basic" selected="True">Basic</option>
+        <option value="advanced">Advanced</option>
+      </param>
+      <when value="basic">
+        <!-- Do nothing here -->
+      </when>
+      <when value="advanced">
+        <repeat name="pedigree" title="Pedigree file" help="-ped,--pedigree &amp;lt;pedigree&amp;gt;">
+            <param name="pedigree_file" type="data" format="txt" label="Pedigree files for samples"/>
+        </repeat>
+        <repeat name="pedigree_string_repeat" title="Pedigree string" help="-pedString,--pedigreeString &amp;lt;pedigreeString&amp;gt;">
+            <param name="pedigree_string" type="text" value="" label="Pedigree string for samples"/>
+        </repeat>
+        <param name="pedigree_validation_type" type="select" label="How strict should we be in validating the pedigree information" help="-pedValidationType,--pedigreeValidationType &amp;lt;pedigreeValidationType&amp;gt;">
+          <option value="STRICT" selected="True">STRICT</option>
+          <option value="SILENT">SILENT</option>
+        </param>
+        <repeat name="read_filter" title="Read Filter" help="-rf,--read_filter &amp;lt;read_filter&amp;gt;">
+            <conditional name="read_filter_type">
+              <param name="read_filter_type_selector" type="select" label="Read Filter Type">
+                <option value="BadCigar">BadCigar</option>
+                <option value="BadMate">BadMate</option>
+                <option value="DuplicateRead">DuplicateRead</option>
+                <option value="FailsVendorQualityCheck">FailsVendorQualityCheck</option>
+                <option value="MalformedRead">MalformedRead</option>
+                <option value="MappingQuality">MappingQuality</option>
+                <option value="MappingQualityUnavailable">MappingQualityUnavailable</option>
+                <option value="MappingQualityZero">MappingQualityZero</option>
+                <option value="MateSameStrand">MateSameStrand</option>
+                <option value="MaxInsertSize">MaxInsertSize</option>
+                <option value="MaxReadLength" selected="True">MaxReadLength</option>
+                <option value="MissingReadGroup">MissingReadGroup</option>
+                <option value="NoOriginalQualityScores">NoOriginalQualityScores</option>
+                <option value="NotPrimaryAlignment">NotPrimaryAlignment</option>
+                <option value="Platform454">Platform454</option>
+                <option value="Platform">Platform</option>
+                <option value="PlatformUnit">PlatformUnit</option>
+                <option value="ReadGroupBlackList">ReadGroupBlackList</option>
+                <option value="ReadName">ReadName</option>
+                <option value="ReadStrand">ReadStrand</option>
+                <option value="ReassignMappingQuality">ReassignMappingQuality</option>
+                <option value="Sample">Sample</option>
+                <option value="SingleReadGroup">SingleReadGroup</option>
+                <option value="UnmappedRead">UnmappedRead</option>
+              </param>
+              <when value="BadCigar">
+                  <!-- no extra options -->
+              </when>
+              <when value="BadMate">
+                  <!-- no extra options -->
+              </when>
+              <when value="DuplicateRead">
+                  <!-- no extra options -->
+              </when>
+              <when value="FailsVendorQualityCheck">
+                  <!-- no extra options -->
+              </when>
+              <when value="MalformedRead">
+                  <param name="filter_mismatching_base_and_quals" type="boolean" truevalue="--filter_mismatching_base_and_quals" falsevalue="" checked="false" label="filter out the reads with mismatching number of bases and base qualities" help="filter out the mismatch reads instead of quitting with an error"/>
+              </when>
+              <when value="MappingQuality">
+                  <param name="min_mapping_quality_score" type="integer" value="10" label="Minimum read mapping quality required to consider a read for calling"/>
+              </when>
+              <when value="MappingQualityUnavailable">
+                  <!-- no extra options -->
+              </when>
+              <when value="MappingQualityZero">
+                  <!-- no extra options -->
+              </when>
+              <when value="MateSameStrand">
+                  <!-- no extra options -->
+              </when>
+              <when value="MaxInsertSize">
+                  <param name="maxInsertSize" type="integer" value="1000000" label="Discard reads with insert size greater than the specified value"/>
+              </when>
+              <when value="MaxReadLength">
+                  <param name="maxReadLength" type="integer" value="76" label="Max Read Length"/>
+              </when>
+              <when value="MissingReadGroup">
+                  <!-- no extra options -->
+              </when>
+              <when value="NoOriginalQualityScores">
+                  <!-- no extra options -->
+              </when>
+              <when value="NotPrimaryAlignment">
+                  <!-- no extra options -->
+              </when>
+              <when value="Platform454">
+                  <!-- no extra options -->
+              </when>
+              <when value="Platform">
+                  <param name="PLFilterName" type="text" value="" label="Discard reads with RG:PL attribute containing this string"/>
+              </when>
+              <when value="PlatformUnit">
+                  <!-- no extra options -->
+              </when>
+              <when value="ReadGroupBlackList">
+                  <!-- no extra options -->
+              </when>
+              <when value="ReadName">
+                  <param name="readName" type="text" value="" label="Filter out all reads except those with this read name"/>
+              </when>
+              <when value="ReadStrand">
+                  <param name="filterPositive" type="boolean" truevalue="--filterPositive" falsevalue="" label="Discard reads on the forward strand"/>
+              </when>
+              <when value="ReassignMappingQuality">
+                  <param name="default_mapping_quality" type="integer" value="60" label="Default read mapping quality to assign to all reads"/>
+              </when>
+              <when value="Sample">
+                  <param name="sample_to_keep" type="text" value="" label="The name of the sample(s) to keep, filtering out all others"/>
+              </when>
+              <when value="SingleReadGroup">
+                  <param name="read_group_to_keep" type="integer" value="76" label="The name of the read group to keep, filtering out all others"/>
+              </when>
+              <when value="UnmappedRead">
+                  <!-- no extra options -->
+              </when>
+            </conditional>
+        </repeat>
+        <repeat name="input_interval_repeat" title="Operate on Genomic intervals" help="-L,--intervals &amp;lt;intervals&amp;gt;">
+          <param name="input_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" />
+        </repeat>
+        <repeat name="input_exclude_interval_repeat" title="Exclude Genomic intervals" help="-XL,--excludeIntervals &amp;lt;excludeIntervals&amp;gt;">
+          <param name="input_exclude_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" />
+        </repeat>
+
+        <param name="interval_set_rule" type="select" label="Interval set rule" help="-isr,--interval_set_rule &amp;lt;interval_set_rule&amp;gt;">
+          <option value="UNION" selected="True">UNION</option>
+          <option value="INTERSECTION">INTERSECTION</option>
+        </param>
+        <param name="interval_padding" type="integer" value="0" min="0" label="Amount of padding (in bp) to add to each interval"
+            help="This is typically used to add padding around exons when analyzing exomes. (--interval_padding / -ip)"/>
+
+        <conditional name="downsampling_type">
+          <param name="downsampling_type_selector" type="select" label="Type of reads downsampling to employ at a given locus" help="-dt,--downsampling_type &amp;lt;downsampling_type&amp;gt;">
+            <option value="NONE" selected="True">NONE</option>
+            <option value="ALL_READS">ALL_READS</option>
+            <option value="BY_SAMPLE">BY_SAMPLE</option>
+          </param>
+          <when value="NONE">
+              <!-- no more options here -->
+          </when>
+          <when value="ALL_READS">
+              <conditional name="downsample_to_type">
+                  <param name="downsample_to_type_selector" type="select" label="Downsample method">
+                      <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option>
+                      <option value="downsample_to_coverage">Downsample by Coverage</option>
+                  </param>
+                  <when value="downsample_to_fraction">
+                      <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &amp;lt;downsample_to_fraction&amp;gt;"/>
+                  </when>
+                  <when value="downsample_to_coverage">
+                      <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &amp;lt;downsample_to_coverage&amp;gt;"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="BY_SAMPLE">
+              <conditional name="downsample_to_type">
+                  <param name="downsample_to_type_selector" type="select" label="Downsample method">
+                      <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option>
+                      <option value="downsample_to_coverage">Downsample by Coverage</option>
+                  </param>
+                  <when value="downsample_to_fraction">
+                      <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &amp;lt;downsample_to_fraction&amp;gt;"/>
+                  </when>
+                  <when value="downsample_to_coverage">
+                      <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &amp;lt;downsample_to_coverage&amp;gt;"/>
+                  </when>
+              </conditional>
+          </when>
+        </conditional>
+        <param name="baq" type="select" label="Type of BAQ calculation to apply in the engine" help="-baq,--baq &amp;lt;baq&amp;gt;">
+          <option value="OFF" selected="True">OFF</option>
+          <option value="CALCULATE_AS_NECESSARY">CALCULATE_AS_NECESSARY</option>
+          <option value="RECALCULATE">RECALCULATE</option>
+        </param>
+        <param name="baq_gap_open_penalty" type="float" label="BAQ gap open penalty (Phred Scaled)" value="40" help="Default value is 40. 30 is perhaps better for whole genome call sets. -baqGOP,--baqGapOpenPenalty &amp;lt;baqGapOpenPenalty&amp;gt;" />
+        <param name="use_original_qualities" type="boolean" truevalue="--useOriginalQualities" falsevalue="" label="Use the original base quality scores from the OQ tag" help="-OQ,--useOriginalQualities" />
+        <param name="default_base_qualities" type="integer" label="Value to be used for all base quality scores, when some are missing" value="-1" help="-DBQ,--defaultBaseQualities &amp;lt;defaultBaseQualities&amp;gt;"/>
+        <param name="validation_strictness" type="select" label="How strict should we be with validation" help="-S,--validation_strictness &amp;lt;validation_strictness&amp;gt;">
+          <option value="STRICT" selected="True">STRICT</option>
+          <option value="LENIENT">LENIENT</option>
+          <option value="SILENT">SILENT</option>
+          <!-- <option value="DEFAULT_STRINGENCY">DEFAULT_STRINGENCY</option> listed in docs, but not valid value...-->
+        </param>
+        <param name="interval_merging" type="select" label="Interval merging rule" help="-im,--interval_merging &amp;lt;interval_merging&amp;gt;">
+          <option value="ALL" selected="True">ALL</option>
+          <option value="OVERLAPPING_ONLY">OVERLAPPING_ONLY</option>
+        </param>
+
+        <repeat name="read_group_black_list_repeat" title="Read group black list" help="-rgbl,--read_group_black_list &amp;lt;read_group_black_list&amp;gt;">
+          <conditional name="read_group_black_list_type">
+            <param name="read_group_black_list_type_selector" type="select" label="Type of reads read group black list">
+              <option value="file" selected="True">Filters in file</option>
+              <option value="text">Specify filters as a string</option>
+            </param>
+            <when value="file">
+              <param name="read_group_black_list" type="data" format="txt" label="Read group black list file" />
+            </when>
+            <when value="text">
+              <param name="read_group_black_list" type="text" value="tag:string" label="Read group black list tag:string" />
+            </when>
+          </conditional>
+        </repeat>
+
+        <param name="disable_experimental_low_memory_sharding" type="boolean" truevalue="--disable_experimental_low_memory_sharding" falsevalue="" label="Disable experimental low-memory sharding functionality." checked="False" help="--disable_experimental_low_memory_sharding"/>
+        <param name="non_deterministic_random_seed" type="boolean" truevalue="--nonDeterministicRandomSeed" falsevalue="" label="Makes the GATK behave non deterministically, that is, the random numbers generated will be different in every run" checked="False"  help="-ndrs,--nonDeterministicRandomSeed"/>
+        <param name="fix_misencoded_quality_scores" type="boolean" truevalue="--fix_misencoded_quality_scores" falsevalue="" label="Fix mis-encoded base quality scores. Q0 == ASCII 33 according to the SAM specification, whereas Illumina encoding starts at Q64. The idea here is simple: we just iterate over all reads and subtract 31 from every quality score." checked="False"  help="-fixMisencodedQuals / --fix_misencoded_quality_scores"/>
+
+      </when>
+    </conditional>
+  </xml>
+  <xml name="analysis_type_conditional">
+    <conditional name="analysis_param_type">
+      <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options">
+        <option value="basic" selected="True">Basic</option>
+        <option value="advanced">Advanced</option>
+      </param>
+      <when value="basic">
+        <!-- Do nothing here -->
+      </when>
+      <when value="advanced">
+        <yield />
+      </when>
+    </conditional>
+  </xml>
+  <xml name="reference_source_selector_param">
+    <param name="reference_source_selector" type="select" label="Choose the source for the reference list">
+      <option value="cached">Locally cached</option>
+      <option value="history">History</option>
+    </param>
+  </xml>
+
+  <xml name="allow_n_cigar_reads">
+    <param name="allow_n_cigar_reads" type="boolean" truevalue="-U ALLOW_N_CIGAR_READS" falsevalue=""
+        label="Allow N in CIGAR strings" help="This is required for RNA-seq data. (-U ALLOW_N_CIGAR_READS)" />
+  </xml>
+
+  <xml name="dbsnp_param">
+    <conditional name="dbsnp_rod_bind_type">
+      <param name="dbsnp_rod_bind_type_selector" type="select" label="Provide a dbSNP Reference-Ordered Data (ROD) file" help="-D,--dbsnp &amp;lt;dbsnp&amp;gt;">
+        <option value="set_dbsnp" selected="True">Set dbSNP</option>
+        <option value="exclude_dbsnp">Don't set dbSNP</option>
+      </param>
+      <when value="exclude_dbsnp" />
+      <when value="set_dbsnp">
+        <param name="dbsnp_input_rod" type="data" format="vcf" label="dbSNP ROD file" />
+        <param name="dbsnp_rod_name" type="text" value="dbsnp" label="dbsnp ROD name">
+          <validator type="regex" message="Value must be a not empty string composed by alphanumeric characters and underscores">^\w+$</validator>
+        </param>
+      </when>
+    </conditional>
+  </xml>
+  <token name="@CITATION_SECTION@">------
+
+**Citation**
+
+For the underlying tool, please cite `DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21478889&gt;`_
+
+If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.*
+
+  </token>
+  <xml name="citations">
+    <citations>
+      <citation type="doi">10.1038/ng.806</citation>
+      <citation type="doi">10.1101/gr.107524.110</citation>
+      <citation type="doi">10.1002/0471250953.bi1110s43</citation>
+    </citations>
+  </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk2_picard_index.loc.sample	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,26 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Picard dict and associated files. You will need
+#to create these data files and then create a picard_index.loc file 
+#similar to this one (store it in this directory) that points to 
+#the directories in which those files are stored. The picard_index.loc 
+#file has this format (longer white space is the TAB character):
+#
+#<unique_build_id>	<dbkey>		<display_name>		<fasta_file_path>
+#
+#So, for example, if you had hg18 indexed and stored in 
+#/depot/data2/galaxy/srma/hg18/,
+#then the srma_index.loc entry would look like this:
+#
+#hg18	hg18	hg18 Pretty		/depot/data2/galaxy/picard/hg18/hg18.fa
+#
+#and your /depot/data2/galaxy/srma/hg18/ directory
+#would contain the following three files:
+#hg18.fa
+#hg18.dict
+#hg18.fa.fai
+#
+#The dictionary file for each reference (ex. hg18.dict) must be 
+#created via Picard (http://picard.sourceforge.net). Note that
+#the dict file does not have the .fa extension although the
+#path list in the loc file does include it.
+#
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk2_wrapper.py	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,138 @@
+#!/usr/bin/env python
+#David Hoover, based on gatk by Dan Blankenberg
+
+"""
+A wrapper script for running the GenomeAnalysisTK.jar commands.
+"""
+
+import sys, optparse, os, tempfile, subprocess, shutil
+from binascii import unhexlify
+
+GALAXY_EXT_TO_GATK_EXT = { 'gatk_interval':'intervals', 'bam_index':'bam.bai', 'gatk_dbsnp':'dbSNP', 'picard_interval_list':'interval_list' } #items not listed here will use the galaxy extension as-is
+GALAXY_EXT_TO_GATK_FILE_TYPE = GALAXY_EXT_TO_GATK_EXT #for now, these are the same, but could be different if needed
+DEFAULT_GATK_PREFIX = "gatk_file"
+CHUNK_SIZE = 2**20 #1mb
+
+
+def cleanup_before_exit( tmp_dir ):
+    if tmp_dir and os.path.exists( tmp_dir ):
+        shutil.rmtree( tmp_dir )
+
+
+def gatk_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir = None, prefix = None ):
+    suffix = GALAXY_EXT_TO_GATK_EXT.get( galaxy_ext, galaxy_ext )
+    if prefix is None:
+        prefix = DEFAULT_GATK_PREFIX
+    if target_dir is None:
+        target_dir = os.getcwd()
+    gatk_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) )
+    os.symlink( galaxy_filename, gatk_filename )
+    return gatk_filename
+
+
+def gatk_filetype_argument_substitution( argument, galaxy_ext ):
+    return argument % dict( file_type = GALAXY_EXT_TO_GATK_FILE_TYPE.get( galaxy_ext, galaxy_ext ) )
+
+
+def open_file_from_option( filename, mode = 'rb' ):
+    if filename:
+        return open( filename, mode = mode )
+    return None
+
+
+def html_report_from_directory( html_out, dir ):
+    html_out.write( '<html>\n<head>\n<title>Galaxy - GATK Output</title>\n</head>\n<body>\n<p/>\n<ul>\n' )
+    for fname in sorted( os.listdir( dir ) ):
+        html_out.write(  '<li><a href="%s">%s</a></li>\n' % ( fname, fname ) )
+    html_out.write( '</ul>\n</body>\n</html>\n' )
+
+
+def index_bam_files( bam_filenames ):
+    for bam_filename in bam_filenames:
+        bam_index_filename = "%s.bai" % bam_filename
+        if not os.path.exists( bam_index_filename ):
+            #need to index this bam file
+            stderr_name = tempfile.NamedTemporaryFile( prefix = "bam_index_stderr" ).name
+            command = 'samtools index %s %s' % ( bam_filename, bam_index_filename )
+            try:
+                subprocess.check_call( args=command, shell=True, stderr=open( stderr_name, 'wb' ) )
+            except:
+                for line in open( stderr_name ):
+                    print >> sys.stderr, line
+                raise Exception( "Error indexing BAM file" )
+            finally:
+                os.unlink( stderr_name )
+
+def __main__():
+    #Parse Command Line
+    parser = optparse.OptionParser()
+    parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to GATK, without any modification.' )
+    parser.add_option( '-o', '--pass_through_options', dest='pass_through_options_encoded', action='append', type="string", help='These options are passed through directly to GATK, with decoding from binascii.unhexlify.' )
+    parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' )
+    parser.add_option( '', '--max_jvm_heap', dest='max_jvm_heap', action='store', type="string", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value.' )
+    parser.add_option( '', '--max_jvm_heap_fraction', dest='max_jvm_heap_fraction', action='store', type="int", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value as a fraction of total physical memory.' )
+    parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' )
+    parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' )
+    parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"')
+    parser.add_option( '-e', '--phone_home', dest='phone_home', action='store', type="string", default='STANDARD', help='What kind of GATK run report should we generate(NO_ET|STANDARD|STDOUT)' )
+    parser.add_option( '-K', '--gatk_key', dest='gatk_key', action='store', type="string", default=None, help='What kind of GATK run report should we generate(NO_ET|STANDARD|STDOUT)' )
+    (options, args) = parser.parse_args()
+
+    if options.pass_through_options:
+        cmd = ' '.join( options.pass_through_options )
+    else:
+        cmd = ''
+    if options.pass_through_options_encoded:
+        cmd = '%s %s' % ( cmd, ' '.join( map( unhexlify, options.pass_through_options_encoded ) ) )
+    if options.max_jvm_heap is not None:
+        cmd = cmd.replace( 'java ', 'java -Xmx%s ' % ( options.max_jvm_heap ), 1 )
+    elif options.max_jvm_heap_fraction is not None:
+        cmd = cmd.replace( 'java ', 'java -XX:DefaultMaxRAMFraction=%s  -XX:+UseParallelGC ' % ( options.max_jvm_heap_fraction ), 1 )
+    bam_filenames = []
+    tmp_dir = tempfile.mkdtemp( prefix='tmp-gatk-' )
+    try:
+        if options.datasets:
+            for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets:
+                gatk_filename = gatk_filename_from_galaxy( filename, galaxy_ext, target_dir = tmp_dir, prefix = prefix )
+                if dataset_arg:
+                    cmd = '%s %s "%s"' % ( cmd, gatk_filetype_argument_substitution( dataset_arg, galaxy_ext ), gatk_filename )
+                if galaxy_ext == "bam":
+                    bam_filenames.append( gatk_filename )
+                if galaxy_ext == 'fasta':
+                    subprocess.check_call( 'samtools faidx "%s"' % gatk_filename, shell=True )
+                    subprocess.check_call( 'java -jar %s R=%s O=%s QUIET=true' % ( os.path.join(os.environ['JAVA_JAR_PATH'], 'CreateSequenceDictionary.jar'), gatk_filename, os.path.splitext(gatk_filename)[0] + '.dict' ), shell=True )
+        index_bam_files( bam_filenames )
+        #set up stdout and stderr output options
+        stdout = open_file_from_option( options.stdout, mode = 'wb' )
+        stderr = open_file_from_option( options.stderr, mode = 'wb' )
+        #if no stderr file is specified, we'll use our own
+        if stderr is None:
+            stderr = tempfile.NamedTemporaryFile( prefix="gatk-stderr-", dir=tmp_dir )
+
+        proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir )
+        return_code = proc.wait()
+
+        if return_code:
+            stderr_target = sys.stderr
+        else:
+            stderr_target = sys.stdout
+        stderr.flush()
+        stderr.seek(0)
+        while True:
+            chunk = stderr.read( CHUNK_SIZE )
+            if chunk:
+                stderr_target.write( chunk )
+            else:
+                break
+        stderr.close()
+    finally:
+        cleanup_before_exit( tmp_dir )
+
+    #generate html reports
+    if options.html_report_from_directory:
+        for ( html_filename, html_dir ) in options.html_report_from_directory:
+            html_report_from_directory( open( html_filename, 'wb' ), html_dir )
+
+
+if __name__ == "__main__":
+    __main__()
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/haplotype_caller.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,313 @@
+<tool id="gatk2_haplotype_caller" name="Haplotype Caller" version="@VERSION@.2">
+  <description>Call SNPs and indels simultaneously via local de-novo assembly of haplotypes in an active region</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    @BAM_INPUTS@
+    -p '
+    @JAR_PATH@
+    -T "HaplotypeCaller"
+    -o "${output_vcf}"
+
+    \$GATK2_SITE_OPTIONS
+
+    --num_cpu_threads_per_data_thread \${GALAXY_SLOTS:-4}
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    #if str($input_recal) != 'None':
+        --BQSR "${input_recal}"
+    #end if
+   '
+    @DBSNP_OPTIONS@
+    $allow_n_cigar_reads
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        #if $analysis_param_type.heterozygosity.__str__.strip() != '':
+            --heterozygosity $analysis_param_type.heterozygosity
+        #end if
+        --genotyping_mode "${analysis_param_type.genotyping_mode_type.genotyping_mode}"
+        #if str( $analysis_param_type.genotyping_mode_type.genotyping_mode ) == 'GENOTYPE_GIVEN_ALLELES':
+            --alleles "${analysis_param_type.genotyping_mode_type.input_alleles_rod}"
+        #end if
+        #if not $analysis_param_type.emitRefConfidence is None:
+          --emitRefConfidence $analysis_param_type.emitRefConfidence
+        #end if
+
+        ## files
+        #if str($analysis_param_type.activeRegionIn) != 'None':
+            --activeRegionIn "$analysis_param_type.activeRegionIn"
+        #end if
+        #if str($analysis_param_type.comp) != 'None':
+            --comp "$analysis_param_type.comp"
+        #end if
+        ##
+        #if str( $analysis_param_type.annotation ) != "None":
+            #for $annotation in str( $analysis_param_type.annotation.fields.gatk_value ).split( ','):
+                --annotation "${annotation}"
+            #end for
+        #end if
+        #for $additional_annotation in $analysis_param_type.additional_annotations:
+            --annotation "${additional_annotation.additional_annotation_name}"
+        #end for
+        #if str( $analysis_param_type.group ) != "None":
+            #for $group in str( $analysis_param_type.group ).split( ','):
+                --group "${group}"
+            #end for
+        #end if
+        #if str( $analysis_param_type.exclude_annotations ) != "None":
+            #for $annotation in str( $analysis_param_type.exclude_annotations.fields.gatk_value ).split( ','):
+                --excludeAnnotation "${annotation}"
+            #end for
+        #end if
+
+        ## value setings
+        #if $analysis_param_type.contamination_fraction_to_filter.__str__.strip() != '':
+            --contamination_fraction_to_filter $analysis_param_type.contamination_fraction_to_filter
+        #end if
+        #if $analysis_param_type.minPruning.__str__.strip() != '':
+            --minPruning $analysis_param_type.minPruning
+        #end if
+        #if $analysis_param_type.standard_min_confidence_threshold_for_calling.__str__.strip() != '':
+            --standard_min_confidence_threshold_for_calling $analysis_param_type.standard_min_confidence_threshold_for_calling
+        #end if
+        #if $analysis_param_type.standard_min_confidence_threshold_for_emitting.__str__.strip() != '':
+            --standard_min_confidence_threshold_for_emitting $analysis_param_type.standard_min_confidence_threshold_for_emitting
+        #end if
+        #if $analysis_param_type.gcpHMM.__str__.strip() != '':
+            --gcpHMM $analysis_param_type.gcpHMM
+        #end if
+        #if $analysis_param_type.max_alternate_alleles.__str__.strip() != '':
+            --max_alternate_alleles $analysis_param_type.max_alternate_alleles
+        #end if
+        ## mode selections
+
+        #if $analysis_param_type.pair_hmm_implementation.__str__ != "None" and len($analysis_param_type.pair_hmm_implementation.__str__) > 0:
+          --pair_hmm_implementation $analysis_param_type.pair_hmm_implementation
+        #end if
+        ## optional outputs
+        #if $analysis_param_type.activeRegionOut:
+            --activeRegionOut $active_region_out
+        #end if
+        #if $analysis_param_type.graphOutput:
+            --graphOutput $graph_out
+        #end if
+        ## flags
+        $analysis_param_type.useAllelesTrigger
+        $analysis_param_type.fullHaplotype
+        $analysis_param_type.genotypeFullActiveRegion
+        $analysis_param_type.debug
+        '
+    #end if
+  </command>
+  <inputs>
+    <param name="input_recal" type="data" format="gatk_report" optional="true" label="Covariates table recalibration file" help="The input covariates table file which enables on-the-fly base quality score recalibration. Enables on-the-fly recalibrate of base qualities. The covariates tables are produced by the BaseQualityScoreRecalibrator tool. Please be aware that one should only run recalibration with the covariates file created on the same input bam(s) (-BQSR,--BQSR &amp;lt;recal_file&amp;gt;)" />
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <expand macro="input_bams_cached" />
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" >
+          <options from_data_table="gatk2_picard_indexes">
+            <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> does not yet work in a repeat...-->
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history">
+        <param name="input_bams" type="data" format="bam" label="BAM file" multiple="True" min="1" help="-I,--input_file &amp;lt;input_file&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+    <expand macro="dbsnp_param" />
+
+    <expand macro="allow_n_cigar_reads" />
+    <expand macro="gatk_param_type_conditional" />
+
+    <conditional name="analysis_param_type">
+      <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options">
+        <option value="basic" selected="True">Basic</option>
+        <option value="advanced">Advanced</option>
+      </param>
+      <when value="basic">
+        <!-- Do nothing here -->
+      </when>
+      <when value="advanced">
+
+        <param name="activeRegionIn" type="data" format="bed,gatk_interval,picard_interval_list,vcf" optional="true" label="activeRegionIn" help="--activeRegionIn / -AR  Use this interval list file as the active regions to process"/>
+        <param name="activeRegionOut" type="boolean" checked="False" truevalue="" falsevalue="" label="activeRegionOut" help="--activeRegionOut / -ARO  Output the active region to an interval list file"/>
+
+        <param name="annotation" type="select" multiple="True" display="checkboxes" label="Annotation Types" help="-A,--annotation &amp;lt;annotation&amp;gt;">
+          <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs -->
+          <options from_data_table="gatk2_annotations">
+            <filter type="multiple_splitter" column="tools_valid_for" separator=","/>
+            <filter type="static_value" value="HaplotypeCaller" column="tools_valid_for"/>
+          </options>
+        </param>
+        <repeat name="additional_annotations" title="Additional annotation" help="-A,--annotation &amp;lt;annotation&amp;gt;">
+          <param name="additional_annotation_name" type="text" value="" label="Annotation name" />
+        </repeat>
+<!--
+        <conditional name="snpEff_rod_bind_type">
+          <param name="snpEff_rod_bind_type_selector" type="select" label="Provide a snpEff reference-ordered data file">
+            <option value="set_snpEff">Set snpEff</option>
+            <option value="exclude_snpEff" selected="True">Don't set snpEff</option>
+          </param>
+          <when value="exclude_snpEff">
+          </when>
+          <when value="set_snpEff">
+            <param name="snpEff_input_rod" type="data" format="vcf" label="ROD file" />
+            <param name="snpEff_rod_name" type="hidden" value="snpEff" label="ROD Name"/>
+          </when>
+        </conditional>
+-->
+        <param name="group" type="select" multiple="True" display="checkboxes" label="Annotation Interfaces/Groups" help="-G,--group &amp;lt;group&amp;gt;">
+            <option value="RodRequiringAnnotation">RodRequiringAnnotation</option>
+            <option value="Standard">Standard</option>
+            <option value="Experimental">Experimental</option>
+            <option value="WorkInProgress">WorkInProgress</option>
+            <option value="RankSumTest">RankSumTest</option>
+            <!-- <option value="none">none</option> -->
+        </param>
+    <!--     <param name="family_string" type="text" value="" label="Family String"/> -->
+        <param name="exclude_annotations" type="select" multiple="True" display="checkboxes" label="Annotations to exclude" help="-XA,--excludeAnnotation &amp;lt;excludeAnnotation&amp;gt;" >
+          <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs -->
+          <options from_data_table="gatk2_annotations">
+            <filter type="multiple_splitter" column="tools_valid_for" separator=","/>
+            <filter type="static_value" value="HaplotypeCaller" column="tools_valid_for"/>
+          </options>
+        </param>
+
+        <param name="comp" type="data" format="vcf" optional="true" label="comp" help="--comp / -comp  comparison VCF file"/>
+        <param name="contamination_fraction_to_filter" type="float" value="0.05" optional="true" label="contamination_fraction_to_filter" help="--contamination_fraction_to_filter / -contamination  Fraction of contamination in sequencing data (for all samples) to aggressively remove">
+            <validator type="in_range" message="value between 0.00 and 1.00" min="0" max="1"/>
+        </param>
+        <param name="debug" type="boolean" checked="False" truevalue="-debug" falsevalue="" label="debug" help="--debug / -debug  If specified, print out very verbose debug information about each triggering active region"/>
+
+        <conditional name="genotyping_mode_type">
+          <param name="genotyping_mode" type="select" label="How to determine the alternate allele to use for genotyping" help="-gt_mode,--genotyping_mode &amp;lt;genotyping_mode&amp;gt;">
+            <option value="DISCOVERY" selected="True">DISCOVERY</option>
+            <option value="GENOTYPE_GIVEN_ALLELES">GENOTYPE_GIVEN_ALLELES</option>
+          </param>
+          <when value="DISCOVERY">
+            <!-- Do nothing here -->
+          </when>
+          <when value="GENOTYPE_GIVEN_ALLELES">
+            <param name="input_alleles_rod" type="data" format="vcf" label="Alleles ROD file" help="-alleles,--alleles &amp;lt;alleles&amp;gt;" />
+          </when>
+        </conditional>
+        <param name="graphOutput" type="boolean" checked="False" truevalue="" falsevalue="" label="graphOutput" help="--graphOutput / -graph  File to which debug assembly graph information should be written"/>
+        <param name="heterozygosity" type="float" value="0.0010" optional="true" label="heterozygosity" help="--heterozygosity / -hets  Heterozygosity value used to compute prior likelihoods for any locus"/>
+        <param name="minPruning" type="integer" value="1" optional="true" label="minPruning" help="--minPruning / -minPruning  The minimum allowed pruning factor in assembly graph. Paths with &gt;= X supporting kmers are pruned from the graph">
+            <validator type="in_range" message="value between 0 and 127" min="0" max="127"/>
+        </param>
+        <!-- http://www.broadinstitute.org/gatk/guide/article?id=2940 -->
+        <param name="emitRefConfidence" type="select" optional="true" label="Output confidence estimates" help="Emitting a per-bp or summarized confidence estimate for a site being strictly homozygous-reference (--emitRefConfidence)">
+              <option value="NONE" selected="True">don't emit anything</option>
+              <option value="BP_RESOLUTION">BP_RESOLUTION (emit detailed information for each BP)</option>
+              <option value="GVCF">GVCF (emit a block summarized version of the BP_RESOLUTION data)</option>
+        </param>
+        <param name="pair_hmm_implementation" type="select" optional="true" label="pair_hmm_implementation" help="--pair_hmm_implementation / -pairHMM  The PairHMM implementation to use for genotype likelihood calculations">
+              <option value="EXACT">EXACT</option>
+              <option value="ORIGINAL">ORIGINAL</option>
+              <option value="CACHING">CACHING</option>
+              <option value="LOGLESS_CACHING" selected="True">LOGLESS_CACHING</option>
+        </param>
+        <param name="standard_min_confidence_threshold_for_calling" type="float" value="30.0" optional="true" label="standard_min_confidence_threshold_for_calling" help="--standard_min_confidence_threshold_for_calling / -stand_call_conf  The minimum phred-scaled confidence threshold at which variants should be called"/>
+        <param name="standard_min_confidence_threshold_for_emitting" type="float" value="30.0" optional="true" label="standard_min_confidence_threshold_for_emitting" help="--standard_min_confidence_threshold_for_emitting / -stand_emit_conf  The minimum phred-scaled confidence threshold at which variants should be emitted (and filtered with LowQual if less than the calling threshold)"/>
+        <param name="useAllelesTrigger" type="boolean" checked="False" truevalue="-allelesTrigger" falsevalue="" label="useAllelesTrigger" help="--useAllelesTrigger / -allelesTrigger  If specified, use additional trigger on variants found in an external alleles file"/>
+        <param name="fullHaplotype" type="boolean" checked="False" truevalue="-fullHaplotype" falsevalue="" label="fullHaplotype" help="--fullHaplotype / -fullHaplotype  If specified, output the full haplotype sequence instead of converting to individual variants w.r.t. the reference"/>
+        <param name="gcpHMM" type="integer" value="10" optional="true" label="gcpHMM" help="--gcpHMM / -gcpHMM  Flat gap continuation penalty for use in the Pair HMM"/>
+        <param name="genotypeFullActiveRegion" type="boolean" checked="False" truevalue="-genotypeFullActiveRegion" falsevalue="" label="genotypeFullActiveRegion" help="--genotypeFullActiveRegion / -genotypeFullActiveRegion  If specified, alternate alleles are considered to be the full active region for the purposes of genotyping"/>
+        <param name="max_alternate_alleles" type="integer" value="6" optional="true" label="max_alternate_alleles" help="--max_alternate_alleles / -maxAltAlleles  Maximum number of alternate alleles to genotype"/>
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (VCF)" />
+    <data format="vcf" name="graph_out" label="${tool.name} on ${on_string} graph" >
+      <filter>analysis_param_type['analysis_param_type_selector'] == "advanced" and analysis_param_type['graphOutput'] == True</filter>
+    </data>
+    <data format="vcf" name="active_region_out" label="${tool.name} on ${on_string} activeRegion" >
+      <filter>analysis_param_type['analysis_param_type_selector'] == "advanced" and analysis_param_type['activeRegionOut'] == True</filter>
+    </data>
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="input_recal" value="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" ftype="csv" />
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_bam" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" lines_diff="4" />
+          <output name="output_log" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+**HaplotypeCaller**
+calls SNPs and indels simultaneously via local de-novo assembly of haplotypes in an active region.
+Haplotypes are evaluated using an affine gap penalty Pair HMM.
+
+For more information on using read based compression in the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_haplotypecaller_HaplotypeCaller.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: PrintReads accepts aligned BAM files.
+
+
+**Outputs**
+
+The output is a VCF file with raw, unrecalibrated SNP and indel calls.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ activeRegionIn              Use this interval list file as the active regions to process
+ activeRegionOut             Output the active region to this interval list file
+ alleles                     The set of alleles at which to genotype when --genotyping_mode is GENOTYPE_GIVEN_ALLELES
+ annotation                  One or more specific annotations to apply to variant calls
+ comp                        comparison VCF file
+ contamination               Fraction of contamination in sequencing data (for all samples) to aggressively remove
+ dbsnp                       dbSNP file
+ debug                       If specified, print out very verbose debug information about each triggering active region
+ excludeAnnotation           One or more specific annotations to exclude
+ genotyping_mode             Specifies how to determine the alternate alleles to use for genotyping
+ graphOutput                 File to which debug assembly graph information should be written
+ group                       One or more classes/groups of annotations to apply to variant calls
+ heterozygosity              Heterozygosity value used to compute prior likelihoods for any locus
+ minPruning                  The minimum allowed pruning factor in assembly graph. Paths with less than or equal supporting kmers are pruned from the graph
+ pair_hmm_implementation     The PairHMM implementation to use for genotype likelihood calculations
+ stand_call_conf             The minimum phred-scaled confidence threshold at which variants should be called
+ stand_emit_conf             The minimum phred-scaled confidence threshold at which variants should be emitted (and filtered with LowQual if less than the calling threshold)
+ useAllelesTrigger           If specified, use additional trigger on variants found in an external alleles file
+ fullHaplotype               If specified, output the full haplotype sequence instead of converting to individual variants w.r.t. the reference
+ gcpHMM                      Flat gap continuation penalty for use in the Pair HMM
+ genotypeFullActiveRegion    If specified, alternate alleles are considered to be the full active region for the purposes of genotyping
+ max_alternate_alleles       Maximum number of alternate alleles to genotype
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/indel_realigner.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,213 @@
+<tool id="gatk2_indel_realigner" name="Indel Realigner" version="@VERSION@.1">
+  <description>- perform local realignment</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input"
+    #if str( $reference_source.input_bam.metadata.bam_index ) != "None":
+        -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index
+    #end if
+    -p '
+    @JAR_PATH@
+    -T "IndelRealigner"
+    -o "${output_bam}"
+
+    \$GATK2_SITE_OPTIONS
+
+    ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975
+    --num_cpu_threads_per_data_thread 1
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+   -LOD "${lod_threshold}"
+    ${knowns_only}
+   '
+
+    #set $rod_binding_names = dict()
+    #for $rod_binding in $rod_bind:
+        #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom':
+            #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name
+        #else
+            #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector
+        #end if
+        #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1
+        -d "-known:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}"
+    #end for
+
+    $allow_n_cigar_reads
+    #include source=$standard_gatk_options#
+    ##start analysis specific options
+    -d "-targetIntervals" "${target_intervals}" "${target_intervals.ext}" "gatk_target_intervals"
+    -p '
+    --disable_bam_indexing
+    '
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        --entropyThreshold "${analysis_param_type.entropy_threshold}"
+        ${analysis_param_type.simplify_bam}
+        --consensusDeterminationModel "${analysis_param_type.consensus_determination_model}"
+        --maxIsizeForMovement "${analysis_param_type.max_insert_size_for_movement}"
+        --maxPositionalMoveAllowed "${analysis_param_type.max_positional_move_allowed}"
+        --maxConsensuses "${analysis_param_type.max_consensuses}"
+        --maxReadsForConsensuses "${analysis_param_type.max_reads_for_consensuses}"
+        --maxReadsForRealignment "${analysis_param_type.max_reads_for_realignment}"
+        ${analysis_param_type.no_original_alignment_tags}
+        '
+    #end if
+  </command>
+  <inputs>
+
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;">
+          <validator type="unspecified_build" />
+          <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->
+        </param>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" >
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options>
+            <filter type="data_meta" key="dbkey" ref="input_bam" />
+          </options>
+        </param>
+      </when>
+    </conditional>
+    <param name="target_intervals" type="data" format="gatk_interval,bed,picard_interval_list" label="Restrict realignment to provided intervals" help="-targetIntervals,--targetIntervals &amp;lt;targetIntervals&amp;gt;" />
+    <repeat name="rod_bind" title="Known Variants" help="Using data sets of known variants (-known,--knownAlleles &amp;lt;knownAlleles&amp;gt;)">
+        <conditional name="rod_bind_type">
+          <param name="rod_bind_type_selector" type="select" label="Variant Type">
+            <option value="dbsnp" selected="True">dbSNP</option>
+            <option value="snps">SNPs</option>
+            <option value="indels">INDELs</option>
+            <option value="custom">Custom</option>
+          </param>
+          <when value="dbsnp">
+              <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" />
+          </when>
+          <when value="snps">
+              <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" />
+          </when>
+          <when value="indels">
+              <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" />
+          </when>
+          <when value="custom">
+              <param name="custom_rod_name" type="text" value="Unknown" label="Customer's variant file"/>
+              <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" />
+          </when>
+        </conditional>
+    </repeat>
+    <param name="lod_threshold" type="float" value="5.0" label="LOD threshold above which the realigner will proceed to realign" help="-LOD,--LODThresholdForCleaning &amp;lt;LODThresholdForCleaning&amp;gt;" />
+    <param name="knowns_only" type="boolean" checked="False" truevalue="-knownsOnly" falsevalue="" label="Use only known indels provided as RODs" help="-knownsOnly"/>
+
+    <expand macro="allow_n_cigar_reads" />
+    <expand macro="gatk_param_type_conditional" />
+
+    <expand macro="analysis_type_conditional">
+
+        <param name="entropy_threshold" type="float" value="0.15" label="percentage of mismatching base quality scores at a position to be considered having high entropy" help="-entropy,--entropyThreshold &amp;lt;entropyThreshold&amp;gt;" />
+        <param name="simplify_bam" type="boolean" checked="False" truevalue="-simplifyBAM" falsevalue="" label="Simplify BAM" help="-simplifyBAM,--simplifyBAM"/>
+        <param name="consensus_determination_model" type="select" label="Consensus Determination Model" help="-model,--consensusDeterminationModel &amp;lt;consensusDeterminationModel&amp;gt;">
+          <option value="KNOWNS_ONLY">KNOWNS_ONLY</option>
+          <option value="USE_READS" selected="True">USE_READS</option>
+          <option value="USE_SW">USE_SW</option>
+        </param>
+        <param name="max_insert_size_for_movement" type="integer" value="3000" label="Maximum insert size of read pairs that we attempt to realign" help="-maxIsize,--maxIsizeForMovement &amp;lt;maxIsizeForMovement&amp;gt;" />
+        <param name="max_positional_move_allowed" type="integer" value="200" label="Maximum positional move in basepairs that a read can be adjusted during realignment" help="-maxPosMove,--maxPositionalMoveAllowed &amp;lt;maxPositionalMoveAllowed&amp;gt;" />
+        <param name="max_consensuses" type="integer" value="30" label="Max alternate consensuses to try" help="-maxConsensuses,--maxConsensuses &amp;lt;maxConsensuses&amp;gt;" />
+        <param name="max_reads_for_consensuses" type="integer" value="120" label="Max reads (chosen randomly) used for finding the potential alternate consensuses" help="-greedy,--maxReadsForConsensuses &amp;lt;maxReadsForConsensuses&amp;gt;" />
+        <param name="max_reads_for_realignment" type="integer" value="20000" label="Max reads allowed at an interval for realignment" help="-maxReads,--maxReadsForRealignment &amp;lt;maxReadsForRealignment&amp;gt;" />
+        <param name="no_original_alignment_tags" type="boolean" checked="False" truevalue="--noOriginalAlignmentTags" falsevalue="" label="Don't output the original cigar or alignment start tags for each realigned read in the output bam" help="-noTags,--noOriginalAlignmentTags"/>
+    </expand>
+  </inputs>
+  <outputs>
+    <data format="bam" name="output_bam" label="${tool.name} on ${on_string} (BAM)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="target_intervals" value="gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval" ftype="gatk_interval" />
+          <param name="input_bam" value="gatk/fake_phiX_reads_1.bam" ftype="bam" />
+          <param name="rod_bind_type_selector" value="snps" />
+          <param name="input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" />
+          <param name="lod_threshold" value="5.0" />
+          <param name="knowns_only" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="advanced" />
+          <param name="entropy_threshold" value="0.15" />
+          <param name="simplify_bam" />
+          <param name="consensus_determination_model" value="USE_SW" />
+          <param name="max_insert_size_for_movement" value="3000" />
+          <param name="max_positional_move_allowed" value="200" />
+          <param name="max_consensuses" value="30" />
+          <param name="max_reads_for_consensuses" value="120" />
+          <param name="max_reads_for_realignment" value="20000" />
+          <param name="no_original_alignment_tags" />
+          <output name="output_bam" file="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" lines_diff="2" />
+          <output name="output_log" file="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+Performs local realignment of reads based on misalignments due to the presence of indels. Unlike most mappers, this walker uses the full alignment context to determine whether an appropriate alternate reference (i.e. indel) exists and updates SAMRecords accordingly.
+
+For more information on local realignment around indels using the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_indels_IndelRealigner.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: IndelRealigner accepts an aligned BAM and a list of intervals to realign as input files.
+
+
+**Outputs**
+
+The output is in the BAM format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ targetIntervals              intervals file output from RealignerTargetCreator
+ LODThresholdForCleaning      LOD threshold above which the cleaner will clean
+ entropyThreshold             percentage of mismatches at a locus to be considered having high entropy
+ out                          Output bam
+ bam_compression              Compression level to use for writing BAM files
+ disable_bam_indexing         Turn off on-the-fly creation of indices for output BAM files.
+ simplifyBAM                  If provided, output BAM files will be simplified to include just key reads for downstream variation discovery analyses (removing duplicates, PF-, non-primary reads), as well stripping all extended tags from the kept reads except the read group identifier
+ useOnlyKnownIndels           Don't run 'Smith-Waterman' to generate alternate consenses; use only known indels provided as RODs for constructing the alternate references.
+ maxReadsInMemory             max reads allowed to be kept in memory at a time by the SAMFileWriter. Keep it low to minimize memory consumption (but the tool may skip realignment on regions with too much coverage.  If it is too low, it may generate errors during realignment); keep it high to maximize realignment (but make sure to give Java enough memory).
+ maxIsizeForMovement          maximum insert size of read pairs that we attempt to realign
+ maxPositionalMoveAllowed     maximum positional move in basepairs that a read can be adjusted during realignment
+ maxConsensuses               max alternate consensuses to try (necessary to improve performance in deep coverage)
+ maxReadsForConsensuses       max reads used for finding the alternate consensuses (necessary to improve performance in deep coverage)
+ maxReadsForRealignment       max reads allowed at an interval for realignment; if this value is exceeded, realignment is not attempted and the reads are passed to the output file(s) as-is
+ noOriginalAlignmentTags      Don't output the original cigar or alignment start tags for each realigned read in the output bam.
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/print_reads.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,245 @@
+<tool id="gatk2_print_reads" name="Print Reads" version="@VERSION@.0">
+  <description>on BAM files</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input"
+    #if str( $reference_source.input_bam.metadata.bam_index ) != "None":
+        -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index
+    #end if
+    -p '
+    @JAR_PATH@
+    -T "PrintReads"
+    -o "${output_bam}"
+    \$GATK2_SITE_OPTIONS
+
+    ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975
+    --num_cpu_threads_per_data_thread \${GALAXY_SLOTS:-6}
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    #if str($input_recal) != 'None':
+        --BQSR "${input_recal}"
+    #end if
+    --disable_bam_indexing
+   '
+
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        #if $analysis_param_type.default_read_group_type.default_read_group_type_selector == "set":
+            --default_read_group "${analysis_param_type.default_read_group_type.default_read_group}"
+        #end if
+        #if str( $analysis_param_type.default_platform ) != "default":
+            --default_platform "${analysis_param_type.default_platform}"
+        #end if
+        #if str( $analysis_param_type.force_read_group_type.force_read_group_type_selector ) == "set":
+            --force_read_group "${analysis_param_type.force_read_group_type.force_read_group}"
+        #end if
+        #if str( $analysis_param_type.force_platform ) != "default":
+            --force_platform "${analysis_param_type.force_platform}"
+        #end if
+        ${analysis_param_type.exception_if_no_tile}
+        #if str( $analysis_param_type.solid_options_type.solid_options_type_selector ) == "set":
+            #if str( $analysis_param_type.solid_options_type.solid_recal_mode ) != "default":
+                --solid_recal_mode "${analysis_param_type.solid_options_type.solid_recal_mode}"
+            #end if
+            #if str( $analysis_param_type.solid_options_type.solid_nocall_strategy ) != "default":
+                --solid_nocall_strategy "${analysis_param_type.solid_options_type.solid_nocall_strategy}"
+            #end if
+        #end if
+        ${analysis_param_type.simplify_bam}
+        --preserve_qscores_less_than "${analysis_param_type.preserve_qscores_less_than}"
+        --smoothing "${analysis_param_type.smoothing}"
+        --max_quality_score "${analysis_param_type.max_quality_score}"
+        --window_size_nqs "${analysis_param_type.window_size_nqs}"
+        --homopolymer_nback "${analysis_param_type.homopolymer_nback}"
+        ${analysis_param_type.do_not_write_original_quals}
+        '
+    #end if
+  </command>
+  <inputs>
+    <param name="input_recal" type="data" format="gatk_report" optional="true" label="Covariates table recalibration file"
+        help="The input covariates table file which enables on-the-fly base quality score recalibration (intended for use with BaseRecalibrator files) (-BQSR,--BQSR)" />
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;">
+          <validator type="unspecified_build" />
+          <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->
+        </param>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" >
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options>
+            <filter type="data_meta" key="dbkey" ref="input_bam" />
+          </options>
+        </param>
+      </when>
+    </conditional>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <conditional name="analysis_param_type">
+      <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options">
+        <option value="basic" selected="True">Basic</option>
+        <option value="advanced">Advanced</option>
+      </param>
+      <when value="basic">
+        <!-- Do nothing here -->
+      </when>
+      <when value="advanced">
+        <conditional name="default_read_group_type">
+          <param name="default_read_group_type_selector" type="select" label="Set default Read Group" help="--default_read_group">
+            <option value="default" selected="True">Don't Set</option>
+            <option value="set">Set</option>
+          </param>
+          <when value="default">
+            <!-- do nothing here -->
+          </when>
+          <when value="set">
+            <param name="default_read_group" type="text" value="Unknown" label="If a read has no read group then default to the provided String"/>
+          </when>
+        </conditional>
+        <param name="default_platform" type="select" label="Set default Platform" help="--default_platform">
+          <option value="default" selected="True">Don't Set</option>
+          <option value="illumina">illumina</option>
+          <option value="454">454</option>
+          <option value="solid">solid</option>
+        </param>
+        <conditional name="force_read_group_type">
+          <param name="force_read_group_type_selector" type="select" label="Force Read Group" help="--force_read_group">
+            <option value="default" selected="True">Don't Force</option>
+            <option value="set">Force</option>
+          </param>
+          <when value="default">
+            <!-- do nothing here -->
+          </when>
+          <when value="set">
+            <param name="force_read_group" type="text" value="Unknown" label="If provided, the read group ID of EVERY read will be forced to be the provided String."/>
+          </when>
+        </conditional>
+        <param name="force_platform" type="select" label="Force Platform" help="--force_platform">
+          <option value="default" selected="True">Don't Force</option>
+          <option value="illumina">illumina</option>
+          <option value="454">454</option>
+          <option value="solid">solid</option>
+        </param>
+        <param name="exception_if_no_tile" type="boolean" checked="False" truevalue="--exception_if_no_tile" falsevalue="" label="Throw an exception when no tile can be found" help="--exception_if_no_tile"/>
+        <conditional name="solid_options_type">
+          <param name="solid_options_type_selector" type="select" label="Set SOLiD specific options">
+            <option value="default" selected="True">Don't Set</option>
+            <option value="set">Set</option>
+          </param>
+          <when value="default">
+            <!-- do nothing here -->
+          </when>
+          <when value="set">
+            <param name="solid_recal_mode" type="select" label="How should we recalibrate solid bases in which the reference was inserted" help="-sMode,--solid_recal_mode &amp;lt;solid_recal_mode&amp;gt;">
+              <option value="default" selected="True">Don't set</option>
+              <option value="DO_NOTHING">DO_NOTHING</option>
+              <option value="SET_Q_ZERO">SET_Q_ZERO</option>
+              <option value="SET_Q_ZERO_BASE_N">SET_Q_ZERO_BASE_N</option>
+              <option value="REMOVE_REF_BIAS">REMOVE_REF_BIAS</option>
+            </param>
+            <param name="solid_nocall_strategy" type="select" label="Behavior of the recalibrator when it encounters no calls" help="-solid_nocall_strategy,--solid_nocall_strategy &amp;lt;solid_nocall_strategy&amp;gt;">
+              <option value="default" selected="True">Don't set</option>
+              <option value="THROW_EXCEPTION">THROW_EXCEPTION</option>
+              <option value="LEAVE_READ_UNRECALIBRATED">LEAVE_READ_UNRECALIBRATED</option>
+              <option value="PURGE_READ">PURGE_READ</option>
+            </param>
+          </when>
+        </conditional>
+        <param name="simplify_bam" type="boolean" checked="False" truevalue="-simplifyBAM" falsevalue="" label="Simplify BAM" help="-simplifyBAM,--simplifyBAM"/>
+        <param name="window_size_nqs" type="integer" value="5" label="Window size used by MinimumNQSCovariate" help="--window_size_nqs"/>
+        <param name="homopolymer_nback" type="integer" value="7" label="Number of previous bases to look at in HomopolymerCovariate" help="-nback,--homopolymer_nback &amp;lt;homopolymer_nback&amp;gt;" />
+        <param name="preserve_qscores_less_than" type="integer" value="5" label="Bases with quality scores less than this threshold won't be recalibrated" help="-pQ,--preserve_qscores_less_than &amp;lt;preserve_qscores_less_than&amp;gt;"/>
+        <param name="smoothing" type="integer" value="1" label="smoothing" help="-sm,--smoothing &amp;lt;smoothing&amp;gt;"/>
+        <param name="max_quality_score" type="integer" value="50" label="Max quality score" help="-maxQ,--max_quality_score &amp;lt;max_quality_score&amp;gt;"/>
+        <param name="do_not_write_original_quals" type="boolean" checked="False" truevalue="--doNotWriteOriginalQuals" falsevalue="" label="Do Not Write Original Quality tag" help="-noOQs,--doNotWriteOriginalQuals"/>
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <data format="bam" name="output_bam" label="${tool.name} on ${on_string} (BAM)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="input_recal" value="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" ftype="csv" />
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_bam" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" lines_diff="4" />
+          <output name="output_log" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+This walker is designed to work as the second pass in a two-pass processing step, doing a by-read traversal.  For each base in each read this walker calculates various user-specified covariates (such as read group, reported quality score, cycle, and dinuc) Using these values as a key in a large hashmap the walker calculates an empirical base quality score and overwrites the quality score currently in the read. This walker then outputs a new bam file with these updated (recalibrated) reads.  Note: This walker expects as input the recalibration table file generated previously by CovariateCounterWalker. Note: This walker is designed to be used in conjunction with CovariateCounterWalker.
+
+For more information on base quality score recalibration using the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_readutils_PrintReads.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: PrintReads accepts an aligned BAM and a recalibration (gatk_report) input files.
+
+
+**Outputs**
+
+The output is in BAM format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ default_read_group             If a read has no read group then default to the provided String.
+ default_platform               If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid.
+ force_read_group               If provided, the read group ID of EVERY read will be forced to be the provided String. This is useful to collapse all data into a single read group.
+ force_platform                 If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid.
+ window_size_nqs                The window size used by MinimumNQSCovariate for its calculation
+ homopolymer_nback              The number of previous bases to look at in HomopolymerCovariate
+ exception_if_no_tile           If provided, TileCovariate will throw an exception when no tile can be found. The default behavior is to use tile = -1
+ solid_recal_mode               How should we recalibrate solid bases in whichthe reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS (DO_NOTHING|SET_Q_ZERO|SET_Q_ZERO_BASE_N|REMOVE_REF_BIAS)
+ solid_nocall_strategy          Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ (THROW_EXCEPTION|LEAVE_READ_UNRECALIBRATED|PURGE_READ)
+ recal_file                     Filename for the input covariates table recalibration .gatk_report file
+ out                            The output BAM file
+ bam_compression                Compression level to use for writing BAM files
+ disable_bam_indexing           Turn off on-the-fly creation of indices for output BAM files.
+ simplifyBAM                    If provided, output BAM files will be simplified to include just key reads for downstream variation discovery analyses (removing duplicates, PF-, non-primary reads), as well stripping all extended tags from the kept reads except the read group identifier
+ preserve_qscores_less_than     Bases with quality scores less than this threshold won't be recalibrated, default=5. In general it's unsafe to change qualities scores below &lt; 5, since base callers use these values to indicate random or bad bases
+ smoothing                      Number of imaginary counts to add to each bin bin order to smooth out bins with few data points, default=1
+ max_quality_score              The integer value at which to cap the quality scores, default=50
+ doNotWriteOriginalQuals        If true, we will not write the original quality (OQ) tag for each read
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,98 @@
+Galaxy wrapper for GATK2
+========================
+
+This wrapper is copyright 2013 by Björn Grüning, Jim Johnson & the Galaxy Team.
+
+The Genome Analysis Toolkit or GATK is a software package developed at the 
+Broad Institute to analyse next-generation resequencing data. The toolkit offers
+a wide variety of tools, with a primary focus on variant discovery and 
+genotyping as well as strong emphasis on data quality assurance. Its robust 
+architecture, powerful processing engine and high-performance computing features
+make it capable of taking on projects of any size.
+
+http://www.broadinstitute.org/gatk
+http://www.broadinstitute.org/gatk/about/citing-gatk
+
+GATK is Free for academics, and fee for commercial use. Please study the GATK licensing website:
+http://www.broadinstitute.org/gatk/about/#licensing
+
+
+Installation
+============
+
+The recommended installation is by means of the toolshed_.
+
+.. _toolshed: http://toolshed.g2.bx.psu.edu/view/iuc/gatk2
+
+Galaxy should be able to install samtools dependencies automatically
+for you. GATK2, and its new licence model, does not allow us to distribute the GATK binaries.
+As a consequence you need to install GATK2 by your own, please see the GATK website for more information:
+
+http://www.broadinstitute.org/gatk/download
+
+Once you have installed GATK2, you need to edit the env.sh files that are installed together with the wrappers.
+You must edit the GATK2_PATH environment variable in the file:
+
+<tool_dependency_dir>/environment_settings/GATK2_PATH/iuc/gatk2/<hash_string>/env.sh
+
+to point to the folder where you have installed GATK2.
+
+Optionally, you may also want to edit the GATK2_SITE_OPTIONS environment variable in the file:
+
+<tool_dependency_dir>/environment_settings/GATK2_SITE_OPTIONS/iuc/gatk2/<hash_string>/env.sh
+
+to deactivate the 'call home feature' of GATK with something like:
+
+GATK2_SITE_OPTIONS='-et NO_ET -K /data/gatk2_key_file'
+
+GATK2_SITE_OPTIONS can be also used to insert other specific options into every GATK2 wrapper
+at runtime, without changing the actual wrapper.
+
+Read more about the "Phone Home" problem at:
+http://www.broadinstitute.org/gatk/guide/article?id=1250
+
+Optionally, you may also want to add some commands to be executed before GATK (e.g. to load modules) to the file:
+::
+    <tool_dependency_dir>/gatk2/default/env.sh
+
+Note that due to the manual nature of the GATK2 installation you will be getting the 
+following warnings in the Galaxy log (unless you specified the env.sh in the previous paragraph):
+::
+    Failed to resolve dependency on 'gatk2', ignoring.
+
+This is because the 
+::
+    <requirement type="package">gatk2</requirement>
+is specified but never resolved in the tool_dependencies.xml. It is safe to ignore.
+
+Finally, you should fill in additional information about your genomes and 
+annotations in the gatk2_picard_index.loc and gatk2_annotations.txt. 
+You can find them in the tool-data/ Galaxy directory.
+
+History
+=======
+
+* v0.1      - Initial public release
+* v2.8.0    - Bugfix release, increase version number to reflect the underlying GATK version
+
+
+Licence (MIT)
+=============
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in
+all copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+THE SOFTWARE.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/realigner_target_creator.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,174 @@
+<tool id="gatk2_realigner_target_creator" name="Realigner Target Creator" version="@VERSION@.1">
+  <description>for use in local realignment</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input"
+    #if str( $reference_source.input_bam.metadata.bam_index ) != "None":
+        -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index
+    #end if
+    -p '
+    @JAR_PATH@
+    -T "RealignerTargetCreator"
+    -o "${output_interval}"
+
+    \$GATK2_SITE_OPTIONS
+
+    ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975
+    --num_cpu_threads_per_data_thread 1
+
+    @THREADS@
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+   '
+    #set $rod_binding_names = dict()
+    #for $rod_binding in $rod_bind:
+        #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom':
+            #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name
+        #else
+            #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector
+        #end if
+        #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1
+        -d "-known:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}"
+    #end for
+
+    $allow_n_cigar_reads
+    #include source=$standard_gatk_options#
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        --minReadsAtLocus "${analysis_param_type.minReadsAtLocus}"
+        --windowSize "${analysis_param_type.windowSize}"
+        --mismatchFraction "${analysis_param_type.mismatchFraction}"
+        --maxIntervalSize "${analysis_param_type.maxIntervalSize}"
+        '
+    #end if
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;">
+          <validator type="unspecified_build" />
+          <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->
+        </param>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" >
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options>
+            <filter type="data_meta" key="dbkey" ref="input_bam" />
+          </options>
+        </param>
+      </when>
+    </conditional>
+
+    <repeat name="rod_bind" title="Known Variants" help="Using data sets of known variants (-known,--known &amp;lt;known&amp;gt;)">
+        <conditional name="rod_bind_type">
+          <param name="rod_bind_type_selector" type="select" label="Variant Type">
+            <option value="dbsnp" selected="True">dbSNP</option>
+            <option value="snps">SNPs</option>
+            <option value="indels">INDELs</option>
+            <option value="custom">Custom</option>
+          </param>
+          <when value="dbsnp">
+              <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" />
+          </when>
+          <when value="snps">
+              <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" />
+          </when>
+          <when value="indels">
+              <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" />
+          </when>
+          <when value="custom">
+              <param name="custom_rod_name" type="text" value="Unknown" label="Customer's variant file" />
+              <param name="input_rod" type="data" format="vcf" label="Variant file (VCF format)" />
+          </when>
+        </conditional>
+    </repeat>
+
+    <expand macro="allow_n_cigar_reads" />
+    <expand macro="gatk_param_type_conditional" />
+
+    <expand macro="analysis_type_conditional">
+        <param name="windowSize" type="integer" value="10" label="Window size for calculating entropy or SNP clusters (windowSize)"
+            help="-window,--windowSize &amp;lt;windowSize&amp;gt;" />
+        <param name="mismatchFraction" type="float" value="0.15" label="Fraction of base qualities needing to mismatch for a position to have high entropy (mismatchFraction)"
+            help="to disable set to &lt;= 0 or &gt; 1 (-mismatch,--mismatchFraction &amp;lt;mismatchFraction&amp;gt;)"/>
+        <param name="minReadsAtLocus" type="integer" value="4" label="Minimum reads at a locus to enable using the entropy calculation (minReadsAtLocus)"
+            help="-minReads,--minReadsAtLocus &amp;lt;minReadsAtLocus&amp;gt;" />
+        <param name="maxIntervalSize" type="integer" value="500" label="Maximum interval size" help="-maxInterval,--maxIntervalSize &amp;lt;maxIntervalSize&amp;gt;" />
+    </expand>
+  </inputs>
+  <outputs>
+    <data format="gatk_interval" name="output_interval" label="${tool.name} on ${on_string} (GATK intervals)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/fake_phiX_reads_1.bam" ftype="bam" />
+          <param name="rod_bind_type_selector" value="dbsnp" />
+          <param name="input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="advanced" />
+          <param name="windowSize" value="10" />
+          <param name="mismatchFraction" value="0.15" />
+          <param name="minReadsAtLocus" value="4" />
+          <param name="maxIntervalSize" value="500" />
+          <output name="output_interval" file="gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval" />
+          <output name="output_log" file="gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.log.contains" compare="contains"/>
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+Emits intervals for the Local Indel Realigner to target for cleaning.  Ignores 454 reads, MQ0 reads, and reads with consecutive indel operators in the CIGAR string.
+
+For more information on local realignment around indels using the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_indels_RealignerTargetCreator.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: RealignerTargetCreator accepts an aligned BAM input file.
+
+
+**Outputs**
+
+The output is in GATK Interval format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ windowSize          window size for calculating entropy or SNP clusters
+ mismatchFraction    fraction of base qualities needing to mismatch for a position to have high entropy; to disable set to &lt;= 0 or &gt; 1
+ minReadsAtLocus     minimum reads at a locus to enable using the entropy calculation
+ maxIntervalSize     maximum interval size
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/reduce_reads.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,228 @@
+<tool id="gatk2_reduce_reads" name="Reduce Reads" version="@VERSION@.0">
+  <description>in BAM files</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input"
+    #if str( $reference_source.input_bam.metadata.bam_index ) != "None":
+        -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index
+    #end if
+    -p '
+    @JAR_PATH@
+    -T "ReduceReads"
+    -o "${output_bam}"
+
+    \$GATK2_SITE_OPTIONS
+
+    ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975
+    --num_cpu_threads_per_data_thread 1
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    #if str($input_recal) != 'None':
+        --BQSR "${input_recal}"
+    #end if
+    --disable_bam_indexing
+   '
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        #if $analysis_param_type.context_size.__str__.strip() != '':
+            --context_size $analysis_param_type.context_size
+        #end if
+        #if $analysis_param_type.downsample_coverage.__str__.strip() != '':
+            --downsample_coverage $analysis_param_type.downsample_coverage
+        #end if
+        #if $analysis_param_type.minimum_del_proportion_to_trigger_variant.__str__.strip() != '':
+            --minimum_del_proportion_to_trigger_variant $analysis_param_type.minimum_del_proportion_to_trigger_variant
+        #end if
+        #if $analysis_param_type.minimum_mapping_quality.__str__.strip() != '':
+            --minimum_mapping_quality $analysis_param_type.minimum_mapping_quality
+        #end if
+        #if $analysis_param_type.minimum_tail_qualities.__str__.strip() != '':
+            --minimum_tail_qualities $analysis_param_type.minimum_tail_qualities
+        #end if
+        #if $analysis_param_type.minimum_base_quality_to_consider.__str__.strip() != '':
+            --minimum_base_quality_to_consider $analysis_param_type.minimum_base_quality_to_consider
+        #end if
+        #if $analysis_param_type.minimum_alt_proportion_to_trigger_variant.__str__.strip() != '':
+            --minimum_alt_proportion_to_trigger_variant $analysis_param_type.minimum_alt_proportion_to_trigger_variant
+        #end if
+        $analysis_param_type.allow_polyploid_reduction
+        $analysis_param_type.dont_compress_read_names
+        $analysis_param_type.dont_hardclip_low_qual_tails
+        $analysis_param_type.dont_simplify_reads
+        $analysis_param_type.dont_use_softclipped_bases
+        $analysis_param_type.hard_clip_to_interval
+        $analysis_param_type.dont_hardclip_adaptor_sequences
+        '
+    #end if
+  </command>
+  <inputs>
+    <param name="input_recal" type="data" format="csv" optional="true" label="Covariates table recalibration file" help="The input covariates table file which enables on-the-fly base quality score recalibration. Enables on-the-fly recalibrate of base qualities. The covariates tables are produced by the BaseQualityScoreRecalibrator tool. Please be aware that one should only run recalibration with the covariates file created on the same input bam(s) (-BQSR,--BQSR &amp;lt;recal_file&amp;gt;)" />
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;">
+          <validator type="unspecified_build" />
+          <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->
+        </param>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" >
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history">
+        <param name="input_bam" type="data" format="bam" label="BAM file" help="-I,--input_file &amp;lt;input_file&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options>
+            <filter type="data_meta" key="dbkey" ref="input_bam" />
+          </options>
+        </param>
+      </when>
+    </conditional>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <conditional name="analysis_param_type">
+      <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options">
+        <option value="basic" selected="True">Basic</option>
+        <option value="advanced">Advanced</option>
+      </param>
+      <when value="basic">
+        <!-- Do nothing here -->
+      </when>
+      <when value="advanced">
+        <param name="allow_polyploid_reduction" type="boolean" checked="False" truevalue="-polyploid" falsevalue="" label="Allow polyploid-based reduction" help="--allow_polyploid_reduction / -polyploid Allow the experimental polyploid-based reduction capabilities"/>
+        <param name="context_size" type="integer" value="10" optional="true" label="context_size" help="The number of bases to keep around mismatches (potential variation)">
+        </param>
+        <param name="dont_compress_read_names" type="boolean" checked="False" truevalue="-nocmp_names" falsevalue="" label="Do not compress read names." help="--dont_compress_read_names / -nocmp_names  By default, ReduceReads will compress read names to numbers and guarantee uniqueness and reads with similar name will still have similar compressed names. Note: If you scatter/gather there is no guarantee that read name uniqueness will be maintained -- in this case we recommend not compressing."/>
+        <param name="dont_hardclip_low_qual_tails" type="boolean" checked="False" truevalue="-noclip_tail" falsevalue="" label="Do not hard clip the low quality tails of the reads" help="--dont_hardclip_low_qual_tails / -noclip_tail This option overrides the argument of minimum tail quality"/>
+
+        <param name="dont_simplify_reads" type="boolean" checked="False" truevalue="-nosimplify" falsevalue="" label="Do not simplify read" help="--dont_simplify_reads / -nosimplify Do not simplify read (strip away all extra information of the read -- anything other than bases, quals and read group)."/>
+        <param name="dont_use_softclipped_bases" type="boolean" checked="False" truevalue="-no_soft" falsevalue="" label="Do not use high quality soft-clipped bases" help="--dont_use_softclipped_bases / -no_soft  Do not use high quality soft-clipped bases. By default, ReduceReads will hard clip away any low quality soft clipped base left by the aligner and use the high quality soft clipped bases in it's traversal algorithm to identify variant regions. The minimum quality for soft clipped bases is the same as the minimum base quality to consider (minqual)"/>
+        <param name="downsample_coverage" type="integer" value="250" optional="true" label="Downsample the coverage of a variable region" help="Downsamples the coverage of a variable region approximately (guarantees the minimum to be equal to this). A value of 0 turns downsampling off.">
+        </param>
+        <param name="hard_clip_to_interval" type="boolean" checked="False" truevalue="-clip_int" falsevalue="" label="Hard clip all incoming reads" help="--hard_clip_to_interval / -clip_int  Optionally hard clip all incoming reads to the desired intervals. The hard clips will happen exactly at the interval border."/>
+        <param name="minimum_del_proportion_to_trigger_variant" type="float" value="0.05" optional="true" label="Minimum proportion of indels in a site to trigger a variant region" help="--minimum_del_proportion_to_trigger_variant / -mindel   Minimum proportion of indels in a site to trigger a variant region. Anything below this will be considered consensus.  ">
+        </param>
+        <param name="minimum_mapping_quality" type="integer" value="20" optional="true" label="Minimum mapping quality for consensus read" help="--minimum_mapping_quality / -minmap  The minimum mapping quality to be considered for the consensus synthetic read. Reads that have mapping quality below this threshold will not be counted towards consensus, but are still counted towards variable regions.">
+        </param>
+        <param name="minimum_tail_qualities" type="integer" value="2" optional="true" label="Minimum tail quality" help="--minimum_tail_qualities / -mintail  Reads have notoriously low quality bases on the tails (left and right). Consecutive bases with quality lower than this threshold will be hard clipped off before entering the reduce reads algorithm.">
+            <validator type="in_range" message="value between 0 and 127" min="0" max="127"/>
+        </param>
+        <param name="minimum_base_quality_to_consider" type="integer" value="20" optional="true" label="Minimum mapping quality for consensus read" help="--minimum_mapping_quality / -minmap  The minimum mapping quality to be considered for the consensus synthetic read. Reads that have mapping quality below this threshold will not be counted towards consensus, but are still counted towards variable regions.">
+            <validator type="in_range" message="value between 0 and 127" min="0" max="127"/>
+        </param>
+        <param name="minimum_alt_proportion_to_trigger_variant" type="float" value="0.05" optional="true" label="Minimum proportion of mismatches in a site to trigger a variant region" help="--minimum_alt_proportion_to_trigger_variant / -minvar  Minimum proportion of mismatches in a site to trigger a variant region. Anything below this will be considered consensus.">
+            <validator type="in_range" message="value between 0.00 and 1.00" min="0.0" max="1.0"/>
+        </param>
+        <param name="dont_hardclip_adaptor_sequences" type="boolean" checked="False" truevalue="-noclip_ad" falsevalue="" label="Do not hard clip adaptor sequences" help="--dont_hardclip_adaptor_sequences / -noclip_ad  Do not hard clip adaptor sequences. Note: You don't have to turn this on for reads that are not mate paired. The program will behave correctly in those cases."/>
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <data format="bam" name="output_bam" label="${tool.name} on ${on_string} (BAM)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="input_recal" value="gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv" ftype="csv" />
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam" ftype="bam" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_bam" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" lines_diff="4" />
+          <output name="output_log" file="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+ReduceReads
+Reduces the BAM file using read based compression that keeps only essential information for variant calling
+
+This walker will generated reduced versions of the BAM files that still follow the BAM spec and contain all the information necessary for the GSA variant calling pipeline. Some options allow you to tune in how much compression you want to achieve. The default values have been shown to reduce a typical whole exome BAM file 100x. The higher the coverage, the bigger the savings in file size and performance of the downstream tools.
+
+.. For more information on using read based compression in the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_compression_reducereads_ReduceReads.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: PrintReads accepts an aligned BAM and a recalibration CSV input files.
+
+
+**Outputs**
+
+The output is in BAM format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+
+ --allow_polyploid_reduction / -polyploid ( boolean with default value false )
+ Allow the experimental polyploid-based reduction capabilities of this tool
+
+ --context_size / -cs ( int with default value 10 )
+ The number of bases to keep around mismatches (potential variation)
+
+ --dont_compress_read_names / -nocmp_names ( boolean with default value false )
+ Do not compress read names. By default, ReduceReads will compress read names to numbers and guarantee uniqueness and reads with similar name will still have similar compressed names. Note: If you scatter/gather there is no guarantee that read name uniqueness will be maintained -- in this case we recommend not compressing.
+
+ --dont_hardclip_low_qual_tails / -noclip_tail ( boolean with default value false )
+ Do not hard clip the low quality tails of the reads. This option overrides the argument of minimum tail quality.
+
+ --dont_simplify_reads / -nosimplify ( boolean with default value false )
+ Do not simplify read (strip away all extra information of the read -- anything other than bases, quals and read group).
+
+ --dont_use_softclipped_bases / -no_soft ( boolean with default value false )
+ Do not use high quality soft-clipped bases. By default, ReduceReads will hard clip away any low quality soft clipped base left by the aligner and use the high quality soft clipped bases in it's traversal algorithm to identify variant regions. The minimum quality for soft clipped bases is the same as the minimum base quality to consider (minqual)
+
+ --downsample_coverage / -ds ( int with default value 250 )
+ Downsamples the coverage of a variable region approximately (guarantees the minimum to be equal to this). A value of 0 turns downsampling off.
+
+ --hard_clip_to_interval / -clip_int ( boolean with default value false )
+ Optionally hard clip all incoming reads to the desired intervals. The hard clips will happen exactly at the interval border.
+
+ -mindel / --minimum_del_proportion_to_trigger_variant ( double with default value 0.05 )
+ Minimum proportion of indels in a site to trigger a variant region. Anything below this will be considered consensus.
+
+ --minimum_mapping_quality / -minmap ( int with default value 20 )
+ The minimum mapping quality to be considered for the consensus synthetic read. Reads that have mapping quality below this threshold will not be counted towards consensus, but are still counted towards variable regions.
+
+ --minimum_tail_qualities / -mintail ( byte with default value 2 )
+ Reads have notoriously low quality bases on the tails (left and right). Consecutive bases with quality lower than this threshold will be hard clipped off before entering the reduce reads algorithm.
+
+ -minqual / --minimum_base_quality_to_consider ( byte with default value 20 )
+ The minimum base quality to be considered for the consensus synthetic read. Reads that have base quality below this threshold will not be counted towards consensus, but are still counted towards variable regions.
+
+ -minvar / --minimum_alt_proportion_to_trigger_variant ( double with default value 0.05 )
+ Minimum proportion of mismatches in a site to trigger a variant region. Anything below this will be considered consensus.
+
+ -noclip_ad / --dont_hardclip_adaptor_sequences ( boolean with default value false )
+ Do not hard clip adaptor sequences. Note: You don't have to turn this on for reads that are not mate paired. The program will behave correctly in those cases.
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
Binary file test-data/gatk/fake_phiX_reads_1.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/fake_phiX_variant_locations.bed	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,2 @@
+phiX174	1442	1443
+phiX174	1445	1446
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/fake_phiX_variant_locations.vcf	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,70 @@
+##fileformat=VCFv4.1
+##samtoolsVersion=0.1.18 (r982:295)
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=MQ,Number=1,Type=Integer,Description="Root-mean-square mapping quality of covering reads">
+##INFO=<ID=FQ,Number=1,Type=Float,Description="Phred probability of all samples being the same">
+##INFO=<ID=AF1,Number=1,Type=Float,Description="Max-likelihood estimate of the first ALT allele frequency (assuming HWE)">
+##INFO=<ID=AC1,Number=1,Type=Float,Description="Max-likelihood estimate of the first ALT allele count (no HWE assumption)">
+##INFO=<ID=G3,Number=3,Type=Float,Description="ML estimate of genotype frequencies">
+##INFO=<ID=HWE,Number=1,Type=Float,Description="Chi^2 based HWE test P-value based on G3">
+##INFO=<ID=CLR,Number=1,Type=Integer,Description="Log ratio of genotype likelihoods with and without the constraint">
+##INFO=<ID=UGT,Number=1,Type=String,Description="The most probable unconstrained genotype configuration in the trio">
+##INFO=<ID=CGT,Number=1,Type=String,Description="The most probable constrained genotype configuration in the trio">
+##INFO=<ID=PV4,Number=4,Type=Float,Description="P-values for strand bias, baseQ bias, mapQ bias and tail distance bias">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=PC2,Number=2,Type=Integer,Description="Phred probability of the nonRef allele frequency in group1 samples being larger (,smaller) than in group2.">
+##INFO=<ID=PCHI2,Number=1,Type=Float,Description="Posterior weighted chi^2 P-value for testing the association between group1 and group2 samples.">
+##INFO=<ID=QCHI2,Number=1,Type=Integer,Description="Phred scaled PCHI2.">
+##INFO=<ID=PR,Number=1,Type=Integer,Description="# permutations yielding a smaller PCHI2.">
+##INFO=<ID=VDB,Number=1,Type=Float,Description="Variant Distance Bias">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=GL,Number=3,Type=Float,Description="Likelihoods for RR,RA,AA genotypes (R=ref,A=alt)">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="# high-quality bases">
+##FORMAT=<ID=SP,Number=1,Type=Integer,Description="Phred-scaled strand bias P-value">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="List of Phred-scaled genotype likelihoods">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A Fake phiX Sample
+phiX174	1411	.	A	.	28.2	.	DP=1;;AC1=2;FQ=-30	PL	0
+phiX174	1412	.	G	.	28.2	.	DP=3;;AC1=2;FQ=-30	PL	0
+phiX174	1413	.	C	.	28.2	.	DP=5;;AC1=2;FQ=-30	PL	0
+phiX174	1414	.	G	.	28.2	.	DP=6;;AC1=2;FQ=-30	PL	0
+phiX174	1415	.	C	.	28.2	.	DP=7;;AC1=2;FQ=-30	PL	0
+phiX174	1416	.	C	.	28.2	.	DP=8;;AC1=2;FQ=-30	PL	0
+phiX174	1417	.	G	.	28.2	.	DP=9;;AC1=2;FQ=-30	PL	0
+phiX174	1418	.	T	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1419	.	G	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1420	.	G	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1421	.	A	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1422	.	T	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1423	.	G	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1424	.	C	.	28.2	.	DP=10;VDB=0.0005;;AC1=2;FQ=-30	PL	0
+phiX174	1425	.	C	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1426	.	T	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1427	.	G	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1428	.	A	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1429	.	C	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1430	.	C	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1431	.	G	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1432	.	T	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1433	.	A	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1434	.	C	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1435	.	C	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1436	.	G	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1437	.	A	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1438	.	G	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1439	.	G	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1440	.	C	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1441	.	T	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1442	.	A	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1443	.	A	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1444	.	C	.	28.2	.	DP=7;;AC1=2;FQ=-30	PL	0
+phiX174	1445	.	C	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1446	.	C	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1447	.	T	.	28.2	.	DP=10;;AC1=2;FQ=-30	PL	0
+phiX174	1448	.	A	.	28.2	.	DP=8;;AC1=2;FQ=-30	PL	0
+phiX174	1449	.	A	.	28.2	.	DP=6;;AC1=2;FQ=-30	PL	0
+phiX174	1450	.	T	.	28.2	.	DP=4;;AC1=2;FQ=-30	PL	0
+phiX174	1451	.	G	.	28.2	.	DP=3;;AC1=2;FQ=-30	PL	0
+phiX174	1452	.	A	.	28.2	.	DP=2;;AC1=2;FQ=-30	PL	0
+phiX174	1453	.	G	.	28.2	.	DP=1;;AC1=2;FQ=-30	PL	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_analyze_covariates/gatk_analyze_covariates_out_1.html	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,34 @@
+<html>
+<head>
+<title>Galaxy - GATK Output</title>
+</head>
+<body>
+<p/>
+<ul>
+<li><a href="A Fake phiX Sample.CycleCovariate.dat">A Fake phiX Sample.CycleCovariate.dat</a></li>
+<li><a href="A Fake phiX Sample.CycleCovariate.dat.Cycle_hist.pdf">A Fake phiX Sample.CycleCovariate.dat.Cycle_hist.pdf</a></li>
+<li><a href="A Fake phiX Sample.CycleCovariate.dat.qual_diff_v_Cycle.pdf">A Fake phiX Sample.CycleCovariate.dat.qual_diff_v_Cycle.pdf</a></li>
+<li><a href="A Fake phiX Sample.CycleCovariate.dat.reported_qual_v_Cycle.pdf">A Fake phiX Sample.CycleCovariate.dat.reported_qual_v_Cycle.pdf</a></li>
+<li><a href="A Fake phiX Sample.DinucCovariate.dat">A Fake phiX Sample.DinucCovariate.dat</a></li>
+<li><a href="A Fake phiX Sample.DinucCovariate.dat.Dinuc_hist.pdf">A Fake phiX Sample.DinucCovariate.dat.Dinuc_hist.pdf</a></li>
+<li><a href="A Fake phiX Sample.DinucCovariate.dat.qual_diff_v_Dinuc.pdf">A Fake phiX Sample.DinucCovariate.dat.qual_diff_v_Dinuc.pdf</a></li>
+<li><a href="A Fake phiX Sample.DinucCovariate.dat.reported_qual_v_Dinuc.pdf">A Fake phiX Sample.DinucCovariate.dat.reported_qual_v_Dinuc.pdf</a></li>
+<li><a href="A Fake phiX Sample.HomopolymerCovariate.dat">A Fake phiX Sample.HomopolymerCovariate.dat</a></li>
+<li><a href="A Fake phiX Sample.HomopolymerCovariate.dat.Homopolymer_hist.pdf">A Fake phiX Sample.HomopolymerCovariate.dat.Homopolymer_hist.pdf</a></li>
+<li><a href="A Fake phiX Sample.HomopolymerCovariate.dat.qual_diff_v_Homopolymer.pdf">A Fake phiX Sample.HomopolymerCovariate.dat.qual_diff_v_Homopolymer.pdf</a></li>
+<li><a href="A Fake phiX Sample.HomopolymerCovariate.dat.reported_qual_v_Homopolymer.pdf">A Fake phiX Sample.HomopolymerCovariate.dat.reported_qual_v_Homopolymer.pdf</a></li>
+<li><a href="A Fake phiX Sample.MinimumNQSCovariate.dat">A Fake phiX Sample.MinimumNQSCovariate.dat</a></li>
+<li><a href="A Fake phiX Sample.MinimumNQSCovariate.dat.MinimumNQS_hist.pdf">A Fake phiX Sample.MinimumNQSCovariate.dat.MinimumNQS_hist.pdf</a></li>
+<li><a href="A Fake phiX Sample.MinimumNQSCovariate.dat.qual_diff_v_MinimumNQS.pdf">A Fake phiX Sample.MinimumNQSCovariate.dat.qual_diff_v_MinimumNQS.pdf</a></li>
+<li><a href="A Fake phiX Sample.MinimumNQSCovariate.dat.reported_qual_v_MinimumNQS.pdf">A Fake phiX Sample.MinimumNQSCovariate.dat.reported_qual_v_MinimumNQS.pdf</a></li>
+<li><a href="A Fake phiX Sample.PositionCovariate.dat">A Fake phiX Sample.PositionCovariate.dat</a></li>
+<li><a href="A Fake phiX Sample.PositionCovariate.dat.Position_hist.pdf">A Fake phiX Sample.PositionCovariate.dat.Position_hist.pdf</a></li>
+<li><a href="A Fake phiX Sample.PositionCovariate.dat.qual_diff_v_Position.pdf">A Fake phiX Sample.PositionCovariate.dat.qual_diff_v_Position.pdf</a></li>
+<li><a href="A Fake phiX Sample.PositionCovariate.dat.reported_qual_v_Position.pdf">A Fake phiX Sample.PositionCovariate.dat.reported_qual_v_Position.pdf</a></li>
+<li><a href="A Fake phiX Sample.QualityScoreCovariate.dat">A Fake phiX Sample.QualityScoreCovariate.dat</a></li>
+<li><a href="A Fake phiX Sample.QualityScoreCovariate.dat.quality_emp_hist.pdf">A Fake phiX Sample.QualityScoreCovariate.dat.quality_emp_hist.pdf</a></li>
+<li><a href="A Fake phiX Sample.QualityScoreCovariate.dat.quality_emp_v_stated.pdf">A Fake phiX Sample.QualityScoreCovariate.dat.quality_emp_v_stated.pdf</a></li>
+<li><a href="A Fake phiX Sample.QualityScoreCovariate.dat.quality_rep_hist.pdf">A Fake phiX Sample.QualityScoreCovariate.dat.quality_rep_hist.pdf</a></li>
+</ul>
+</body>
+</html>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_analyze_covariates/gatk_analyze_covariates_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,9 @@
+Program Name: org.broadinstitute.sting.analyzecovariates.AnalyzeCovariates
+Reading in input csv file...
+...Done!
+Writing out intermediate tables for R...
+Writing out data tables for read group: A Fake phiX Sample	with 340 observations	and aggregate residual error = -9.136
+...Done!
+Calling analysis R scripts and writing out figures...
+Analyzing read group: A Fake phiX Sample
+...Done!
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,246 @@
+# Counted Sites    41
+# Counted Bases    340
+# Skipped Sites    2
+# Fraction Skipped 1 / 21 bp
+ReadGroup,QualityScore,Cycle,Dinuc,Homopolymer,MinimumNQS,Position,nObservations,nMismatches,Qempirical
+A Fake phiX Sample,26,1,NN,0,26,0,9,0,40
+A Fake phiX Sample,26,1,NN,1,26,0,1,0,40
+A Fake phiX Sample,26,2,AG,0,26,1,1,0,40
+A Fake phiX Sample,26,2,CC,0,26,1,1,0,40
+A Fake phiX Sample,26,2,CG,0,26,1,3,0,40
+A Fake phiX Sample,26,2,GC,0,26,1,2,0,40
+A Fake phiX Sample,26,2,GC,1,26,1,1,0,40
+A Fake phiX Sample,26,2,GT,0,26,1,1,0,40
+A Fake phiX Sample,26,2,TG,1,26,1,1,0,40
+A Fake phiX Sample,26,3,CC,0,26,2,1,0,40
+A Fake phiX Sample,26,3,CG,0,26,2,3,0,40
+A Fake phiX Sample,26,3,GC,0,26,2,1,0,40
+A Fake phiX Sample,26,3,GC,1,26,2,2,0,40
+A Fake phiX Sample,26,3,GG,0,26,2,1,0,40
+A Fake phiX Sample,26,3,GT,0,26,2,1,0,40
+A Fake phiX Sample,26,3,TG,1,26,2,1,0,40
+A Fake phiX Sample,26,4,CC,0,26,3,2,0,40
+A Fake phiX Sample,26,4,CG,0,26,3,2,0,40
+A Fake phiX Sample,26,4,GA,0,26,3,1,0,40
+A Fake phiX Sample,26,4,GC,1,26,3,2,0,40
+A Fake phiX Sample,26,4,GG,0,26,3,1,0,40
+A Fake phiX Sample,26,4,GT,0,26,3,1,0,40
+A Fake phiX Sample,26,4,TG,1,26,3,1,0,40
+A Fake phiX Sample,26,5,AT,0,26,4,1,0,40
+A Fake phiX Sample,26,5,CC,0,26,4,2,0,40
+A Fake phiX Sample,26,5,CG,0,26,4,2,0,40
+A Fake phiX Sample,26,5,GA,0,26,4,1,0,40
+A Fake phiX Sample,26,5,GC,1,26,4,1,0,40
+A Fake phiX Sample,26,5,GG,0,26,4,1,0,40
+A Fake phiX Sample,26,5,GT,0,26,4,1,0,40
+A Fake phiX Sample,26,5,TG,1,26,4,1,0,40
+A Fake phiX Sample,26,6,AT,0,26,5,1,0,40
+A Fake phiX Sample,26,6,CC,0,26,5,1,0,40
+A Fake phiX Sample,26,6,CG,0,26,5,2,0,40
+A Fake phiX Sample,26,6,GA,0,26,5,1,0,40
+A Fake phiX Sample,26,6,GG,0,26,5,1,0,40
+A Fake phiX Sample,26,6,GT,0,26,5,2,0,40
+A Fake phiX Sample,26,6,TG,0,26,5,1,0,40
+A Fake phiX Sample,26,6,TG,1,26,5,1,0,40
+A Fake phiX Sample,26,7,AT,0,26,6,1,0,40
+A Fake phiX Sample,26,7,CG,0,26,6,1,0,40
+A Fake phiX Sample,26,7,GA,0,26,6,2,1,3
+A Fake phiX Sample,26,7,GG,0,26,6,1,0,40
+A Fake phiX Sample,26,7,GT,0,26,6,2,0,40
+A Fake phiX Sample,26,7,TG,0,26,6,1,0,40
+A Fake phiX Sample,26,7,TG,1,26,6,2,0,40
+A Fake phiX Sample,26,8,AC,0,26,7,1,0,40
+A Fake phiX Sample,26,8,AT,0,26,7,1,0,40
+A Fake phiX Sample,26,8,GA,0,26,7,2,1,3
+A Fake phiX Sample,26,8,GG,0,26,7,2,0,40
+A Fake phiX Sample,26,8,GT,0,26,7,1,0,40
+A Fake phiX Sample,26,8,TG,0,26,7,1,0,40
+A Fake phiX Sample,26,8,TG,1,26,7,2,0,40
+A Fake phiX Sample,26,9,AC,0,26,8,1,0,40
+A Fake phiX Sample,26,9,AT,0,26,8,1,0,40
+A Fake phiX Sample,26,9,CT,0,26,8,1,0,40
+A Fake phiX Sample,26,9,GA,0,26,8,3,1,5
+A Fake phiX Sample,26,9,GG,0,26,8,2,0,40
+A Fake phiX Sample,26,9,TG,0,26,8,1,0,40
+A Fake phiX Sample,26,9,TG,1,26,8,1,0,40
+A Fake phiX Sample,26,10,AC,0,26,9,1,0,40
+A Fake phiX Sample,26,10,AT,0,26,9,2,0,40
+A Fake phiX Sample,26,10,CT,0,26,9,1,0,40
+A Fake phiX Sample,26,10,GA,0,26,9,3,1,5
+A Fake phiX Sample,26,10,GG,0,26,9,1,0,40
+A Fake phiX Sample,26,10,TG,0,26,9,2,0,40
+A Fake phiX Sample,26,11,AC,0,26,10,1,0,40
+A Fake phiX Sample,26,11,AT,0,26,10,2,0,40
+A Fake phiX Sample,26,11,CT,0,26,10,1,0,40
+A Fake phiX Sample,26,11,GA,0,26,10,3,1,5
+A Fake phiX Sample,26,11,TG,0,26,10,3,0,40
+A Fake phiX Sample,26,12,AC,0,26,11,1,0,40
+A Fake phiX Sample,26,12,AC,1,26,11,1,0,40
+A Fake phiX Sample,26,12,AT,0,26,11,1,0,40
+A Fake phiX Sample,26,12,CT,0,26,11,1,0,40
+A Fake phiX Sample,26,12,GA,0,26,11,2,1,3
+A Fake phiX Sample,26,12,GC,1,26,11,1,0,40
+A Fake phiX Sample,26,12,TG,0,26,11,3,0,40
+A Fake phiX Sample,26,13,AC,0,26,12,1,0,40
+A Fake phiX Sample,26,13,AC,1,26,12,1,0,40
+A Fake phiX Sample,26,13,CC,0,26,12,2,0,40
+A Fake phiX Sample,26,13,CT,0,26,12,1,0,40
+A Fake phiX Sample,26,13,GA,0,26,12,2,1,3
+A Fake phiX Sample,26,13,GC,1,26,12,1,0,40
+A Fake phiX Sample,26,13,TG,0,26,12,2,0,40
+A Fake phiX Sample,26,14,AC,0,26,13,1,0,40
+A Fake phiX Sample,26,14,AC,1,26,13,1,0,40
+A Fake phiX Sample,26,14,CC,0,26,13,2,0,40
+A Fake phiX Sample,26,14,CG,0,26,13,1,0,40
+A Fake phiX Sample,26,14,CT,0,26,13,2,0,40
+A Fake phiX Sample,26,14,GA,0,26,13,1,0,40
+A Fake phiX Sample,26,14,GC,1,26,13,1,0,40
+A Fake phiX Sample,26,14,TG,0,26,13,1,0,40
+A Fake phiX Sample,26,15,AC,1,26,14,1,0,40
+A Fake phiX Sample,26,15,CC,0,26,14,2,0,40
+A Fake phiX Sample,26,15,CG,0,26,14,1,0,40
+A Fake phiX Sample,26,15,CT,0,26,14,2,0,40
+A Fake phiX Sample,26,15,GA,0,26,14,1,0,40
+A Fake phiX Sample,26,15,GT,0,26,14,1,0,40
+A Fake phiX Sample,26,15,TG,0,26,14,2,0,40
+A Fake phiX Sample,26,16,AC,1,26,15,1,0,40
+A Fake phiX Sample,26,16,CC,0,26,15,1,0,40
+A Fake phiX Sample,26,16,CG,0,26,15,1,0,40
+A Fake phiX Sample,26,16,CT,0,26,15,1,0,40
+A Fake phiX Sample,26,16,GA,0,26,15,2,0,40
+A Fake phiX Sample,26,16,GT,0,26,15,1,0,40
+A Fake phiX Sample,26,16,TA,0,26,15,1,0,40
+A Fake phiX Sample,26,16,TG,0,26,15,2,0,40
+A Fake phiX Sample,26,17,AC,1,26,16,3,0,40
+A Fake phiX Sample,26,17,CC,0,26,16,1,0,40
+A Fake phiX Sample,26,17,CG,0,26,16,1,0,40
+A Fake phiX Sample,26,17,GA,0,26,16,2,0,40
+A Fake phiX Sample,26,17,GT,0,26,16,1,0,40
+A Fake phiX Sample,26,17,TA,0,26,16,1,0,40
+A Fake phiX Sample,26,17,TG,0,26,16,1,0,40
+A Fake phiX Sample,26,18,AC,1,26,17,3,0,40
+A Fake phiX Sample,26,18,CC,0,26,17,3,0,40
+A Fake phiX Sample,26,18,CG,0,26,17,1,0,40
+A Fake phiX Sample,26,18,GA,0,26,17,1,0,40
+A Fake phiX Sample,26,18,GT,0,26,17,1,0,40
+A Fake phiX Sample,26,18,TA,0,26,17,1,0,40
+A Fake phiX Sample,26,19,AC,1,26,18,2,0,40
+A Fake phiX Sample,26,19,CC,0,26,18,3,0,40
+A Fake phiX Sample,26,19,CG,0,26,18,3,0,40
+A Fake phiX Sample,26,19,GT,0,26,18,1,0,40
+A Fake phiX Sample,26,19,TA,0,26,18,1,0,40
+A Fake phiX Sample,26,20,AC,1,26,19,1,0,40
+A Fake phiX Sample,26,20,CC,0,26,19,2,0,40
+A Fake phiX Sample,26,20,CG,0,26,19,3,0,40
+A Fake phiX Sample,26,20,GA,0,26,19,1,0,40
+A Fake phiX Sample,26,20,GT,0,26,19,2,0,40
+A Fake phiX Sample,26,20,TA,0,26,19,1,0,40
+A Fake phiX Sample,26,21,AC,1,26,20,1,0,40
+A Fake phiX Sample,26,21,AG,1,26,20,1,0,40
+A Fake phiX Sample,26,21,CC,0,26,20,1,0,40
+A Fake phiX Sample,26,21,CG,0,26,20,2,0,40
+A Fake phiX Sample,26,21,GA,0,26,20,1,0,40
+A Fake phiX Sample,26,21,GT,0,26,20,2,0,40
+A Fake phiX Sample,26,21,TA,0,26,20,2,0,40
+A Fake phiX Sample,26,22,AC,1,26,21,2,0,40
+A Fake phiX Sample,26,22,AG,1,26,21,1,0,40
+A Fake phiX Sample,26,22,CC,0,26,21,1,0,40
+A Fake phiX Sample,26,22,CG,0,26,21,1,0,40
+A Fake phiX Sample,26,22,GA,0,26,21,1,0,40
+A Fake phiX Sample,26,22,GG,0,26,21,1,0,40
+A Fake phiX Sample,26,22,GT,0,26,21,1,0,40
+A Fake phiX Sample,26,22,TA,0,26,21,2,0,40
+A Fake phiX Sample,26,23,AC,1,26,22,2,0,40
+A Fake phiX Sample,26,23,AG,1,26,22,1,0,40
+A Fake phiX Sample,26,23,CC,0,26,22,2,0,40
+A Fake phiX Sample,26,23,CG,0,26,22,1,0,40
+A Fake phiX Sample,26,23,GA,0,26,22,1,0,40
+A Fake phiX Sample,26,23,GC,0,26,22,1,0,40
+A Fake phiX Sample,26,23,GG,0,26,22,1,0,40
+A Fake phiX Sample,26,23,TA,0,26,22,1,0,40
+A Fake phiX Sample,26,24,AC,1,26,23,1,0,40
+A Fake phiX Sample,26,24,AG,1,26,23,1,0,40
+A Fake phiX Sample,26,24,CC,0,26,23,2,0,40
+A Fake phiX Sample,26,24,CG,0,26,23,2,0,40
+A Fake phiX Sample,26,24,CT,0,26,23,1,0,40
+A Fake phiX Sample,26,24,GA,0,26,23,1,0,40
+A Fake phiX Sample,26,24,GC,0,26,23,1,0,40
+A Fake phiX Sample,26,24,GG,0,26,23,1,0,40
+A Fake phiX Sample,26,25,AG,1,26,24,1,0,40
+A Fake phiX Sample,26,25,CC,0,26,24,1,0,40
+A Fake phiX Sample,26,25,CG,0,26,24,2,0,40
+A Fake phiX Sample,26,25,CT,0,26,24,1,0,40
+A Fake phiX Sample,26,25,GA,0,26,24,2,0,40
+A Fake phiX Sample,26,25,GC,0,26,24,1,0,40
+A Fake phiX Sample,26,25,GG,0,26,24,1,0,40
+A Fake phiX Sample,26,25,TA,1,26,24,1,0,40
+A Fake phiX Sample,26,26,AG,1,26,25,2,0,40
+A Fake phiX Sample,26,26,CG,0,26,25,1,0,40
+A Fake phiX Sample,26,26,CT,0,26,25,1,0,40
+A Fake phiX Sample,26,26,GA,0,26,25,2,0,40
+A Fake phiX Sample,26,26,GC,0,26,25,1,0,40
+A Fake phiX Sample,26,26,GG,0,26,25,1,0,40
+A Fake phiX Sample,26,26,TA,1,26,25,1,0,40
+A Fake phiX Sample,26,27,AC,2,26,26,1,0,40
+A Fake phiX Sample,26,27,AG,1,26,26,2,0,40
+A Fake phiX Sample,26,27,CT,0,26,26,1,0,40
+A Fake phiX Sample,26,27,GA,0,26,26,1,0,40
+A Fake phiX Sample,26,27,GC,0,26,26,1,0,40
+A Fake phiX Sample,26,27,GG,0,26,26,2,0,40
+A Fake phiX Sample,26,27,TA,1,26,26,1,0,40
+A Fake phiX Sample,26,28,AC,2,26,27,1,0,40
+A Fake phiX Sample,26,28,AG,1,26,27,1,0,40
+A Fake phiX Sample,26,28,CC,1,26,27,1,0,40
+A Fake phiX Sample,26,28,CT,0,26,27,1,0,40
+A Fake phiX Sample,26,28,GC,0,26,27,2,0,40
+A Fake phiX Sample,26,28,GG,0,26,27,2,0,40
+A Fake phiX Sample,26,28,TA,1,26,27,1,0,40
+A Fake phiX Sample,26,29,AC,2,26,28,1,0,40
+A Fake phiX Sample,26,29,CC,1,26,28,1,0,40
+A Fake phiX Sample,26,29,CT,0,26,28,2,0,40
+A Fake phiX Sample,26,29,GC,0,26,28,2,0,40
+A Fake phiX Sample,26,29,GG,0,26,28,1,0,40
+A Fake phiX Sample,26,29,TA,1,26,28,1,0,40
+A Fake phiX Sample,26,30,AC,2,26,29,1,0,40
+A Fake phiX Sample,26,30,CC,1,26,29,1,0,40
+A Fake phiX Sample,26,30,CT,0,26,29,3,0,40
+A Fake phiX Sample,26,30,GC,0,26,29,1,0,40
+A Fake phiX Sample,26,30,TA,1,26,29,2,0,40
+A Fake phiX Sample,26,31,AC,2,26,30,1,0,40
+A Fake phiX Sample,26,31,CC,1,26,30,1,0,40
+A Fake phiX Sample,26,31,CT,0,26,30,2,0,40
+A Fake phiX Sample,26,31,TA,1,26,30,3,0,40
+A Fake phiX Sample,26,32,AA,0,26,31,1,0,40
+A Fake phiX Sample,26,32,AC,1,26,31,1,0,40
+A Fake phiX Sample,26,32,AC,2,26,31,1,0,40
+A Fake phiX Sample,26,32,CC,1,26,31,1,0,40
+A Fake phiX Sample,26,32,CT,0,26,31,1,0,40
+A Fake phiX Sample,26,32,TA,1,26,31,2,0,40
+A Fake phiX Sample,26,33,AA,0,26,32,1,0,40
+A Fake phiX Sample,26,33,AC,1,26,32,1,0,40
+A Fake phiX Sample,26,33,AC,2,26,32,1,0,40
+A Fake phiX Sample,26,33,AT,0,26,32,1,0,40
+A Fake phiX Sample,26,33,CC,1,26,32,1,0,40
+A Fake phiX Sample,26,33,CT,0,26,32,1,0,40
+A Fake phiX Sample,26,33,TA,1,26,32,1,0,40
+A Fake phiX Sample,26,34,AA,0,26,33,1,0,40
+A Fake phiX Sample,26,34,AC,1,26,33,1,0,40
+A Fake phiX Sample,26,34,AT,0,26,33,1,0,40
+A Fake phiX Sample,26,34,CC,1,26,33,1,0,40
+A Fake phiX Sample,26,34,CT,0,26,33,2,0,40
+A Fake phiX Sample,26,34,TA,1,26,33,1,0,40
+A Fake phiX Sample,26,34,TG,0,26,33,1,0,40
+A Fake phiX Sample,26,35,AA,0,26,34,1,0,40
+A Fake phiX Sample,26,35,AT,0,26,34,1,0,40
+A Fake phiX Sample,26,35,CT,0,26,34,2,0,40
+A Fake phiX Sample,26,35,GA,0,26,34,1,0,40
+A Fake phiX Sample,26,35,TA,1,26,34,2,0,40
+A Fake phiX Sample,26,35,TG,0,26,34,1,0,40
+A Fake phiX Sample,26,36,AA,0,26,35,2,0,40
+A Fake phiX Sample,26,36,AG,0,26,35,1,0,40
+A Fake phiX Sample,26,36,AT,0,26,35,1,0,40
+A Fake phiX Sample,26,36,CT,0,26,35,2,0,40
+A Fake phiX Sample,26,36,GA,0,26,35,1,0,40
+A Fake phiX Sample,26,36,TA,0,26,35,2,0,40
+A Fake phiX Sample,26,36,TG,0,26,35,1,0,40
+EOF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,13 @@
+GenomeAnalysisEngine - Strictness is SILENT
+CountCovariatesWalker - The covariates being used here:
+CountCovariatesWalker - 	ReadGroupCovariate
+CountCovariatesWalker - 	QualityScoreCovariate
+CountCovariatesWalker - 	CycleCovariate
+CountCovariatesWalker - 	DinucCovariate
+CountCovariatesWalker - 	HomopolymerCovariate
+CountCovariatesWalker - 	MinimumNQSCovariate
+CountCovariatesWalker - 	PositionCovariate
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
+CountCovariatesWalker - Writing raw recalibration data...
+CountCovariatesWalker - ...done!
+TraversalEngine - Total runtime
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,6 @@
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
+TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining 
+DepthOfCoverageWalker - Printing summary info 
+DepthOfCoverageWalker - Printing locus summary 
+TraversalEngine - Total runtime
+TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%)
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,2 @@
+	gte_0	gte_1	gte_2	gte_3	gte_4	gte_5	gte_6	gte_7	gte_8	gte_9	gte_10	gte_11	gte_12	gte_13	gte_14	gte_15	gte_16	gte_17	gte_18	gte_19	gte_20	gte_21	gte_22	gte_23	gte_24	gte_25	gte_26	gte_27	gte_28	gte_29	gte_30	gte_31	gte_32	gte_33	gte_34	gte_35	gte_36	gte_37	gte_38	gte_39	gte_40	gte_41	gte_42	gte_43	gte_44	gte_45	gte_46	gte_47	gte_48	gte_49	gte_50	gte_51	gte_52	gte_53	gte_54	gte_55	gte_56	gte_57	gte_58	gte_59	gte_60	gte_61	gte_62	gte_63	gte_64	gte_65	gte_66	gte_67	gte_68	gte_69	gte_70	gte_71	gte_72	gte_73	gte_74	gte_75	gte_76	gte_77	gte_78	gte_79	gte_80	gte_81	gte_82	gte_83	gte_84	gte_85	gte_86	gte_87	gte_88	gte_89	gte_90	gte_91	gte_92	gte_93	gte_94	gte_95	gte_96	gte_97	gte_98	gte_99	gte_100	gte_101	gte_102	gte_103	gte_104	gte_105	gte_106	gte_107	gte_108	gte_109	gte_110	gte_111	gte_112	gte_113	gte_114	gte_115	gte_116	gte_117	gte_118	gte_119	gte_120	gte_121	gte_122	gte_123	gte_124	gte_125	gte_126	gte_127	gte_128	gte_129	gte_130	gte_131	gte_132	gte_133	gte_134	gte_135	gte_136	gte_137	gte_138	gte_139	gte_140	gte_141	gte_142	gte_143	gte_144	gte_145	gte_146	gte_147	gte_148	gte_149	gte_150	gte_151	gte_152	gte_153	gte_154	gte_155	gte_156	gte_157	gte_158	gte_159	gte_160	gte_161	gte_162	gte_163	gte_164	gte_165	gte_166	gte_167	gte_168	gte_169	gte_170	gte_171	gte_172	gte_173	gte_174	gte_175	gte_176	gte_177	gte_178	gte_179	gte_180	gte_181	gte_182	gte_183	gte_184	gte_185	gte_186	gte_187	gte_188	gte_189	gte_190	gte_191	gte_192	gte_193	gte_194	gte_195	gte_196	gte_197	gte_198	gte_199	gte_200	gte_201	gte_202	gte_203	gte_204	gte_205	gte_206	gte_207	gte_208	gte_209	gte_210	gte_211	gte_212	gte_213	gte_214	gte_215	gte_216	gte_217	gte_218	gte_219	gte_220	gte_221	gte_222	gte_223	gte_224	gte_225	gte_226	gte_227	gte_228	gte_229	gte_230	gte_231	gte_232	gte_233	gte_234	gte_235	gte_236	gte_237	gte_238	gte_239	gte_240	gte_241	gte_242	gte_243	gte_244	gte_245	gte_246	gte_247	gte_248	gte_249	gte_250	gte_251	gte_252	gte_253	gte_254	gte_255	gte_256	gte_257	gte_258	gte_259	gte_260	gte_261	gte_262	gte_263	gte_264	gte_265	gte_266	gte_267	gte_268	gte_269	gte_270	gte_271	gte_272	gte_273	gte_274	gte_275	gte_276	gte_277	gte_278	gte_279	gte_280	gte_281	gte_282	gte_283	gte_284	gte_285	gte_286	gte_287	gte_288	gte_289	gte_290	gte_291	gte_292	gte_293	gte_294	gte_295	gte_296	gte_297	gte_298	gte_299	gte_300	gte_301	gte_302	gte_303	gte_304	gte_305	gte_306	gte_307	gte_308	gte_309	gte_310	gte_311	gte_312	gte_313	gte_314	gte_315	gte_316	gte_317	gte_318	gte_319	gte_320	gte_321	gte_322	gte_323	gte_324	gte_325	gte_326	gte_327	gte_328	gte_329	gte_330	gte_331	gte_332	gte_333	gte_334	gte_335	gte_336	gte_337	gte_338	gte_339	gte_340	gte_341	gte_342	gte_343	gte_344	gte_345	gte_346	gte_347	gte_348	gte_349	gte_350	gte_351	gte_352	gte_353	gte_354	gte_355	gte_356	gte_357	gte_358	gte_359	gte_360	gte_361	gte_362	gte_363	gte_364	gte_365	gte_366	gte_367	gte_368	gte_369	gte_370	gte_371	gte_372	gte_373	gte_374	gte_375	gte_376	gte_377	gte_378	gte_379	gte_380	gte_381	gte_382	gte_383	gte_384	gte_385	gte_386	gte_387	gte_388	gte_389	gte_390	gte_391	gte_392	gte_393	gte_394	gte_395	gte_396	gte_397	gte_398	gte_399	gte_400	gte_401	gte_402	gte_403	gte_404	gte_405	gte_406	gte_407	gte_408	gte_409	gte_410	gte_411	gte_412	gte_413	gte_414	gte_415	gte_416	gte_417	gte_418	gte_419	gte_420	gte_421	gte_422	gte_423	gte_424	gte_425	gte_426	gte_427	gte_428	gte_429	gte_430	gte_431	gte_432	gte_433	gte_434	gte_435	gte_436	gte_437	gte_438	gte_439	gte_440	gte_441	gte_442	gte_443	gte_444	gte_445	gte_446	gte_447	gte_448	gte_449	gte_450	gte_451	gte_452	gte_453	gte_454	gte_455	gte_456	gte_457	gte_458	gte_459	gte_460	gte_461	gte_462	gte_463	gte_464	gte_465	gte_466	gte_467	gte_468	gte_469	gte_470	gte_471	gte_472	gte_473	gte_474	gte_475	gte_476	gte_477	gte_478	gte_479	gte_480	gte_481	gte_482	gte_483	gte_484	gte_485	gte_486	gte_487	gte_488	gte_489	gte_490	gte_491	gte_492	gte_493	gte_494	gte_495	gte_496	gte_497	gte_498	gte_499	gte_500
+NSamples_1	5386	43	41	40	38	37	36	34	32	30	29	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,2 @@
+	gte_0	gte_1	gte_2	gte_3	gte_4	gte_5	gte_6	gte_7	gte_8	gte_9	gte_10	gte_11	gte_12	gte_13	gte_14	gte_15	gte_16	gte_17	gte_18	gte_19	gte_20	gte_21	gte_22	gte_23	gte_24	gte_25	gte_26	gte_27	gte_28	gte_29	gte_30	gte_31	gte_32	gte_33	gte_34	gte_35	gte_36	gte_37	gte_38	gte_39	gte_40	gte_41	gte_42	gte_43	gte_44	gte_45	gte_46	gte_47	gte_48	gte_49	gte_50	gte_51	gte_52	gte_53	gte_54	gte_55	gte_56	gte_57	gte_58	gte_59	gte_60	gte_61	gte_62	gte_63	gte_64	gte_65	gte_66	gte_67	gte_68	gte_69	gte_70	gte_71	gte_72	gte_73	gte_74	gte_75	gte_76	gte_77	gte_78	gte_79	gte_80	gte_81	gte_82	gte_83	gte_84	gte_85	gte_86	gte_87	gte_88	gte_89	gte_90	gte_91	gte_92	gte_93	gte_94	gte_95	gte_96	gte_97	gte_98	gte_99	gte_100	gte_101	gte_102	gte_103	gte_104	gte_105	gte_106	gte_107	gte_108	gte_109	gte_110	gte_111	gte_112	gte_113	gte_114	gte_115	gte_116	gte_117	gte_118	gte_119	gte_120	gte_121	gte_122	gte_123	gte_124	gte_125	gte_126	gte_127	gte_128	gte_129	gte_130	gte_131	gte_132	gte_133	gte_134	gte_135	gte_136	gte_137	gte_138	gte_139	gte_140	gte_141	gte_142	gte_143	gte_144	gte_145	gte_146	gte_147	gte_148	gte_149	gte_150	gte_151	gte_152	gte_153	gte_154	gte_155	gte_156	gte_157	gte_158	gte_159	gte_160	gte_161	gte_162	gte_163	gte_164	gte_165	gte_166	gte_167	gte_168	gte_169	gte_170	gte_171	gte_172	gte_173	gte_174	gte_175	gte_176	gte_177	gte_178	gte_179	gte_180	gte_181	gte_182	gte_183	gte_184	gte_185	gte_186	gte_187	gte_188	gte_189	gte_190	gte_191	gte_192	gte_193	gte_194	gte_195	gte_196	gte_197	gte_198	gte_199	gte_200	gte_201	gte_202	gte_203	gte_204	gte_205	gte_206	gte_207	gte_208	gte_209	gte_210	gte_211	gte_212	gte_213	gte_214	gte_215	gte_216	gte_217	gte_218	gte_219	gte_220	gte_221	gte_222	gte_223	gte_224	gte_225	gte_226	gte_227	gte_228	gte_229	gte_230	gte_231	gte_232	gte_233	gte_234	gte_235	gte_236	gte_237	gte_238	gte_239	gte_240	gte_241	gte_242	gte_243	gte_244	gte_245	gte_246	gte_247	gte_248	gte_249	gte_250	gte_251	gte_252	gte_253	gte_254	gte_255	gte_256	gte_257	gte_258	gte_259	gte_260	gte_261	gte_262	gte_263	gte_264	gte_265	gte_266	gte_267	gte_268	gte_269	gte_270	gte_271	gte_272	gte_273	gte_274	gte_275	gte_276	gte_277	gte_278	gte_279	gte_280	gte_281	gte_282	gte_283	gte_284	gte_285	gte_286	gte_287	gte_288	gte_289	gte_290	gte_291	gte_292	gte_293	gte_294	gte_295	gte_296	gte_297	gte_298	gte_299	gte_300	gte_301	gte_302	gte_303	gte_304	gte_305	gte_306	gte_307	gte_308	gte_309	gte_310	gte_311	gte_312	gte_313	gte_314	gte_315	gte_316	gte_317	gte_318	gte_319	gte_320	gte_321	gte_322	gte_323	gte_324	gte_325	gte_326	gte_327	gte_328	gte_329	gte_330	gte_331	gte_332	gte_333	gte_334	gte_335	gte_336	gte_337	gte_338	gte_339	gte_340	gte_341	gte_342	gte_343	gte_344	gte_345	gte_346	gte_347	gte_348	gte_349	gte_350	gte_351	gte_352	gte_353	gte_354	gte_355	gte_356	gte_357	gte_358	gte_359	gte_360	gte_361	gte_362	gte_363	gte_364	gte_365	gte_366	gte_367	gte_368	gte_369	gte_370	gte_371	gte_372	gte_373	gte_374	gte_375	gte_376	gte_377	gte_378	gte_379	gte_380	gte_381	gte_382	gte_383	gte_384	gte_385	gte_386	gte_387	gte_388	gte_389	gte_390	gte_391	gte_392	gte_393	gte_394	gte_395	gte_396	gte_397	gte_398	gte_399	gte_400	gte_401	gte_402	gte_403	gte_404	gte_405	gte_406	gte_407	gte_408	gte_409	gte_410	gte_411	gte_412	gte_413	gte_414	gte_415	gte_416	gte_417	gte_418	gte_419	gte_420	gte_421	gte_422	gte_423	gte_424	gte_425	gte_426	gte_427	gte_428	gte_429	gte_430	gte_431	gte_432	gte_433	gte_434	gte_435	gte_436	gte_437	gte_438	gte_439	gte_440	gte_441	gte_442	gte_443	gte_444	gte_445	gte_446	gte_447	gte_448	gte_449	gte_450	gte_451	gte_452	gte_453	gte_454	gte_455	gte_456	gte_457	gte_458	gte_459	gte_460	gte_461	gte_462	gte_463	gte_464	gte_465	gte_466	gte_467	gte_468	gte_469	gte_470	gte_471	gte_472	gte_473	gte_474	gte_475	gte_476	gte_477	gte_478	gte_479	gte_480	gte_481	gte_482	gte_483	gte_484	gte_485	gte_486	gte_487	gte_488	gte_489	gte_490	gte_491	gte_492	gte_493	gte_494	gte_495	gte_496	gte_497	gte_498	gte_499	gte_500
+A Fake phiX Sample	1.00	0.01	0.01	0.01	0.01	0.01	0.01	0.01	0.01	0.01	0.01	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,5387 @@
+Locus	Total_Depth	Average_Depth_sample	Depth_for_A Fake phiX Sample
+phiX174:1	0	0.00	0
+phiX174:2	0	0.00	0
+phiX174:3	0	0.00	0
+phiX174:4	0	0.00	0
+phiX174:5	0	0.00	0
+phiX174:6	0	0.00	0
+phiX174:7	0	0.00	0
+phiX174:8	0	0.00	0
+phiX174:9	0	0.00	0
+phiX174:10	0	0.00	0
+phiX174:11	0	0.00	0
+phiX174:12	0	0.00	0
+phiX174:13	0	0.00	0
+phiX174:14	0	0.00	0
+phiX174:15	0	0.00	0
+phiX174:16	0	0.00	0
+phiX174:17	0	0.00	0
+phiX174:18	0	0.00	0
+phiX174:19	0	0.00	0
+phiX174:20	0	0.00	0
+phiX174:21	0	0.00	0
+phiX174:22	0	0.00	0
+phiX174:23	0	0.00	0
+phiX174:24	0	0.00	0
+phiX174:25	0	0.00	0
+phiX174:26	0	0.00	0
+phiX174:27	0	0.00	0
+phiX174:28	0	0.00	0
+phiX174:29	0	0.00	0
+phiX174:30	0	0.00	0
+phiX174:31	0	0.00	0
+phiX174:32	0	0.00	0
+phiX174:33	0	0.00	0
+phiX174:34	0	0.00	0
+phiX174:35	0	0.00	0
+phiX174:36	0	0.00	0
+phiX174:37	0	0.00	0
+phiX174:38	0	0.00	0
+phiX174:39	0	0.00	0
+phiX174:40	0	0.00	0
+phiX174:41	0	0.00	0
+phiX174:42	0	0.00	0
+phiX174:43	0	0.00	0
+phiX174:44	0	0.00	0
+phiX174:45	0	0.00	0
+phiX174:46	0	0.00	0
+phiX174:47	0	0.00	0
+phiX174:48	0	0.00	0
+phiX174:49	0	0.00	0
+phiX174:50	0	0.00	0
+phiX174:51	0	0.00	0
+phiX174:52	0	0.00	0
+phiX174:53	0	0.00	0
+phiX174:54	0	0.00	0
+phiX174:55	0	0.00	0
+phiX174:56	0	0.00	0
+phiX174:57	0	0.00	0
+phiX174:58	0	0.00	0
+phiX174:59	0	0.00	0
+phiX174:60	0	0.00	0
+phiX174:61	0	0.00	0
+phiX174:62	0	0.00	0
+phiX174:63	0	0.00	0
+phiX174:64	0	0.00	0
+phiX174:65	0	0.00	0
+phiX174:66	0	0.00	0
+phiX174:67	0	0.00	0
+phiX174:68	0	0.00	0
+phiX174:69	0	0.00	0
+phiX174:70	0	0.00	0
+phiX174:71	0	0.00	0
+phiX174:72	0	0.00	0
+phiX174:73	0	0.00	0
+phiX174:74	0	0.00	0
+phiX174:75	0	0.00	0
+phiX174:76	0	0.00	0
+phiX174:77	0	0.00	0
+phiX174:78	0	0.00	0
+phiX174:79	0	0.00	0
+phiX174:80	0	0.00	0
+phiX174:81	0	0.00	0
+phiX174:82	0	0.00	0
+phiX174:83	0	0.00	0
+phiX174:84	0	0.00	0
+phiX174:85	0	0.00	0
+phiX174:86	0	0.00	0
+phiX174:87	0	0.00	0
+phiX174:88	0	0.00	0
+phiX174:89	0	0.00	0
+phiX174:90	0	0.00	0
+phiX174:91	0	0.00	0
+phiX174:92	0	0.00	0
+phiX174:93	0	0.00	0
+phiX174:94	0	0.00	0
+phiX174:95	0	0.00	0
+phiX174:96	0	0.00	0
+phiX174:97	0	0.00	0
+phiX174:98	0	0.00	0
+phiX174:99	0	0.00	0
+phiX174:100	0	0.00	0
+phiX174:101	0	0.00	0
+phiX174:102	0	0.00	0
+phiX174:103	0	0.00	0
+phiX174:104	0	0.00	0
+phiX174:105	0	0.00	0
+phiX174:106	0	0.00	0
+phiX174:107	0	0.00	0
+phiX174:108	0	0.00	0
+phiX174:109	0	0.00	0
+phiX174:110	0	0.00	0
+phiX174:111	0	0.00	0
+phiX174:112	0	0.00	0
+phiX174:113	0	0.00	0
+phiX174:114	0	0.00	0
+phiX174:115	0	0.00	0
+phiX174:116	0	0.00	0
+phiX174:117	0	0.00	0
+phiX174:118	0	0.00	0
+phiX174:119	0	0.00	0
+phiX174:120	0	0.00	0
+phiX174:121	0	0.00	0
+phiX174:122	0	0.00	0
+phiX174:123	0	0.00	0
+phiX174:124	0	0.00	0
+phiX174:125	0	0.00	0
+phiX174:126	0	0.00	0
+phiX174:127	0	0.00	0
+phiX174:128	0	0.00	0
+phiX174:129	0	0.00	0
+phiX174:130	0	0.00	0
+phiX174:131	0	0.00	0
+phiX174:132	0	0.00	0
+phiX174:133	0	0.00	0
+phiX174:134	0	0.00	0
+phiX174:135	0	0.00	0
+phiX174:136	0	0.00	0
+phiX174:137	0	0.00	0
+phiX174:138	0	0.00	0
+phiX174:139	0	0.00	0
+phiX174:140	0	0.00	0
+phiX174:141	0	0.00	0
+phiX174:142	0	0.00	0
+phiX174:143	0	0.00	0
+phiX174:144	0	0.00	0
+phiX174:145	0	0.00	0
+phiX174:146	0	0.00	0
+phiX174:147	0	0.00	0
+phiX174:148	0	0.00	0
+phiX174:149	0	0.00	0
+phiX174:150	0	0.00	0
+phiX174:151	0	0.00	0
+phiX174:152	0	0.00	0
+phiX174:153	0	0.00	0
+phiX174:154	0	0.00	0
+phiX174:155	0	0.00	0
+phiX174:156	0	0.00	0
+phiX174:157	0	0.00	0
+phiX174:158	0	0.00	0
+phiX174:159	0	0.00	0
+phiX174:160	0	0.00	0
+phiX174:161	0	0.00	0
+phiX174:162	0	0.00	0
+phiX174:163	0	0.00	0
+phiX174:164	0	0.00	0
+phiX174:165	0	0.00	0
+phiX174:166	0	0.00	0
+phiX174:167	0	0.00	0
+phiX174:168	0	0.00	0
+phiX174:169	0	0.00	0
+phiX174:170	0	0.00	0
+phiX174:171	0	0.00	0
+phiX174:172	0	0.00	0
+phiX174:173	0	0.00	0
+phiX174:174	0	0.00	0
+phiX174:175	0	0.00	0
+phiX174:176	0	0.00	0
+phiX174:177	0	0.00	0
+phiX174:178	0	0.00	0
+phiX174:179	0	0.00	0
+phiX174:180	0	0.00	0
+phiX174:181	0	0.00	0
+phiX174:182	0	0.00	0
+phiX174:183	0	0.00	0
+phiX174:184	0	0.00	0
+phiX174:185	0	0.00	0
+phiX174:186	0	0.00	0
+phiX174:187	0	0.00	0
+phiX174:188	0	0.00	0
+phiX174:189	0	0.00	0
+phiX174:190	0	0.00	0
+phiX174:191	0	0.00	0
+phiX174:192	0	0.00	0
+phiX174:193	0	0.00	0
+phiX174:194	0	0.00	0
+phiX174:195	0	0.00	0
+phiX174:196	0	0.00	0
+phiX174:197	0	0.00	0
+phiX174:198	0	0.00	0
+phiX174:199	0	0.00	0
+phiX174:200	0	0.00	0
+phiX174:201	0	0.00	0
+phiX174:202	0	0.00	0
+phiX174:203	0	0.00	0
+phiX174:204	0	0.00	0
+phiX174:205	0	0.00	0
+phiX174:206	0	0.00	0
+phiX174:207	0	0.00	0
+phiX174:208	0	0.00	0
+phiX174:209	0	0.00	0
+phiX174:210	0	0.00	0
+phiX174:211	0	0.00	0
+phiX174:212	0	0.00	0
+phiX174:213	0	0.00	0
+phiX174:214	0	0.00	0
+phiX174:215	0	0.00	0
+phiX174:216	0	0.00	0
+phiX174:217	0	0.00	0
+phiX174:218	0	0.00	0
+phiX174:219	0	0.00	0
+phiX174:220	0	0.00	0
+phiX174:221	0	0.00	0
+phiX174:222	0	0.00	0
+phiX174:223	0	0.00	0
+phiX174:224	0	0.00	0
+phiX174:225	0	0.00	0
+phiX174:226	0	0.00	0
+phiX174:227	0	0.00	0
+phiX174:228	0	0.00	0
+phiX174:229	0	0.00	0
+phiX174:230	0	0.00	0
+phiX174:231	0	0.00	0
+phiX174:232	0	0.00	0
+phiX174:233	0	0.00	0
+phiX174:234	0	0.00	0
+phiX174:235	0	0.00	0
+phiX174:236	0	0.00	0
+phiX174:237	0	0.00	0
+phiX174:238	0	0.00	0
+phiX174:239	0	0.00	0
+phiX174:240	0	0.00	0
+phiX174:241	0	0.00	0
+phiX174:242	0	0.00	0
+phiX174:243	0	0.00	0
+phiX174:244	0	0.00	0
+phiX174:245	0	0.00	0
+phiX174:246	0	0.00	0
+phiX174:247	0	0.00	0
+phiX174:248	0	0.00	0
+phiX174:249	0	0.00	0
+phiX174:250	0	0.00	0
+phiX174:251	0	0.00	0
+phiX174:252	0	0.00	0
+phiX174:253	0	0.00	0
+phiX174:254	0	0.00	0
+phiX174:255	0	0.00	0
+phiX174:256	0	0.00	0
+phiX174:257	0	0.00	0
+phiX174:258	0	0.00	0
+phiX174:259	0	0.00	0
+phiX174:260	0	0.00	0
+phiX174:261	0	0.00	0
+phiX174:262	0	0.00	0
+phiX174:263	0	0.00	0
+phiX174:264	0	0.00	0
+phiX174:265	0	0.00	0
+phiX174:266	0	0.00	0
+phiX174:267	0	0.00	0
+phiX174:268	0	0.00	0
+phiX174:269	0	0.00	0
+phiX174:270	0	0.00	0
+phiX174:271	0	0.00	0
+phiX174:272	0	0.00	0
+phiX174:273	0	0.00	0
+phiX174:274	0	0.00	0
+phiX174:275	0	0.00	0
+phiX174:276	0	0.00	0
+phiX174:277	0	0.00	0
+phiX174:278	0	0.00	0
+phiX174:279	0	0.00	0
+phiX174:280	0	0.00	0
+phiX174:281	0	0.00	0
+phiX174:282	0	0.00	0
+phiX174:283	0	0.00	0
+phiX174:284	0	0.00	0
+phiX174:285	0	0.00	0
+phiX174:286	0	0.00	0
+phiX174:287	0	0.00	0
+phiX174:288	0	0.00	0
+phiX174:289	0	0.00	0
+phiX174:290	0	0.00	0
+phiX174:291	0	0.00	0
+phiX174:292	0	0.00	0
+phiX174:293	0	0.00	0
+phiX174:294	0	0.00	0
+phiX174:295	0	0.00	0
+phiX174:296	0	0.00	0
+phiX174:297	0	0.00	0
+phiX174:298	0	0.00	0
+phiX174:299	0	0.00	0
+phiX174:300	0	0.00	0
+phiX174:301	0	0.00	0
+phiX174:302	0	0.00	0
+phiX174:303	0	0.00	0
+phiX174:304	0	0.00	0
+phiX174:305	0	0.00	0
+phiX174:306	0	0.00	0
+phiX174:307	0	0.00	0
+phiX174:308	0	0.00	0
+phiX174:309	0	0.00	0
+phiX174:310	0	0.00	0
+phiX174:311	0	0.00	0
+phiX174:312	0	0.00	0
+phiX174:313	0	0.00	0
+phiX174:314	0	0.00	0
+phiX174:315	0	0.00	0
+phiX174:316	0	0.00	0
+phiX174:317	0	0.00	0
+phiX174:318	0	0.00	0
+phiX174:319	0	0.00	0
+phiX174:320	0	0.00	0
+phiX174:321	0	0.00	0
+phiX174:322	0	0.00	0
+phiX174:323	0	0.00	0
+phiX174:324	0	0.00	0
+phiX174:325	0	0.00	0
+phiX174:326	0	0.00	0
+phiX174:327	0	0.00	0
+phiX174:328	0	0.00	0
+phiX174:329	0	0.00	0
+phiX174:330	0	0.00	0
+phiX174:331	0	0.00	0
+phiX174:332	0	0.00	0
+phiX174:333	0	0.00	0
+phiX174:334	0	0.00	0
+phiX174:335	0	0.00	0
+phiX174:336	0	0.00	0
+phiX174:337	0	0.00	0
+phiX174:338	0	0.00	0
+phiX174:339	0	0.00	0
+phiX174:340	0	0.00	0
+phiX174:341	0	0.00	0
+phiX174:342	0	0.00	0
+phiX174:343	0	0.00	0
+phiX174:344	0	0.00	0
+phiX174:345	0	0.00	0
+phiX174:346	0	0.00	0
+phiX174:347	0	0.00	0
+phiX174:348	0	0.00	0
+phiX174:349	0	0.00	0
+phiX174:350	0	0.00	0
+phiX174:351	0	0.00	0
+phiX174:352	0	0.00	0
+phiX174:353	0	0.00	0
+phiX174:354	0	0.00	0
+phiX174:355	0	0.00	0
+phiX174:356	0	0.00	0
+phiX174:357	0	0.00	0
+phiX174:358	0	0.00	0
+phiX174:359	0	0.00	0
+phiX174:360	0	0.00	0
+phiX174:361	0	0.00	0
+phiX174:362	0	0.00	0
+phiX174:363	0	0.00	0
+phiX174:364	0	0.00	0
+phiX174:365	0	0.00	0
+phiX174:366	0	0.00	0
+phiX174:367	0	0.00	0
+phiX174:368	0	0.00	0
+phiX174:369	0	0.00	0
+phiX174:370	0	0.00	0
+phiX174:371	0	0.00	0
+phiX174:372	0	0.00	0
+phiX174:373	0	0.00	0
+phiX174:374	0	0.00	0
+phiX174:375	0	0.00	0
+phiX174:376	0	0.00	0
+phiX174:377	0	0.00	0
+phiX174:378	0	0.00	0
+phiX174:379	0	0.00	0
+phiX174:380	0	0.00	0
+phiX174:381	0	0.00	0
+phiX174:382	0	0.00	0
+phiX174:383	0	0.00	0
+phiX174:384	0	0.00	0
+phiX174:385	0	0.00	0
+phiX174:386	0	0.00	0
+phiX174:387	0	0.00	0
+phiX174:388	0	0.00	0
+phiX174:389	0	0.00	0
+phiX174:390	0	0.00	0
+phiX174:391	0	0.00	0
+phiX174:392	0	0.00	0
+phiX174:393	0	0.00	0
+phiX174:394	0	0.00	0
+phiX174:395	0	0.00	0
+phiX174:396	0	0.00	0
+phiX174:397	0	0.00	0
+phiX174:398	0	0.00	0
+phiX174:399	0	0.00	0
+phiX174:400	0	0.00	0
+phiX174:401	0	0.00	0
+phiX174:402	0	0.00	0
+phiX174:403	0	0.00	0
+phiX174:404	0	0.00	0
+phiX174:405	0	0.00	0
+phiX174:406	0	0.00	0
+phiX174:407	0	0.00	0
+phiX174:408	0	0.00	0
+phiX174:409	0	0.00	0
+phiX174:410	0	0.00	0
+phiX174:411	0	0.00	0
+phiX174:412	0	0.00	0
+phiX174:413	0	0.00	0
+phiX174:414	0	0.00	0
+phiX174:415	0	0.00	0
+phiX174:416	0	0.00	0
+phiX174:417	0	0.00	0
+phiX174:418	0	0.00	0
+phiX174:419	0	0.00	0
+phiX174:420	0	0.00	0
+phiX174:421	0	0.00	0
+phiX174:422	0	0.00	0
+phiX174:423	0	0.00	0
+phiX174:424	0	0.00	0
+phiX174:425	0	0.00	0
+phiX174:426	0	0.00	0
+phiX174:427	0	0.00	0
+phiX174:428	0	0.00	0
+phiX174:429	0	0.00	0
+phiX174:430	0	0.00	0
+phiX174:431	0	0.00	0
+phiX174:432	0	0.00	0
+phiX174:433	0	0.00	0
+phiX174:434	0	0.00	0
+phiX174:435	0	0.00	0
+phiX174:436	0	0.00	0
+phiX174:437	0	0.00	0
+phiX174:438	0	0.00	0
+phiX174:439	0	0.00	0
+phiX174:440	0	0.00	0
+phiX174:441	0	0.00	0
+phiX174:442	0	0.00	0
+phiX174:443	0	0.00	0
+phiX174:444	0	0.00	0
+phiX174:445	0	0.00	0
+phiX174:446	0	0.00	0
+phiX174:447	0	0.00	0
+phiX174:448	0	0.00	0
+phiX174:449	0	0.00	0
+phiX174:450	0	0.00	0
+phiX174:451	0	0.00	0
+phiX174:452	0	0.00	0
+phiX174:453	0	0.00	0
+phiX174:454	0	0.00	0
+phiX174:455	0	0.00	0
+phiX174:456	0	0.00	0
+phiX174:457	0	0.00	0
+phiX174:458	0	0.00	0
+phiX174:459	0	0.00	0
+phiX174:460	0	0.00	0
+phiX174:461	0	0.00	0
+phiX174:462	0	0.00	0
+phiX174:463	0	0.00	0
+phiX174:464	0	0.00	0
+phiX174:465	0	0.00	0
+phiX174:466	0	0.00	0
+phiX174:467	0	0.00	0
+phiX174:468	0	0.00	0
+phiX174:469	0	0.00	0
+phiX174:470	0	0.00	0
+phiX174:471	0	0.00	0
+phiX174:472	0	0.00	0
+phiX174:473	0	0.00	0
+phiX174:474	0	0.00	0
+phiX174:475	0	0.00	0
+phiX174:476	0	0.00	0
+phiX174:477	0	0.00	0
+phiX174:478	0	0.00	0
+phiX174:479	0	0.00	0
+phiX174:480	0	0.00	0
+phiX174:481	0	0.00	0
+phiX174:482	0	0.00	0
+phiX174:483	0	0.00	0
+phiX174:484	0	0.00	0
+phiX174:485	0	0.00	0
+phiX174:486	0	0.00	0
+phiX174:487	0	0.00	0
+phiX174:488	0	0.00	0
+phiX174:489	0	0.00	0
+phiX174:490	0	0.00	0
+phiX174:491	0	0.00	0
+phiX174:492	0	0.00	0
+phiX174:493	0	0.00	0
+phiX174:494	0	0.00	0
+phiX174:495	0	0.00	0
+phiX174:496	0	0.00	0
+phiX174:497	0	0.00	0
+phiX174:498	0	0.00	0
+phiX174:499	0	0.00	0
+phiX174:500	0	0.00	0
+phiX174:501	0	0.00	0
+phiX174:502	0	0.00	0
+phiX174:503	0	0.00	0
+phiX174:504	0	0.00	0
+phiX174:505	0	0.00	0
+phiX174:506	0	0.00	0
+phiX174:507	0	0.00	0
+phiX174:508	0	0.00	0
+phiX174:509	0	0.00	0
+phiX174:510	0	0.00	0
+phiX174:511	0	0.00	0
+phiX174:512	0	0.00	0
+phiX174:513	0	0.00	0
+phiX174:514	0	0.00	0
+phiX174:515	0	0.00	0
+phiX174:516	0	0.00	0
+phiX174:517	0	0.00	0
+phiX174:518	0	0.00	0
+phiX174:519	0	0.00	0
+phiX174:520	0	0.00	0
+phiX174:521	0	0.00	0
+phiX174:522	0	0.00	0
+phiX174:523	0	0.00	0
+phiX174:524	0	0.00	0
+phiX174:525	0	0.00	0
+phiX174:526	0	0.00	0
+phiX174:527	0	0.00	0
+phiX174:528	0	0.00	0
+phiX174:529	0	0.00	0
+phiX174:530	0	0.00	0
+phiX174:531	0	0.00	0
+phiX174:532	0	0.00	0
+phiX174:533	0	0.00	0
+phiX174:534	0	0.00	0
+phiX174:535	0	0.00	0
+phiX174:536	0	0.00	0
+phiX174:537	0	0.00	0
+phiX174:538	0	0.00	0
+phiX174:539	0	0.00	0
+phiX174:540	0	0.00	0
+phiX174:541	0	0.00	0
+phiX174:542	0	0.00	0
+phiX174:543	0	0.00	0
+phiX174:544	0	0.00	0
+phiX174:545	0	0.00	0
+phiX174:546	0	0.00	0
+phiX174:547	0	0.00	0
+phiX174:548	0	0.00	0
+phiX174:549	0	0.00	0
+phiX174:550	0	0.00	0
+phiX174:551	0	0.00	0
+phiX174:552	0	0.00	0
+phiX174:553	0	0.00	0
+phiX174:554	0	0.00	0
+phiX174:555	0	0.00	0
+phiX174:556	0	0.00	0
+phiX174:557	0	0.00	0
+phiX174:558	0	0.00	0
+phiX174:559	0	0.00	0
+phiX174:560	0	0.00	0
+phiX174:561	0	0.00	0
+phiX174:562	0	0.00	0
+phiX174:563	0	0.00	0
+phiX174:564	0	0.00	0
+phiX174:565	0	0.00	0
+phiX174:566	0	0.00	0
+phiX174:567	0	0.00	0
+phiX174:568	0	0.00	0
+phiX174:569	0	0.00	0
+phiX174:570	0	0.00	0
+phiX174:571	0	0.00	0
+phiX174:572	0	0.00	0
+phiX174:573	0	0.00	0
+phiX174:574	0	0.00	0
+phiX174:575	0	0.00	0
+phiX174:576	0	0.00	0
+phiX174:577	0	0.00	0
+phiX174:578	0	0.00	0
+phiX174:579	0	0.00	0
+phiX174:580	0	0.00	0
+phiX174:581	0	0.00	0
+phiX174:582	0	0.00	0
+phiX174:583	0	0.00	0
+phiX174:584	0	0.00	0
+phiX174:585	0	0.00	0
+phiX174:586	0	0.00	0
+phiX174:587	0	0.00	0
+phiX174:588	0	0.00	0
+phiX174:589	0	0.00	0
+phiX174:590	0	0.00	0
+phiX174:591	0	0.00	0
+phiX174:592	0	0.00	0
+phiX174:593	0	0.00	0
+phiX174:594	0	0.00	0
+phiX174:595	0	0.00	0
+phiX174:596	0	0.00	0
+phiX174:597	0	0.00	0
+phiX174:598	0	0.00	0
+phiX174:599	0	0.00	0
+phiX174:600	0	0.00	0
+phiX174:601	0	0.00	0
+phiX174:602	0	0.00	0
+phiX174:603	0	0.00	0
+phiX174:604	0	0.00	0
+phiX174:605	0	0.00	0
+phiX174:606	0	0.00	0
+phiX174:607	0	0.00	0
+phiX174:608	0	0.00	0
+phiX174:609	0	0.00	0
+phiX174:610	0	0.00	0
+phiX174:611	0	0.00	0
+phiX174:612	0	0.00	0
+phiX174:613	0	0.00	0
+phiX174:614	0	0.00	0
+phiX174:615	0	0.00	0
+phiX174:616	0	0.00	0
+phiX174:617	0	0.00	0
+phiX174:618	0	0.00	0
+phiX174:619	0	0.00	0
+phiX174:620	0	0.00	0
+phiX174:621	0	0.00	0
+phiX174:622	0	0.00	0
+phiX174:623	0	0.00	0
+phiX174:624	0	0.00	0
+phiX174:625	0	0.00	0
+phiX174:626	0	0.00	0
+phiX174:627	0	0.00	0
+phiX174:628	0	0.00	0
+phiX174:629	0	0.00	0
+phiX174:630	0	0.00	0
+phiX174:631	0	0.00	0
+phiX174:632	0	0.00	0
+phiX174:633	0	0.00	0
+phiX174:634	0	0.00	0
+phiX174:635	0	0.00	0
+phiX174:636	0	0.00	0
+phiX174:637	0	0.00	0
+phiX174:638	0	0.00	0
+phiX174:639	0	0.00	0
+phiX174:640	0	0.00	0
+phiX174:641	0	0.00	0
+phiX174:642	0	0.00	0
+phiX174:643	0	0.00	0
+phiX174:644	0	0.00	0
+phiX174:645	0	0.00	0
+phiX174:646	0	0.00	0
+phiX174:647	0	0.00	0
+phiX174:648	0	0.00	0
+phiX174:649	0	0.00	0
+phiX174:650	0	0.00	0
+phiX174:651	0	0.00	0
+phiX174:652	0	0.00	0
+phiX174:653	0	0.00	0
+phiX174:654	0	0.00	0
+phiX174:655	0	0.00	0
+phiX174:656	0	0.00	0
+phiX174:657	0	0.00	0
+phiX174:658	0	0.00	0
+phiX174:659	0	0.00	0
+phiX174:660	0	0.00	0
+phiX174:661	0	0.00	0
+phiX174:662	0	0.00	0
+phiX174:663	0	0.00	0
+phiX174:664	0	0.00	0
+phiX174:665	0	0.00	0
+phiX174:666	0	0.00	0
+phiX174:667	0	0.00	0
+phiX174:668	0	0.00	0
+phiX174:669	0	0.00	0
+phiX174:670	0	0.00	0
+phiX174:671	0	0.00	0
+phiX174:672	0	0.00	0
+phiX174:673	0	0.00	0
+phiX174:674	0	0.00	0
+phiX174:675	0	0.00	0
+phiX174:676	0	0.00	0
+phiX174:677	0	0.00	0
+phiX174:678	0	0.00	0
+phiX174:679	0	0.00	0
+phiX174:680	0	0.00	0
+phiX174:681	0	0.00	0
+phiX174:682	0	0.00	0
+phiX174:683	0	0.00	0
+phiX174:684	0	0.00	0
+phiX174:685	0	0.00	0
+phiX174:686	0	0.00	0
+phiX174:687	0	0.00	0
+phiX174:688	0	0.00	0
+phiX174:689	0	0.00	0
+phiX174:690	0	0.00	0
+phiX174:691	0	0.00	0
+phiX174:692	0	0.00	0
+phiX174:693	0	0.00	0
+phiX174:694	0	0.00	0
+phiX174:695	0	0.00	0
+phiX174:696	0	0.00	0
+phiX174:697	0	0.00	0
+phiX174:698	0	0.00	0
+phiX174:699	0	0.00	0
+phiX174:700	0	0.00	0
+phiX174:701	0	0.00	0
+phiX174:702	0	0.00	0
+phiX174:703	0	0.00	0
+phiX174:704	0	0.00	0
+phiX174:705	0	0.00	0
+phiX174:706	0	0.00	0
+phiX174:707	0	0.00	0
+phiX174:708	0	0.00	0
+phiX174:709	0	0.00	0
+phiX174:710	0	0.00	0
+phiX174:711	0	0.00	0
+phiX174:712	0	0.00	0
+phiX174:713	0	0.00	0
+phiX174:714	0	0.00	0
+phiX174:715	0	0.00	0
+phiX174:716	0	0.00	0
+phiX174:717	0	0.00	0
+phiX174:718	0	0.00	0
+phiX174:719	0	0.00	0
+phiX174:720	0	0.00	0
+phiX174:721	0	0.00	0
+phiX174:722	0	0.00	0
+phiX174:723	0	0.00	0
+phiX174:724	0	0.00	0
+phiX174:725	0	0.00	0
+phiX174:726	0	0.00	0
+phiX174:727	0	0.00	0
+phiX174:728	0	0.00	0
+phiX174:729	0	0.00	0
+phiX174:730	0	0.00	0
+phiX174:731	0	0.00	0
+phiX174:732	0	0.00	0
+phiX174:733	0	0.00	0
+phiX174:734	0	0.00	0
+phiX174:735	0	0.00	0
+phiX174:736	0	0.00	0
+phiX174:737	0	0.00	0
+phiX174:738	0	0.00	0
+phiX174:739	0	0.00	0
+phiX174:740	0	0.00	0
+phiX174:741	0	0.00	0
+phiX174:742	0	0.00	0
+phiX174:743	0	0.00	0
+phiX174:744	0	0.00	0
+phiX174:745	0	0.00	0
+phiX174:746	0	0.00	0
+phiX174:747	0	0.00	0
+phiX174:748	0	0.00	0
+phiX174:749	0	0.00	0
+phiX174:750	0	0.00	0
+phiX174:751	0	0.00	0
+phiX174:752	0	0.00	0
+phiX174:753	0	0.00	0
+phiX174:754	0	0.00	0
+phiX174:755	0	0.00	0
+phiX174:756	0	0.00	0
+phiX174:757	0	0.00	0
+phiX174:758	0	0.00	0
+phiX174:759	0	0.00	0
+phiX174:760	0	0.00	0
+phiX174:761	0	0.00	0
+phiX174:762	0	0.00	0
+phiX174:763	0	0.00	0
+phiX174:764	0	0.00	0
+phiX174:765	0	0.00	0
+phiX174:766	0	0.00	0
+phiX174:767	0	0.00	0
+phiX174:768	0	0.00	0
+phiX174:769	0	0.00	0
+phiX174:770	0	0.00	0
+phiX174:771	0	0.00	0
+phiX174:772	0	0.00	0
+phiX174:773	0	0.00	0
+phiX174:774	0	0.00	0
+phiX174:775	0	0.00	0
+phiX174:776	0	0.00	0
+phiX174:777	0	0.00	0
+phiX174:778	0	0.00	0
+phiX174:779	0	0.00	0
+phiX174:780	0	0.00	0
+phiX174:781	0	0.00	0
+phiX174:782	0	0.00	0
+phiX174:783	0	0.00	0
+phiX174:784	0	0.00	0
+phiX174:785	0	0.00	0
+phiX174:786	0	0.00	0
+phiX174:787	0	0.00	0
+phiX174:788	0	0.00	0
+phiX174:789	0	0.00	0
+phiX174:790	0	0.00	0
+phiX174:791	0	0.00	0
+phiX174:792	0	0.00	0
+phiX174:793	0	0.00	0
+phiX174:794	0	0.00	0
+phiX174:795	0	0.00	0
+phiX174:796	0	0.00	0
+phiX174:797	0	0.00	0
+phiX174:798	0	0.00	0
+phiX174:799	0	0.00	0
+phiX174:800	0	0.00	0
+phiX174:801	0	0.00	0
+phiX174:802	0	0.00	0
+phiX174:803	0	0.00	0
+phiX174:804	0	0.00	0
+phiX174:805	0	0.00	0
+phiX174:806	0	0.00	0
+phiX174:807	0	0.00	0
+phiX174:808	0	0.00	0
+phiX174:809	0	0.00	0
+phiX174:810	0	0.00	0
+phiX174:811	0	0.00	0
+phiX174:812	0	0.00	0
+phiX174:813	0	0.00	0
+phiX174:814	0	0.00	0
+phiX174:815	0	0.00	0
+phiX174:816	0	0.00	0
+phiX174:817	0	0.00	0
+phiX174:818	0	0.00	0
+phiX174:819	0	0.00	0
+phiX174:820	0	0.00	0
+phiX174:821	0	0.00	0
+phiX174:822	0	0.00	0
+phiX174:823	0	0.00	0
+phiX174:824	0	0.00	0
+phiX174:825	0	0.00	0
+phiX174:826	0	0.00	0
+phiX174:827	0	0.00	0
+phiX174:828	0	0.00	0
+phiX174:829	0	0.00	0
+phiX174:830	0	0.00	0
+phiX174:831	0	0.00	0
+phiX174:832	0	0.00	0
+phiX174:833	0	0.00	0
+phiX174:834	0	0.00	0
+phiX174:835	0	0.00	0
+phiX174:836	0	0.00	0
+phiX174:837	0	0.00	0
+phiX174:838	0	0.00	0
+phiX174:839	0	0.00	0
+phiX174:840	0	0.00	0
+phiX174:841	0	0.00	0
+phiX174:842	0	0.00	0
+phiX174:843	0	0.00	0
+phiX174:844	0	0.00	0
+phiX174:845	0	0.00	0
+phiX174:846	0	0.00	0
+phiX174:847	0	0.00	0
+phiX174:848	0	0.00	0
+phiX174:849	0	0.00	0
+phiX174:850	0	0.00	0
+phiX174:851	0	0.00	0
+phiX174:852	0	0.00	0
+phiX174:853	0	0.00	0
+phiX174:854	0	0.00	0
+phiX174:855	0	0.00	0
+phiX174:856	0	0.00	0
+phiX174:857	0	0.00	0
+phiX174:858	0	0.00	0
+phiX174:859	0	0.00	0
+phiX174:860	0	0.00	0
+phiX174:861	0	0.00	0
+phiX174:862	0	0.00	0
+phiX174:863	0	0.00	0
+phiX174:864	0	0.00	0
+phiX174:865	0	0.00	0
+phiX174:866	0	0.00	0
+phiX174:867	0	0.00	0
+phiX174:868	0	0.00	0
+phiX174:869	0	0.00	0
+phiX174:870	0	0.00	0
+phiX174:871	0	0.00	0
+phiX174:872	0	0.00	0
+phiX174:873	0	0.00	0
+phiX174:874	0	0.00	0
+phiX174:875	0	0.00	0
+phiX174:876	0	0.00	0
+phiX174:877	0	0.00	0
+phiX174:878	0	0.00	0
+phiX174:879	0	0.00	0
+phiX174:880	0	0.00	0
+phiX174:881	0	0.00	0
+phiX174:882	0	0.00	0
+phiX174:883	0	0.00	0
+phiX174:884	0	0.00	0
+phiX174:885	0	0.00	0
+phiX174:886	0	0.00	0
+phiX174:887	0	0.00	0
+phiX174:888	0	0.00	0
+phiX174:889	0	0.00	0
+phiX174:890	0	0.00	0
+phiX174:891	0	0.00	0
+phiX174:892	0	0.00	0
+phiX174:893	0	0.00	0
+phiX174:894	0	0.00	0
+phiX174:895	0	0.00	0
+phiX174:896	0	0.00	0
+phiX174:897	0	0.00	0
+phiX174:898	0	0.00	0
+phiX174:899	0	0.00	0
+phiX174:900	0	0.00	0
+phiX174:901	0	0.00	0
+phiX174:902	0	0.00	0
+phiX174:903	0	0.00	0
+phiX174:904	0	0.00	0
+phiX174:905	0	0.00	0
+phiX174:906	0	0.00	0
+phiX174:907	0	0.00	0
+phiX174:908	0	0.00	0
+phiX174:909	0	0.00	0
+phiX174:910	0	0.00	0
+phiX174:911	0	0.00	0
+phiX174:912	0	0.00	0
+phiX174:913	0	0.00	0
+phiX174:914	0	0.00	0
+phiX174:915	0	0.00	0
+phiX174:916	0	0.00	0
+phiX174:917	0	0.00	0
+phiX174:918	0	0.00	0
+phiX174:919	0	0.00	0
+phiX174:920	0	0.00	0
+phiX174:921	0	0.00	0
+phiX174:922	0	0.00	0
+phiX174:923	0	0.00	0
+phiX174:924	0	0.00	0
+phiX174:925	0	0.00	0
+phiX174:926	0	0.00	0
+phiX174:927	0	0.00	0
+phiX174:928	0	0.00	0
+phiX174:929	0	0.00	0
+phiX174:930	0	0.00	0
+phiX174:931	0	0.00	0
+phiX174:932	0	0.00	0
+phiX174:933	0	0.00	0
+phiX174:934	0	0.00	0
+phiX174:935	0	0.00	0
+phiX174:936	0	0.00	0
+phiX174:937	0	0.00	0
+phiX174:938	0	0.00	0
+phiX174:939	0	0.00	0
+phiX174:940	0	0.00	0
+phiX174:941	0	0.00	0
+phiX174:942	0	0.00	0
+phiX174:943	0	0.00	0
+phiX174:944	0	0.00	0
+phiX174:945	0	0.00	0
+phiX174:946	0	0.00	0
+phiX174:947	0	0.00	0
+phiX174:948	0	0.00	0
+phiX174:949	0	0.00	0
+phiX174:950	0	0.00	0
+phiX174:951	0	0.00	0
+phiX174:952	0	0.00	0
+phiX174:953	0	0.00	0
+phiX174:954	0	0.00	0
+phiX174:955	0	0.00	0
+phiX174:956	0	0.00	0
+phiX174:957	0	0.00	0
+phiX174:958	0	0.00	0
+phiX174:959	0	0.00	0
+phiX174:960	0	0.00	0
+phiX174:961	0	0.00	0
+phiX174:962	0	0.00	0
+phiX174:963	0	0.00	0
+phiX174:964	0	0.00	0
+phiX174:965	0	0.00	0
+phiX174:966	0	0.00	0
+phiX174:967	0	0.00	0
+phiX174:968	0	0.00	0
+phiX174:969	0	0.00	0
+phiX174:970	0	0.00	0
+phiX174:971	0	0.00	0
+phiX174:972	0	0.00	0
+phiX174:973	0	0.00	0
+phiX174:974	0	0.00	0
+phiX174:975	0	0.00	0
+phiX174:976	0	0.00	0
+phiX174:977	0	0.00	0
+phiX174:978	0	0.00	0
+phiX174:979	0	0.00	0
+phiX174:980	0	0.00	0
+phiX174:981	0	0.00	0
+phiX174:982	0	0.00	0
+phiX174:983	0	0.00	0
+phiX174:984	0	0.00	0
+phiX174:985	0	0.00	0
+phiX174:986	0	0.00	0
+phiX174:987	0	0.00	0
+phiX174:988	0	0.00	0
+phiX174:989	0	0.00	0
+phiX174:990	0	0.00	0
+phiX174:991	0	0.00	0
+phiX174:992	0	0.00	0
+phiX174:993	0	0.00	0
+phiX174:994	0	0.00	0
+phiX174:995	0	0.00	0
+phiX174:996	0	0.00	0
+phiX174:997	0	0.00	0
+phiX174:998	0	0.00	0
+phiX174:999	0	0.00	0
+phiX174:1000	0	0.00	0
+phiX174:1001	0	0.00	0
+phiX174:1002	0	0.00	0
+phiX174:1003	0	0.00	0
+phiX174:1004	0	0.00	0
+phiX174:1005	0	0.00	0
+phiX174:1006	0	0.00	0
+phiX174:1007	0	0.00	0
+phiX174:1008	0	0.00	0
+phiX174:1009	0	0.00	0
+phiX174:1010	0	0.00	0
+phiX174:1011	0	0.00	0
+phiX174:1012	0	0.00	0
+phiX174:1013	0	0.00	0
+phiX174:1014	0	0.00	0
+phiX174:1015	0	0.00	0
+phiX174:1016	0	0.00	0
+phiX174:1017	0	0.00	0
+phiX174:1018	0	0.00	0
+phiX174:1019	0	0.00	0
+phiX174:1020	0	0.00	0
+phiX174:1021	0	0.00	0
+phiX174:1022	0	0.00	0
+phiX174:1023	0	0.00	0
+phiX174:1024	0	0.00	0
+phiX174:1025	0	0.00	0
+phiX174:1026	0	0.00	0
+phiX174:1027	0	0.00	0
+phiX174:1028	0	0.00	0
+phiX174:1029	0	0.00	0
+phiX174:1030	0	0.00	0
+phiX174:1031	0	0.00	0
+phiX174:1032	0	0.00	0
+phiX174:1033	0	0.00	0
+phiX174:1034	0	0.00	0
+phiX174:1035	0	0.00	0
+phiX174:1036	0	0.00	0
+phiX174:1037	0	0.00	0
+phiX174:1038	0	0.00	0
+phiX174:1039	0	0.00	0
+phiX174:1040	0	0.00	0
+phiX174:1041	0	0.00	0
+phiX174:1042	0	0.00	0
+phiX174:1043	0	0.00	0
+phiX174:1044	0	0.00	0
+phiX174:1045	0	0.00	0
+phiX174:1046	0	0.00	0
+phiX174:1047	0	0.00	0
+phiX174:1048	0	0.00	0
+phiX174:1049	0	0.00	0
+phiX174:1050	0	0.00	0
+phiX174:1051	0	0.00	0
+phiX174:1052	0	0.00	0
+phiX174:1053	0	0.00	0
+phiX174:1054	0	0.00	0
+phiX174:1055	0	0.00	0
+phiX174:1056	0	0.00	0
+phiX174:1057	0	0.00	0
+phiX174:1058	0	0.00	0
+phiX174:1059	0	0.00	0
+phiX174:1060	0	0.00	0
+phiX174:1061	0	0.00	0
+phiX174:1062	0	0.00	0
+phiX174:1063	0	0.00	0
+phiX174:1064	0	0.00	0
+phiX174:1065	0	0.00	0
+phiX174:1066	0	0.00	0
+phiX174:1067	0	0.00	0
+phiX174:1068	0	0.00	0
+phiX174:1069	0	0.00	0
+phiX174:1070	0	0.00	0
+phiX174:1071	0	0.00	0
+phiX174:1072	0	0.00	0
+phiX174:1073	0	0.00	0
+phiX174:1074	0	0.00	0
+phiX174:1075	0	0.00	0
+phiX174:1076	0	0.00	0
+phiX174:1077	0	0.00	0
+phiX174:1078	0	0.00	0
+phiX174:1079	0	0.00	0
+phiX174:1080	0	0.00	0
+phiX174:1081	0	0.00	0
+phiX174:1082	0	0.00	0
+phiX174:1083	0	0.00	0
+phiX174:1084	0	0.00	0
+phiX174:1085	0	0.00	0
+phiX174:1086	0	0.00	0
+phiX174:1087	0	0.00	0
+phiX174:1088	0	0.00	0
+phiX174:1089	0	0.00	0
+phiX174:1090	0	0.00	0
+phiX174:1091	0	0.00	0
+phiX174:1092	0	0.00	0
+phiX174:1093	0	0.00	0
+phiX174:1094	0	0.00	0
+phiX174:1095	0	0.00	0
+phiX174:1096	0	0.00	0
+phiX174:1097	0	0.00	0
+phiX174:1098	0	0.00	0
+phiX174:1099	0	0.00	0
+phiX174:1100	0	0.00	0
+phiX174:1101	0	0.00	0
+phiX174:1102	0	0.00	0
+phiX174:1103	0	0.00	0
+phiX174:1104	0	0.00	0
+phiX174:1105	0	0.00	0
+phiX174:1106	0	0.00	0
+phiX174:1107	0	0.00	0
+phiX174:1108	0	0.00	0
+phiX174:1109	0	0.00	0
+phiX174:1110	0	0.00	0
+phiX174:1111	0	0.00	0
+phiX174:1112	0	0.00	0
+phiX174:1113	0	0.00	0
+phiX174:1114	0	0.00	0
+phiX174:1115	0	0.00	0
+phiX174:1116	0	0.00	0
+phiX174:1117	0	0.00	0
+phiX174:1118	0	0.00	0
+phiX174:1119	0	0.00	0
+phiX174:1120	0	0.00	0
+phiX174:1121	0	0.00	0
+phiX174:1122	0	0.00	0
+phiX174:1123	0	0.00	0
+phiX174:1124	0	0.00	0
+phiX174:1125	0	0.00	0
+phiX174:1126	0	0.00	0
+phiX174:1127	0	0.00	0
+phiX174:1128	0	0.00	0
+phiX174:1129	0	0.00	0
+phiX174:1130	0	0.00	0
+phiX174:1131	0	0.00	0
+phiX174:1132	0	0.00	0
+phiX174:1133	0	0.00	0
+phiX174:1134	0	0.00	0
+phiX174:1135	0	0.00	0
+phiX174:1136	0	0.00	0
+phiX174:1137	0	0.00	0
+phiX174:1138	0	0.00	0
+phiX174:1139	0	0.00	0
+phiX174:1140	0	0.00	0
+phiX174:1141	0	0.00	0
+phiX174:1142	0	0.00	0
+phiX174:1143	0	0.00	0
+phiX174:1144	0	0.00	0
+phiX174:1145	0	0.00	0
+phiX174:1146	0	0.00	0
+phiX174:1147	0	0.00	0
+phiX174:1148	0	0.00	0
+phiX174:1149	0	0.00	0
+phiX174:1150	0	0.00	0
+phiX174:1151	0	0.00	0
+phiX174:1152	0	0.00	0
+phiX174:1153	0	0.00	0
+phiX174:1154	0	0.00	0
+phiX174:1155	0	0.00	0
+phiX174:1156	0	0.00	0
+phiX174:1157	0	0.00	0
+phiX174:1158	0	0.00	0
+phiX174:1159	0	0.00	0
+phiX174:1160	0	0.00	0
+phiX174:1161	0	0.00	0
+phiX174:1162	0	0.00	0
+phiX174:1163	0	0.00	0
+phiX174:1164	0	0.00	0
+phiX174:1165	0	0.00	0
+phiX174:1166	0	0.00	0
+phiX174:1167	0	0.00	0
+phiX174:1168	0	0.00	0
+phiX174:1169	0	0.00	0
+phiX174:1170	0	0.00	0
+phiX174:1171	0	0.00	0
+phiX174:1172	0	0.00	0
+phiX174:1173	0	0.00	0
+phiX174:1174	0	0.00	0
+phiX174:1175	0	0.00	0
+phiX174:1176	0	0.00	0
+phiX174:1177	0	0.00	0
+phiX174:1178	0	0.00	0
+phiX174:1179	0	0.00	0
+phiX174:1180	0	0.00	0
+phiX174:1181	0	0.00	0
+phiX174:1182	0	0.00	0
+phiX174:1183	0	0.00	0
+phiX174:1184	0	0.00	0
+phiX174:1185	0	0.00	0
+phiX174:1186	0	0.00	0
+phiX174:1187	0	0.00	0
+phiX174:1188	0	0.00	0
+phiX174:1189	0	0.00	0
+phiX174:1190	0	0.00	0
+phiX174:1191	0	0.00	0
+phiX174:1192	0	0.00	0
+phiX174:1193	0	0.00	0
+phiX174:1194	0	0.00	0
+phiX174:1195	0	0.00	0
+phiX174:1196	0	0.00	0
+phiX174:1197	0	0.00	0
+phiX174:1198	0	0.00	0
+phiX174:1199	0	0.00	0
+phiX174:1200	0	0.00	0
+phiX174:1201	0	0.00	0
+phiX174:1202	0	0.00	0
+phiX174:1203	0	0.00	0
+phiX174:1204	0	0.00	0
+phiX174:1205	0	0.00	0
+phiX174:1206	0	0.00	0
+phiX174:1207	0	0.00	0
+phiX174:1208	0	0.00	0
+phiX174:1209	0	0.00	0
+phiX174:1210	0	0.00	0
+phiX174:1211	0	0.00	0
+phiX174:1212	0	0.00	0
+phiX174:1213	0	0.00	0
+phiX174:1214	0	0.00	0
+phiX174:1215	0	0.00	0
+phiX174:1216	0	0.00	0
+phiX174:1217	0	0.00	0
+phiX174:1218	0	0.00	0
+phiX174:1219	0	0.00	0
+phiX174:1220	0	0.00	0
+phiX174:1221	0	0.00	0
+phiX174:1222	0	0.00	0
+phiX174:1223	0	0.00	0
+phiX174:1224	0	0.00	0
+phiX174:1225	0	0.00	0
+phiX174:1226	0	0.00	0
+phiX174:1227	0	0.00	0
+phiX174:1228	0	0.00	0
+phiX174:1229	0	0.00	0
+phiX174:1230	0	0.00	0
+phiX174:1231	0	0.00	0
+phiX174:1232	0	0.00	0
+phiX174:1233	0	0.00	0
+phiX174:1234	0	0.00	0
+phiX174:1235	0	0.00	0
+phiX174:1236	0	0.00	0
+phiX174:1237	0	0.00	0
+phiX174:1238	0	0.00	0
+phiX174:1239	0	0.00	0
+phiX174:1240	0	0.00	0
+phiX174:1241	0	0.00	0
+phiX174:1242	0	0.00	0
+phiX174:1243	0	0.00	0
+phiX174:1244	0	0.00	0
+phiX174:1245	0	0.00	0
+phiX174:1246	0	0.00	0
+phiX174:1247	0	0.00	0
+phiX174:1248	0	0.00	0
+phiX174:1249	0	0.00	0
+phiX174:1250	0	0.00	0
+phiX174:1251	0	0.00	0
+phiX174:1252	0	0.00	0
+phiX174:1253	0	0.00	0
+phiX174:1254	0	0.00	0
+phiX174:1255	0	0.00	0
+phiX174:1256	0	0.00	0
+phiX174:1257	0	0.00	0
+phiX174:1258	0	0.00	0
+phiX174:1259	0	0.00	0
+phiX174:1260	0	0.00	0
+phiX174:1261	0	0.00	0
+phiX174:1262	0	0.00	0
+phiX174:1263	0	0.00	0
+phiX174:1264	0	0.00	0
+phiX174:1265	0	0.00	0
+phiX174:1266	0	0.00	0
+phiX174:1267	0	0.00	0
+phiX174:1268	0	0.00	0
+phiX174:1269	0	0.00	0
+phiX174:1270	0	0.00	0
+phiX174:1271	0	0.00	0
+phiX174:1272	0	0.00	0
+phiX174:1273	0	0.00	0
+phiX174:1274	0	0.00	0
+phiX174:1275	0	0.00	0
+phiX174:1276	0	0.00	0
+phiX174:1277	0	0.00	0
+phiX174:1278	0	0.00	0
+phiX174:1279	0	0.00	0
+phiX174:1280	0	0.00	0
+phiX174:1281	0	0.00	0
+phiX174:1282	0	0.00	0
+phiX174:1283	0	0.00	0
+phiX174:1284	0	0.00	0
+phiX174:1285	0	0.00	0
+phiX174:1286	0	0.00	0
+phiX174:1287	0	0.00	0
+phiX174:1288	0	0.00	0
+phiX174:1289	0	0.00	0
+phiX174:1290	0	0.00	0
+phiX174:1291	0	0.00	0
+phiX174:1292	0	0.00	0
+phiX174:1293	0	0.00	0
+phiX174:1294	0	0.00	0
+phiX174:1295	0	0.00	0
+phiX174:1296	0	0.00	0
+phiX174:1297	0	0.00	0
+phiX174:1298	0	0.00	0
+phiX174:1299	0	0.00	0
+phiX174:1300	0	0.00	0
+phiX174:1301	0	0.00	0
+phiX174:1302	0	0.00	0
+phiX174:1303	0	0.00	0
+phiX174:1304	0	0.00	0
+phiX174:1305	0	0.00	0
+phiX174:1306	0	0.00	0
+phiX174:1307	0	0.00	0
+phiX174:1308	0	0.00	0
+phiX174:1309	0	0.00	0
+phiX174:1310	0	0.00	0
+phiX174:1311	0	0.00	0
+phiX174:1312	0	0.00	0
+phiX174:1313	0	0.00	0
+phiX174:1314	0	0.00	0
+phiX174:1315	0	0.00	0
+phiX174:1316	0	0.00	0
+phiX174:1317	0	0.00	0
+phiX174:1318	0	0.00	0
+phiX174:1319	0	0.00	0
+phiX174:1320	0	0.00	0
+phiX174:1321	0	0.00	0
+phiX174:1322	0	0.00	0
+phiX174:1323	0	0.00	0
+phiX174:1324	0	0.00	0
+phiX174:1325	0	0.00	0
+phiX174:1326	0	0.00	0
+phiX174:1327	0	0.00	0
+phiX174:1328	0	0.00	0
+phiX174:1329	0	0.00	0
+phiX174:1330	0	0.00	0
+phiX174:1331	0	0.00	0
+phiX174:1332	0	0.00	0
+phiX174:1333	0	0.00	0
+phiX174:1334	0	0.00	0
+phiX174:1335	0	0.00	0
+phiX174:1336	0	0.00	0
+phiX174:1337	0	0.00	0
+phiX174:1338	0	0.00	0
+phiX174:1339	0	0.00	0
+phiX174:1340	0	0.00	0
+phiX174:1341	0	0.00	0
+phiX174:1342	0	0.00	0
+phiX174:1343	0	0.00	0
+phiX174:1344	0	0.00	0
+phiX174:1345	0	0.00	0
+phiX174:1346	0	0.00	0
+phiX174:1347	0	0.00	0
+phiX174:1348	0	0.00	0
+phiX174:1349	0	0.00	0
+phiX174:1350	0	0.00	0
+phiX174:1351	0	0.00	0
+phiX174:1352	0	0.00	0
+phiX174:1353	0	0.00	0
+phiX174:1354	0	0.00	0
+phiX174:1355	0	0.00	0
+phiX174:1356	0	0.00	0
+phiX174:1357	0	0.00	0
+phiX174:1358	0	0.00	0
+phiX174:1359	0	0.00	0
+phiX174:1360	0	0.00	0
+phiX174:1361	0	0.00	0
+phiX174:1362	0	0.00	0
+phiX174:1363	0	0.00	0
+phiX174:1364	0	0.00	0
+phiX174:1365	0	0.00	0
+phiX174:1366	0	0.00	0
+phiX174:1367	0	0.00	0
+phiX174:1368	0	0.00	0
+phiX174:1369	0	0.00	0
+phiX174:1370	0	0.00	0
+phiX174:1371	0	0.00	0
+phiX174:1372	0	0.00	0
+phiX174:1373	0	0.00	0
+phiX174:1374	0	0.00	0
+phiX174:1375	0	0.00	0
+phiX174:1376	0	0.00	0
+phiX174:1377	0	0.00	0
+phiX174:1378	0	0.00	0
+phiX174:1379	0	0.00	0
+phiX174:1380	0	0.00	0
+phiX174:1381	0	0.00	0
+phiX174:1382	0	0.00	0
+phiX174:1383	0	0.00	0
+phiX174:1384	0	0.00	0
+phiX174:1385	0	0.00	0
+phiX174:1386	0	0.00	0
+phiX174:1387	0	0.00	0
+phiX174:1388	0	0.00	0
+phiX174:1389	0	0.00	0
+phiX174:1390	0	0.00	0
+phiX174:1391	0	0.00	0
+phiX174:1392	0	0.00	0
+phiX174:1393	0	0.00	0
+phiX174:1394	0	0.00	0
+phiX174:1395	0	0.00	0
+phiX174:1396	0	0.00	0
+phiX174:1397	0	0.00	0
+phiX174:1398	0	0.00	0
+phiX174:1399	0	0.00	0
+phiX174:1400	0	0.00	0
+phiX174:1401	0	0.00	0
+phiX174:1402	0	0.00	0
+phiX174:1403	0	0.00	0
+phiX174:1404	0	0.00	0
+phiX174:1405	0	0.00	0
+phiX174:1406	0	0.00	0
+phiX174:1407	0	0.00	0
+phiX174:1408	0	0.00	0
+phiX174:1409	0	0.00	0
+phiX174:1410	0	0.00	0
+phiX174:1411	1	1.00	1
+phiX174:1412	3	3.00	3
+phiX174:1413	5	5.00	5
+phiX174:1414	6	6.00	6
+phiX174:1415	7	7.00	7
+phiX174:1416	8	8.00	8
+phiX174:1417	9	9.00	9
+phiX174:1418	10	10.00	10
+phiX174:1419	10	10.00	10
+phiX174:1420	10	10.00	10
+phiX174:1421	10	10.00	10
+phiX174:1422	10	10.00	10
+phiX174:1423	10	10.00	10
+phiX174:1424	10	10.00	10
+phiX174:1425	10	10.00	10
+phiX174:1426	10	10.00	10
+phiX174:1427	10	10.00	10
+phiX174:1428	10	10.00	10
+phiX174:1429	10	10.00	10
+phiX174:1430	10	10.00	10
+phiX174:1431	10	10.00	10
+phiX174:1432	10	10.00	10
+phiX174:1433	10	10.00	10
+phiX174:1434	10	10.00	10
+phiX174:1435	10	10.00	10
+phiX174:1436	10	10.00	10
+phiX174:1437	10	10.00	10
+phiX174:1438	10	10.00	10
+phiX174:1439	10	10.00	10
+phiX174:1440	10	10.00	10
+phiX174:1441	10	10.00	10
+phiX174:1442	10	10.00	10
+phiX174:1443	10	10.00	10
+phiX174:1444	7	7.00	7
+phiX174:1445	10	10.00	10
+phiX174:1446	10	10.00	10
+phiX174:1447	10	10.00	10
+phiX174:1448	8	8.00	8
+phiX174:1449	6	6.00	6
+phiX174:1450	4	4.00	4
+phiX174:1451	3	3.00	3
+phiX174:1452	2	2.00	2
+phiX174:1453	1	1.00	1
+phiX174:1454	0	0.00	0
+phiX174:1455	0	0.00	0
+phiX174:1456	0	0.00	0
+phiX174:1457	0	0.00	0
+phiX174:1458	0	0.00	0
+phiX174:1459	0	0.00	0
+phiX174:1460	0	0.00	0
+phiX174:1461	0	0.00	0
+phiX174:1462	0	0.00	0
+phiX174:1463	0	0.00	0
+phiX174:1464	0	0.00	0
+phiX174:1465	0	0.00	0
+phiX174:1466	0	0.00	0
+phiX174:1467	0	0.00	0
+phiX174:1468	0	0.00	0
+phiX174:1469	0	0.00	0
+phiX174:1470	0	0.00	0
+phiX174:1471	0	0.00	0
+phiX174:1472	0	0.00	0
+phiX174:1473	0	0.00	0
+phiX174:1474	0	0.00	0
+phiX174:1475	0	0.00	0
+phiX174:1476	0	0.00	0
+phiX174:1477	0	0.00	0
+phiX174:1478	0	0.00	0
+phiX174:1479	0	0.00	0
+phiX174:1480	0	0.00	0
+phiX174:1481	0	0.00	0
+phiX174:1482	0	0.00	0
+phiX174:1483	0	0.00	0
+phiX174:1484	0	0.00	0
+phiX174:1485	0	0.00	0
+phiX174:1486	0	0.00	0
+phiX174:1487	0	0.00	0
+phiX174:1488	0	0.00	0
+phiX174:1489	0	0.00	0
+phiX174:1490	0	0.00	0
+phiX174:1491	0	0.00	0
+phiX174:1492	0	0.00	0
+phiX174:1493	0	0.00	0
+phiX174:1494	0	0.00	0
+phiX174:1495	0	0.00	0
+phiX174:1496	0	0.00	0
+phiX174:1497	0	0.00	0
+phiX174:1498	0	0.00	0
+phiX174:1499	0	0.00	0
+phiX174:1500	0	0.00	0
+phiX174:1501	0	0.00	0
+phiX174:1502	0	0.00	0
+phiX174:1503	0	0.00	0
+phiX174:1504	0	0.00	0
+phiX174:1505	0	0.00	0
+phiX174:1506	0	0.00	0
+phiX174:1507	0	0.00	0
+phiX174:1508	0	0.00	0
+phiX174:1509	0	0.00	0
+phiX174:1510	0	0.00	0
+phiX174:1511	0	0.00	0
+phiX174:1512	0	0.00	0
+phiX174:1513	0	0.00	0
+phiX174:1514	0	0.00	0
+phiX174:1515	0	0.00	0
+phiX174:1516	0	0.00	0
+phiX174:1517	0	0.00	0
+phiX174:1518	0	0.00	0
+phiX174:1519	0	0.00	0
+phiX174:1520	0	0.00	0
+phiX174:1521	0	0.00	0
+phiX174:1522	0	0.00	0
+phiX174:1523	0	0.00	0
+phiX174:1524	0	0.00	0
+phiX174:1525	0	0.00	0
+phiX174:1526	0	0.00	0
+phiX174:1527	0	0.00	0
+phiX174:1528	0	0.00	0
+phiX174:1529	0	0.00	0
+phiX174:1530	0	0.00	0
+phiX174:1531	0	0.00	0
+phiX174:1532	0	0.00	0
+phiX174:1533	0	0.00	0
+phiX174:1534	0	0.00	0
+phiX174:1535	0	0.00	0
+phiX174:1536	0	0.00	0
+phiX174:1537	0	0.00	0
+phiX174:1538	0	0.00	0
+phiX174:1539	0	0.00	0
+phiX174:1540	0	0.00	0
+phiX174:1541	0	0.00	0
+phiX174:1542	0	0.00	0
+phiX174:1543	0	0.00	0
+phiX174:1544	0	0.00	0
+phiX174:1545	0	0.00	0
+phiX174:1546	0	0.00	0
+phiX174:1547	0	0.00	0
+phiX174:1548	0	0.00	0
+phiX174:1549	0	0.00	0
+phiX174:1550	0	0.00	0
+phiX174:1551	0	0.00	0
+phiX174:1552	0	0.00	0
+phiX174:1553	0	0.00	0
+phiX174:1554	0	0.00	0
+phiX174:1555	0	0.00	0
+phiX174:1556	0	0.00	0
+phiX174:1557	0	0.00	0
+phiX174:1558	0	0.00	0
+phiX174:1559	0	0.00	0
+phiX174:1560	0	0.00	0
+phiX174:1561	0	0.00	0
+phiX174:1562	0	0.00	0
+phiX174:1563	0	0.00	0
+phiX174:1564	0	0.00	0
+phiX174:1565	0	0.00	0
+phiX174:1566	0	0.00	0
+phiX174:1567	0	0.00	0
+phiX174:1568	0	0.00	0
+phiX174:1569	0	0.00	0
+phiX174:1570	0	0.00	0
+phiX174:1571	0	0.00	0
+phiX174:1572	0	0.00	0
+phiX174:1573	0	0.00	0
+phiX174:1574	0	0.00	0
+phiX174:1575	0	0.00	0
+phiX174:1576	0	0.00	0
+phiX174:1577	0	0.00	0
+phiX174:1578	0	0.00	0
+phiX174:1579	0	0.00	0
+phiX174:1580	0	0.00	0
+phiX174:1581	0	0.00	0
+phiX174:1582	0	0.00	0
+phiX174:1583	0	0.00	0
+phiX174:1584	0	0.00	0
+phiX174:1585	0	0.00	0
+phiX174:1586	0	0.00	0
+phiX174:1587	0	0.00	0
+phiX174:1588	0	0.00	0
+phiX174:1589	0	0.00	0
+phiX174:1590	0	0.00	0
+phiX174:1591	0	0.00	0
+phiX174:1592	0	0.00	0
+phiX174:1593	0	0.00	0
+phiX174:1594	0	0.00	0
+phiX174:1595	0	0.00	0
+phiX174:1596	0	0.00	0
+phiX174:1597	0	0.00	0
+phiX174:1598	0	0.00	0
+phiX174:1599	0	0.00	0
+phiX174:1600	0	0.00	0
+phiX174:1601	0	0.00	0
+phiX174:1602	0	0.00	0
+phiX174:1603	0	0.00	0
+phiX174:1604	0	0.00	0
+phiX174:1605	0	0.00	0
+phiX174:1606	0	0.00	0
+phiX174:1607	0	0.00	0
+phiX174:1608	0	0.00	0
+phiX174:1609	0	0.00	0
+phiX174:1610	0	0.00	0
+phiX174:1611	0	0.00	0
+phiX174:1612	0	0.00	0
+phiX174:1613	0	0.00	0
+phiX174:1614	0	0.00	0
+phiX174:1615	0	0.00	0
+phiX174:1616	0	0.00	0
+phiX174:1617	0	0.00	0
+phiX174:1618	0	0.00	0
+phiX174:1619	0	0.00	0
+phiX174:1620	0	0.00	0
+phiX174:1621	0	0.00	0
+phiX174:1622	0	0.00	0
+phiX174:1623	0	0.00	0
+phiX174:1624	0	0.00	0
+phiX174:1625	0	0.00	0
+phiX174:1626	0	0.00	0
+phiX174:1627	0	0.00	0
+phiX174:1628	0	0.00	0
+phiX174:1629	0	0.00	0
+phiX174:1630	0	0.00	0
+phiX174:1631	0	0.00	0
+phiX174:1632	0	0.00	0
+phiX174:1633	0	0.00	0
+phiX174:1634	0	0.00	0
+phiX174:1635	0	0.00	0
+phiX174:1636	0	0.00	0
+phiX174:1637	0	0.00	0
+phiX174:1638	0	0.00	0
+phiX174:1639	0	0.00	0
+phiX174:1640	0	0.00	0
+phiX174:1641	0	0.00	0
+phiX174:1642	0	0.00	0
+phiX174:1643	0	0.00	0
+phiX174:1644	0	0.00	0
+phiX174:1645	0	0.00	0
+phiX174:1646	0	0.00	0
+phiX174:1647	0	0.00	0
+phiX174:1648	0	0.00	0
+phiX174:1649	0	0.00	0
+phiX174:1650	0	0.00	0
+phiX174:1651	0	0.00	0
+phiX174:1652	0	0.00	0
+phiX174:1653	0	0.00	0
+phiX174:1654	0	0.00	0
+phiX174:1655	0	0.00	0
+phiX174:1656	0	0.00	0
+phiX174:1657	0	0.00	0
+phiX174:1658	0	0.00	0
+phiX174:1659	0	0.00	0
+phiX174:1660	0	0.00	0
+phiX174:1661	0	0.00	0
+phiX174:1662	0	0.00	0
+phiX174:1663	0	0.00	0
+phiX174:1664	0	0.00	0
+phiX174:1665	0	0.00	0
+phiX174:1666	0	0.00	0
+phiX174:1667	0	0.00	0
+phiX174:1668	0	0.00	0
+phiX174:1669	0	0.00	0
+phiX174:1670	0	0.00	0
+phiX174:1671	0	0.00	0
+phiX174:1672	0	0.00	0
+phiX174:1673	0	0.00	0
+phiX174:1674	0	0.00	0
+phiX174:1675	0	0.00	0
+phiX174:1676	0	0.00	0
+phiX174:1677	0	0.00	0
+phiX174:1678	0	0.00	0
+phiX174:1679	0	0.00	0
+phiX174:1680	0	0.00	0
+phiX174:1681	0	0.00	0
+phiX174:1682	0	0.00	0
+phiX174:1683	0	0.00	0
+phiX174:1684	0	0.00	0
+phiX174:1685	0	0.00	0
+phiX174:1686	0	0.00	0
+phiX174:1687	0	0.00	0
+phiX174:1688	0	0.00	0
+phiX174:1689	0	0.00	0
+phiX174:1690	0	0.00	0
+phiX174:1691	0	0.00	0
+phiX174:1692	0	0.00	0
+phiX174:1693	0	0.00	0
+phiX174:1694	0	0.00	0
+phiX174:1695	0	0.00	0
+phiX174:1696	0	0.00	0
+phiX174:1697	0	0.00	0
+phiX174:1698	0	0.00	0
+phiX174:1699	0	0.00	0
+phiX174:1700	0	0.00	0
+phiX174:1701	0	0.00	0
+phiX174:1702	0	0.00	0
+phiX174:1703	0	0.00	0
+phiX174:1704	0	0.00	0
+phiX174:1705	0	0.00	0
+phiX174:1706	0	0.00	0
+phiX174:1707	0	0.00	0
+phiX174:1708	0	0.00	0
+phiX174:1709	0	0.00	0
+phiX174:1710	0	0.00	0
+phiX174:1711	0	0.00	0
+phiX174:1712	0	0.00	0
+phiX174:1713	0	0.00	0
+phiX174:1714	0	0.00	0
+phiX174:1715	0	0.00	0
+phiX174:1716	0	0.00	0
+phiX174:1717	0	0.00	0
+phiX174:1718	0	0.00	0
+phiX174:1719	0	0.00	0
+phiX174:1720	0	0.00	0
+phiX174:1721	0	0.00	0
+phiX174:1722	0	0.00	0
+phiX174:1723	0	0.00	0
+phiX174:1724	0	0.00	0
+phiX174:1725	0	0.00	0
+phiX174:1726	0	0.00	0
+phiX174:1727	0	0.00	0
+phiX174:1728	0	0.00	0
+phiX174:1729	0	0.00	0
+phiX174:1730	0	0.00	0
+phiX174:1731	0	0.00	0
+phiX174:1732	0	0.00	0
+phiX174:1733	0	0.00	0
+phiX174:1734	0	0.00	0
+phiX174:1735	0	0.00	0
+phiX174:1736	0	0.00	0
+phiX174:1737	0	0.00	0
+phiX174:1738	0	0.00	0
+phiX174:1739	0	0.00	0
+phiX174:1740	0	0.00	0
+phiX174:1741	0	0.00	0
+phiX174:1742	0	0.00	0
+phiX174:1743	0	0.00	0
+phiX174:1744	0	0.00	0
+phiX174:1745	0	0.00	0
+phiX174:1746	0	0.00	0
+phiX174:1747	0	0.00	0
+phiX174:1748	0	0.00	0
+phiX174:1749	0	0.00	0
+phiX174:1750	0	0.00	0
+phiX174:1751	0	0.00	0
+phiX174:1752	0	0.00	0
+phiX174:1753	0	0.00	0
+phiX174:1754	0	0.00	0
+phiX174:1755	0	0.00	0
+phiX174:1756	0	0.00	0
+phiX174:1757	0	0.00	0
+phiX174:1758	0	0.00	0
+phiX174:1759	0	0.00	0
+phiX174:1760	0	0.00	0
+phiX174:1761	0	0.00	0
+phiX174:1762	0	0.00	0
+phiX174:1763	0	0.00	0
+phiX174:1764	0	0.00	0
+phiX174:1765	0	0.00	0
+phiX174:1766	0	0.00	0
+phiX174:1767	0	0.00	0
+phiX174:1768	0	0.00	0
+phiX174:1769	0	0.00	0
+phiX174:1770	0	0.00	0
+phiX174:1771	0	0.00	0
+phiX174:1772	0	0.00	0
+phiX174:1773	0	0.00	0
+phiX174:1774	0	0.00	0
+phiX174:1775	0	0.00	0
+phiX174:1776	0	0.00	0
+phiX174:1777	0	0.00	0
+phiX174:1778	0	0.00	0
+phiX174:1779	0	0.00	0
+phiX174:1780	0	0.00	0
+phiX174:1781	0	0.00	0
+phiX174:1782	0	0.00	0
+phiX174:1783	0	0.00	0
+phiX174:1784	0	0.00	0
+phiX174:1785	0	0.00	0
+phiX174:1786	0	0.00	0
+phiX174:1787	0	0.00	0
+phiX174:1788	0	0.00	0
+phiX174:1789	0	0.00	0
+phiX174:1790	0	0.00	0
+phiX174:1791	0	0.00	0
+phiX174:1792	0	0.00	0
+phiX174:1793	0	0.00	0
+phiX174:1794	0	0.00	0
+phiX174:1795	0	0.00	0
+phiX174:1796	0	0.00	0
+phiX174:1797	0	0.00	0
+phiX174:1798	0	0.00	0
+phiX174:1799	0	0.00	0
+phiX174:1800	0	0.00	0
+phiX174:1801	0	0.00	0
+phiX174:1802	0	0.00	0
+phiX174:1803	0	0.00	0
+phiX174:1804	0	0.00	0
+phiX174:1805	0	0.00	0
+phiX174:1806	0	0.00	0
+phiX174:1807	0	0.00	0
+phiX174:1808	0	0.00	0
+phiX174:1809	0	0.00	0
+phiX174:1810	0	0.00	0
+phiX174:1811	0	0.00	0
+phiX174:1812	0	0.00	0
+phiX174:1813	0	0.00	0
+phiX174:1814	0	0.00	0
+phiX174:1815	0	0.00	0
+phiX174:1816	0	0.00	0
+phiX174:1817	0	0.00	0
+phiX174:1818	0	0.00	0
+phiX174:1819	0	0.00	0
+phiX174:1820	0	0.00	0
+phiX174:1821	0	0.00	0
+phiX174:1822	0	0.00	0
+phiX174:1823	0	0.00	0
+phiX174:1824	0	0.00	0
+phiX174:1825	0	0.00	0
+phiX174:1826	0	0.00	0
+phiX174:1827	0	0.00	0
+phiX174:1828	0	0.00	0
+phiX174:1829	0	0.00	0
+phiX174:1830	0	0.00	0
+phiX174:1831	0	0.00	0
+phiX174:1832	0	0.00	0
+phiX174:1833	0	0.00	0
+phiX174:1834	0	0.00	0
+phiX174:1835	0	0.00	0
+phiX174:1836	0	0.00	0
+phiX174:1837	0	0.00	0
+phiX174:1838	0	0.00	0
+phiX174:1839	0	0.00	0
+phiX174:1840	0	0.00	0
+phiX174:1841	0	0.00	0
+phiX174:1842	0	0.00	0
+phiX174:1843	0	0.00	0
+phiX174:1844	0	0.00	0
+phiX174:1845	0	0.00	0
+phiX174:1846	0	0.00	0
+phiX174:1847	0	0.00	0
+phiX174:1848	0	0.00	0
+phiX174:1849	0	0.00	0
+phiX174:1850	0	0.00	0
+phiX174:1851	0	0.00	0
+phiX174:1852	0	0.00	0
+phiX174:1853	0	0.00	0
+phiX174:1854	0	0.00	0
+phiX174:1855	0	0.00	0
+phiX174:1856	0	0.00	0
+phiX174:1857	0	0.00	0
+phiX174:1858	0	0.00	0
+phiX174:1859	0	0.00	0
+phiX174:1860	0	0.00	0
+phiX174:1861	0	0.00	0
+phiX174:1862	0	0.00	0
+phiX174:1863	0	0.00	0
+phiX174:1864	0	0.00	0
+phiX174:1865	0	0.00	0
+phiX174:1866	0	0.00	0
+phiX174:1867	0	0.00	0
+phiX174:1868	0	0.00	0
+phiX174:1869	0	0.00	0
+phiX174:1870	0	0.00	0
+phiX174:1871	0	0.00	0
+phiX174:1872	0	0.00	0
+phiX174:1873	0	0.00	0
+phiX174:1874	0	0.00	0
+phiX174:1875	0	0.00	0
+phiX174:1876	0	0.00	0
+phiX174:1877	0	0.00	0
+phiX174:1878	0	0.00	0
+phiX174:1879	0	0.00	0
+phiX174:1880	0	0.00	0
+phiX174:1881	0	0.00	0
+phiX174:1882	0	0.00	0
+phiX174:1883	0	0.00	0
+phiX174:1884	0	0.00	0
+phiX174:1885	0	0.00	0
+phiX174:1886	0	0.00	0
+phiX174:1887	0	0.00	0
+phiX174:1888	0	0.00	0
+phiX174:1889	0	0.00	0
+phiX174:1890	0	0.00	0
+phiX174:1891	0	0.00	0
+phiX174:1892	0	0.00	0
+phiX174:1893	0	0.00	0
+phiX174:1894	0	0.00	0
+phiX174:1895	0	0.00	0
+phiX174:1896	0	0.00	0
+phiX174:1897	0	0.00	0
+phiX174:1898	0	0.00	0
+phiX174:1899	0	0.00	0
+phiX174:1900	0	0.00	0
+phiX174:1901	0	0.00	0
+phiX174:1902	0	0.00	0
+phiX174:1903	0	0.00	0
+phiX174:1904	0	0.00	0
+phiX174:1905	0	0.00	0
+phiX174:1906	0	0.00	0
+phiX174:1907	0	0.00	0
+phiX174:1908	0	0.00	0
+phiX174:1909	0	0.00	0
+phiX174:1910	0	0.00	0
+phiX174:1911	0	0.00	0
+phiX174:1912	0	0.00	0
+phiX174:1913	0	0.00	0
+phiX174:1914	0	0.00	0
+phiX174:1915	0	0.00	0
+phiX174:1916	0	0.00	0
+phiX174:1917	0	0.00	0
+phiX174:1918	0	0.00	0
+phiX174:1919	0	0.00	0
+phiX174:1920	0	0.00	0
+phiX174:1921	0	0.00	0
+phiX174:1922	0	0.00	0
+phiX174:1923	0	0.00	0
+phiX174:1924	0	0.00	0
+phiX174:1925	0	0.00	0
+phiX174:1926	0	0.00	0
+phiX174:1927	0	0.00	0
+phiX174:1928	0	0.00	0
+phiX174:1929	0	0.00	0
+phiX174:1930	0	0.00	0
+phiX174:1931	0	0.00	0
+phiX174:1932	0	0.00	0
+phiX174:1933	0	0.00	0
+phiX174:1934	0	0.00	0
+phiX174:1935	0	0.00	0
+phiX174:1936	0	0.00	0
+phiX174:1937	0	0.00	0
+phiX174:1938	0	0.00	0
+phiX174:1939	0	0.00	0
+phiX174:1940	0	0.00	0
+phiX174:1941	0	0.00	0
+phiX174:1942	0	0.00	0
+phiX174:1943	0	0.00	0
+phiX174:1944	0	0.00	0
+phiX174:1945	0	0.00	0
+phiX174:1946	0	0.00	0
+phiX174:1947	0	0.00	0
+phiX174:1948	0	0.00	0
+phiX174:1949	0	0.00	0
+phiX174:1950	0	0.00	0
+phiX174:1951	0	0.00	0
+phiX174:1952	0	0.00	0
+phiX174:1953	0	0.00	0
+phiX174:1954	0	0.00	0
+phiX174:1955	0	0.00	0
+phiX174:1956	0	0.00	0
+phiX174:1957	0	0.00	0
+phiX174:1958	0	0.00	0
+phiX174:1959	0	0.00	0
+phiX174:1960	0	0.00	0
+phiX174:1961	0	0.00	0
+phiX174:1962	0	0.00	0
+phiX174:1963	0	0.00	0
+phiX174:1964	0	0.00	0
+phiX174:1965	0	0.00	0
+phiX174:1966	0	0.00	0
+phiX174:1967	0	0.00	0
+phiX174:1968	0	0.00	0
+phiX174:1969	0	0.00	0
+phiX174:1970	0	0.00	0
+phiX174:1971	0	0.00	0
+phiX174:1972	0	0.00	0
+phiX174:1973	0	0.00	0
+phiX174:1974	0	0.00	0
+phiX174:1975	0	0.00	0
+phiX174:1976	0	0.00	0
+phiX174:1977	0	0.00	0
+phiX174:1978	0	0.00	0
+phiX174:1979	0	0.00	0
+phiX174:1980	0	0.00	0
+phiX174:1981	0	0.00	0
+phiX174:1982	0	0.00	0
+phiX174:1983	0	0.00	0
+phiX174:1984	0	0.00	0
+phiX174:1985	0	0.00	0
+phiX174:1986	0	0.00	0
+phiX174:1987	0	0.00	0
+phiX174:1988	0	0.00	0
+phiX174:1989	0	0.00	0
+phiX174:1990	0	0.00	0
+phiX174:1991	0	0.00	0
+phiX174:1992	0	0.00	0
+phiX174:1993	0	0.00	0
+phiX174:1994	0	0.00	0
+phiX174:1995	0	0.00	0
+phiX174:1996	0	0.00	0
+phiX174:1997	0	0.00	0
+phiX174:1998	0	0.00	0
+phiX174:1999	0	0.00	0
+phiX174:2000	0	0.00	0
+phiX174:2001	0	0.00	0
+phiX174:2002	0	0.00	0
+phiX174:2003	0	0.00	0
+phiX174:2004	0	0.00	0
+phiX174:2005	0	0.00	0
+phiX174:2006	0	0.00	0
+phiX174:2007	0	0.00	0
+phiX174:2008	0	0.00	0
+phiX174:2009	0	0.00	0
+phiX174:2010	0	0.00	0
+phiX174:2011	0	0.00	0
+phiX174:2012	0	0.00	0
+phiX174:2013	0	0.00	0
+phiX174:2014	0	0.00	0
+phiX174:2015	0	0.00	0
+phiX174:2016	0	0.00	0
+phiX174:2017	0	0.00	0
+phiX174:2018	0	0.00	0
+phiX174:2019	0	0.00	0
+phiX174:2020	0	0.00	0
+phiX174:2021	0	0.00	0
+phiX174:2022	0	0.00	0
+phiX174:2023	0	0.00	0
+phiX174:2024	0	0.00	0
+phiX174:2025	0	0.00	0
+phiX174:2026	0	0.00	0
+phiX174:2027	0	0.00	0
+phiX174:2028	0	0.00	0
+phiX174:2029	0	0.00	0
+phiX174:2030	0	0.00	0
+phiX174:2031	0	0.00	0
+phiX174:2032	0	0.00	0
+phiX174:2033	0	0.00	0
+phiX174:2034	0	0.00	0
+phiX174:2035	0	0.00	0
+phiX174:2036	0	0.00	0
+phiX174:2037	0	0.00	0
+phiX174:2038	0	0.00	0
+phiX174:2039	0	0.00	0
+phiX174:2040	0	0.00	0
+phiX174:2041	0	0.00	0
+phiX174:2042	0	0.00	0
+phiX174:2043	0	0.00	0
+phiX174:2044	0	0.00	0
+phiX174:2045	0	0.00	0
+phiX174:2046	0	0.00	0
+phiX174:2047	0	0.00	0
+phiX174:2048	0	0.00	0
+phiX174:2049	0	0.00	0
+phiX174:2050	0	0.00	0
+phiX174:2051	0	0.00	0
+phiX174:2052	0	0.00	0
+phiX174:2053	0	0.00	0
+phiX174:2054	0	0.00	0
+phiX174:2055	0	0.00	0
+phiX174:2056	0	0.00	0
+phiX174:2057	0	0.00	0
+phiX174:2058	0	0.00	0
+phiX174:2059	0	0.00	0
+phiX174:2060	0	0.00	0
+phiX174:2061	0	0.00	0
+phiX174:2062	0	0.00	0
+phiX174:2063	0	0.00	0
+phiX174:2064	0	0.00	0
+phiX174:2065	0	0.00	0
+phiX174:2066	0	0.00	0
+phiX174:2067	0	0.00	0
+phiX174:2068	0	0.00	0
+phiX174:2069	0	0.00	0
+phiX174:2070	0	0.00	0
+phiX174:2071	0	0.00	0
+phiX174:2072	0	0.00	0
+phiX174:2073	0	0.00	0
+phiX174:2074	0	0.00	0
+phiX174:2075	0	0.00	0
+phiX174:2076	0	0.00	0
+phiX174:2077	0	0.00	0
+phiX174:2078	0	0.00	0
+phiX174:2079	0	0.00	0
+phiX174:2080	0	0.00	0
+phiX174:2081	0	0.00	0
+phiX174:2082	0	0.00	0
+phiX174:2083	0	0.00	0
+phiX174:2084	0	0.00	0
+phiX174:2085	0	0.00	0
+phiX174:2086	0	0.00	0
+phiX174:2087	0	0.00	0
+phiX174:2088	0	0.00	0
+phiX174:2089	0	0.00	0
+phiX174:2090	0	0.00	0
+phiX174:2091	0	0.00	0
+phiX174:2092	0	0.00	0
+phiX174:2093	0	0.00	0
+phiX174:2094	0	0.00	0
+phiX174:2095	0	0.00	0
+phiX174:2096	0	0.00	0
+phiX174:2097	0	0.00	0
+phiX174:2098	0	0.00	0
+phiX174:2099	0	0.00	0
+phiX174:2100	0	0.00	0
+phiX174:2101	0	0.00	0
+phiX174:2102	0	0.00	0
+phiX174:2103	0	0.00	0
+phiX174:2104	0	0.00	0
+phiX174:2105	0	0.00	0
+phiX174:2106	0	0.00	0
+phiX174:2107	0	0.00	0
+phiX174:2108	0	0.00	0
+phiX174:2109	0	0.00	0
+phiX174:2110	0	0.00	0
+phiX174:2111	0	0.00	0
+phiX174:2112	0	0.00	0
+phiX174:2113	0	0.00	0
+phiX174:2114	0	0.00	0
+phiX174:2115	0	0.00	0
+phiX174:2116	0	0.00	0
+phiX174:2117	0	0.00	0
+phiX174:2118	0	0.00	0
+phiX174:2119	0	0.00	0
+phiX174:2120	0	0.00	0
+phiX174:2121	0	0.00	0
+phiX174:2122	0	0.00	0
+phiX174:2123	0	0.00	0
+phiX174:2124	0	0.00	0
+phiX174:2125	0	0.00	0
+phiX174:2126	0	0.00	0
+phiX174:2127	0	0.00	0
+phiX174:2128	0	0.00	0
+phiX174:2129	0	0.00	0
+phiX174:2130	0	0.00	0
+phiX174:2131	0	0.00	0
+phiX174:2132	0	0.00	0
+phiX174:2133	0	0.00	0
+phiX174:2134	0	0.00	0
+phiX174:2135	0	0.00	0
+phiX174:2136	0	0.00	0
+phiX174:2137	0	0.00	0
+phiX174:2138	0	0.00	0
+phiX174:2139	0	0.00	0
+phiX174:2140	0	0.00	0
+phiX174:2141	0	0.00	0
+phiX174:2142	0	0.00	0
+phiX174:2143	0	0.00	0
+phiX174:2144	0	0.00	0
+phiX174:2145	0	0.00	0
+phiX174:2146	0	0.00	0
+phiX174:2147	0	0.00	0
+phiX174:2148	0	0.00	0
+phiX174:2149	0	0.00	0
+phiX174:2150	0	0.00	0
+phiX174:2151	0	0.00	0
+phiX174:2152	0	0.00	0
+phiX174:2153	0	0.00	0
+phiX174:2154	0	0.00	0
+phiX174:2155	0	0.00	0
+phiX174:2156	0	0.00	0
+phiX174:2157	0	0.00	0
+phiX174:2158	0	0.00	0
+phiX174:2159	0	0.00	0
+phiX174:2160	0	0.00	0
+phiX174:2161	0	0.00	0
+phiX174:2162	0	0.00	0
+phiX174:2163	0	0.00	0
+phiX174:2164	0	0.00	0
+phiX174:2165	0	0.00	0
+phiX174:2166	0	0.00	0
+phiX174:2167	0	0.00	0
+phiX174:2168	0	0.00	0
+phiX174:2169	0	0.00	0
+phiX174:2170	0	0.00	0
+phiX174:2171	0	0.00	0
+phiX174:2172	0	0.00	0
+phiX174:2173	0	0.00	0
+phiX174:2174	0	0.00	0
+phiX174:2175	0	0.00	0
+phiX174:2176	0	0.00	0
+phiX174:2177	0	0.00	0
+phiX174:2178	0	0.00	0
+phiX174:2179	0	0.00	0
+phiX174:2180	0	0.00	0
+phiX174:2181	0	0.00	0
+phiX174:2182	0	0.00	0
+phiX174:2183	0	0.00	0
+phiX174:2184	0	0.00	0
+phiX174:2185	0	0.00	0
+phiX174:2186	0	0.00	0
+phiX174:2187	0	0.00	0
+phiX174:2188	0	0.00	0
+phiX174:2189	0	0.00	0
+phiX174:2190	0	0.00	0
+phiX174:2191	0	0.00	0
+phiX174:2192	0	0.00	0
+phiX174:2193	0	0.00	0
+phiX174:2194	0	0.00	0
+phiX174:2195	0	0.00	0
+phiX174:2196	0	0.00	0
+phiX174:2197	0	0.00	0
+phiX174:2198	0	0.00	0
+phiX174:2199	0	0.00	0
+phiX174:2200	0	0.00	0
+phiX174:2201	0	0.00	0
+phiX174:2202	0	0.00	0
+phiX174:2203	0	0.00	0
+phiX174:2204	0	0.00	0
+phiX174:2205	0	0.00	0
+phiX174:2206	0	0.00	0
+phiX174:2207	0	0.00	0
+phiX174:2208	0	0.00	0
+phiX174:2209	0	0.00	0
+phiX174:2210	0	0.00	0
+phiX174:2211	0	0.00	0
+phiX174:2212	0	0.00	0
+phiX174:2213	0	0.00	0
+phiX174:2214	0	0.00	0
+phiX174:2215	0	0.00	0
+phiX174:2216	0	0.00	0
+phiX174:2217	0	0.00	0
+phiX174:2218	0	0.00	0
+phiX174:2219	0	0.00	0
+phiX174:2220	0	0.00	0
+phiX174:2221	0	0.00	0
+phiX174:2222	0	0.00	0
+phiX174:2223	0	0.00	0
+phiX174:2224	0	0.00	0
+phiX174:2225	0	0.00	0
+phiX174:2226	0	0.00	0
+phiX174:2227	0	0.00	0
+phiX174:2228	0	0.00	0
+phiX174:2229	0	0.00	0
+phiX174:2230	0	0.00	0
+phiX174:2231	0	0.00	0
+phiX174:2232	0	0.00	0
+phiX174:2233	0	0.00	0
+phiX174:2234	0	0.00	0
+phiX174:2235	0	0.00	0
+phiX174:2236	0	0.00	0
+phiX174:2237	0	0.00	0
+phiX174:2238	0	0.00	0
+phiX174:2239	0	0.00	0
+phiX174:2240	0	0.00	0
+phiX174:2241	0	0.00	0
+phiX174:2242	0	0.00	0
+phiX174:2243	0	0.00	0
+phiX174:2244	0	0.00	0
+phiX174:2245	0	0.00	0
+phiX174:2246	0	0.00	0
+phiX174:2247	0	0.00	0
+phiX174:2248	0	0.00	0
+phiX174:2249	0	0.00	0
+phiX174:2250	0	0.00	0
+phiX174:2251	0	0.00	0
+phiX174:2252	0	0.00	0
+phiX174:2253	0	0.00	0
+phiX174:2254	0	0.00	0
+phiX174:2255	0	0.00	0
+phiX174:2256	0	0.00	0
+phiX174:2257	0	0.00	0
+phiX174:2258	0	0.00	0
+phiX174:2259	0	0.00	0
+phiX174:2260	0	0.00	0
+phiX174:2261	0	0.00	0
+phiX174:2262	0	0.00	0
+phiX174:2263	0	0.00	0
+phiX174:2264	0	0.00	0
+phiX174:2265	0	0.00	0
+phiX174:2266	0	0.00	0
+phiX174:2267	0	0.00	0
+phiX174:2268	0	0.00	0
+phiX174:2269	0	0.00	0
+phiX174:2270	0	0.00	0
+phiX174:2271	0	0.00	0
+phiX174:2272	0	0.00	0
+phiX174:2273	0	0.00	0
+phiX174:2274	0	0.00	0
+phiX174:2275	0	0.00	0
+phiX174:2276	0	0.00	0
+phiX174:2277	0	0.00	0
+phiX174:2278	0	0.00	0
+phiX174:2279	0	0.00	0
+phiX174:2280	0	0.00	0
+phiX174:2281	0	0.00	0
+phiX174:2282	0	0.00	0
+phiX174:2283	0	0.00	0
+phiX174:2284	0	0.00	0
+phiX174:2285	0	0.00	0
+phiX174:2286	0	0.00	0
+phiX174:2287	0	0.00	0
+phiX174:2288	0	0.00	0
+phiX174:2289	0	0.00	0
+phiX174:2290	0	0.00	0
+phiX174:2291	0	0.00	0
+phiX174:2292	0	0.00	0
+phiX174:2293	0	0.00	0
+phiX174:2294	0	0.00	0
+phiX174:2295	0	0.00	0
+phiX174:2296	0	0.00	0
+phiX174:2297	0	0.00	0
+phiX174:2298	0	0.00	0
+phiX174:2299	0	0.00	0
+phiX174:2300	0	0.00	0
+phiX174:2301	0	0.00	0
+phiX174:2302	0	0.00	0
+phiX174:2303	0	0.00	0
+phiX174:2304	0	0.00	0
+phiX174:2305	0	0.00	0
+phiX174:2306	0	0.00	0
+phiX174:2307	0	0.00	0
+phiX174:2308	0	0.00	0
+phiX174:2309	0	0.00	0
+phiX174:2310	0	0.00	0
+phiX174:2311	0	0.00	0
+phiX174:2312	0	0.00	0
+phiX174:2313	0	0.00	0
+phiX174:2314	0	0.00	0
+phiX174:2315	0	0.00	0
+phiX174:2316	0	0.00	0
+phiX174:2317	0	0.00	0
+phiX174:2318	0	0.00	0
+phiX174:2319	0	0.00	0
+phiX174:2320	0	0.00	0
+phiX174:2321	0	0.00	0
+phiX174:2322	0	0.00	0
+phiX174:2323	0	0.00	0
+phiX174:2324	0	0.00	0
+phiX174:2325	0	0.00	0
+phiX174:2326	0	0.00	0
+phiX174:2327	0	0.00	0
+phiX174:2328	0	0.00	0
+phiX174:2329	0	0.00	0
+phiX174:2330	0	0.00	0
+phiX174:2331	0	0.00	0
+phiX174:2332	0	0.00	0
+phiX174:2333	0	0.00	0
+phiX174:2334	0	0.00	0
+phiX174:2335	0	0.00	0
+phiX174:2336	0	0.00	0
+phiX174:2337	0	0.00	0
+phiX174:2338	0	0.00	0
+phiX174:2339	0	0.00	0
+phiX174:2340	0	0.00	0
+phiX174:2341	0	0.00	0
+phiX174:2342	0	0.00	0
+phiX174:2343	0	0.00	0
+phiX174:2344	0	0.00	0
+phiX174:2345	0	0.00	0
+phiX174:2346	0	0.00	0
+phiX174:2347	0	0.00	0
+phiX174:2348	0	0.00	0
+phiX174:2349	0	0.00	0
+phiX174:2350	0	0.00	0
+phiX174:2351	0	0.00	0
+phiX174:2352	0	0.00	0
+phiX174:2353	0	0.00	0
+phiX174:2354	0	0.00	0
+phiX174:2355	0	0.00	0
+phiX174:2356	0	0.00	0
+phiX174:2357	0	0.00	0
+phiX174:2358	0	0.00	0
+phiX174:2359	0	0.00	0
+phiX174:2360	0	0.00	0
+phiX174:2361	0	0.00	0
+phiX174:2362	0	0.00	0
+phiX174:2363	0	0.00	0
+phiX174:2364	0	0.00	0
+phiX174:2365	0	0.00	0
+phiX174:2366	0	0.00	0
+phiX174:2367	0	0.00	0
+phiX174:2368	0	0.00	0
+phiX174:2369	0	0.00	0
+phiX174:2370	0	0.00	0
+phiX174:2371	0	0.00	0
+phiX174:2372	0	0.00	0
+phiX174:2373	0	0.00	0
+phiX174:2374	0	0.00	0
+phiX174:2375	0	0.00	0
+phiX174:2376	0	0.00	0
+phiX174:2377	0	0.00	0
+phiX174:2378	0	0.00	0
+phiX174:2379	0	0.00	0
+phiX174:2380	0	0.00	0
+phiX174:2381	0	0.00	0
+phiX174:2382	0	0.00	0
+phiX174:2383	0	0.00	0
+phiX174:2384	0	0.00	0
+phiX174:2385	0	0.00	0
+phiX174:2386	0	0.00	0
+phiX174:2387	0	0.00	0
+phiX174:2388	0	0.00	0
+phiX174:2389	0	0.00	0
+phiX174:2390	0	0.00	0
+phiX174:2391	0	0.00	0
+phiX174:2392	0	0.00	0
+phiX174:2393	0	0.00	0
+phiX174:2394	0	0.00	0
+phiX174:2395	0	0.00	0
+phiX174:2396	0	0.00	0
+phiX174:2397	0	0.00	0
+phiX174:2398	0	0.00	0
+phiX174:2399	0	0.00	0
+phiX174:2400	0	0.00	0
+phiX174:2401	0	0.00	0
+phiX174:2402	0	0.00	0
+phiX174:2403	0	0.00	0
+phiX174:2404	0	0.00	0
+phiX174:2405	0	0.00	0
+phiX174:2406	0	0.00	0
+phiX174:2407	0	0.00	0
+phiX174:2408	0	0.00	0
+phiX174:2409	0	0.00	0
+phiX174:2410	0	0.00	0
+phiX174:2411	0	0.00	0
+phiX174:2412	0	0.00	0
+phiX174:2413	0	0.00	0
+phiX174:2414	0	0.00	0
+phiX174:2415	0	0.00	0
+phiX174:2416	0	0.00	0
+phiX174:2417	0	0.00	0
+phiX174:2418	0	0.00	0
+phiX174:2419	0	0.00	0
+phiX174:2420	0	0.00	0
+phiX174:2421	0	0.00	0
+phiX174:2422	0	0.00	0
+phiX174:2423	0	0.00	0
+phiX174:2424	0	0.00	0
+phiX174:2425	0	0.00	0
+phiX174:2426	0	0.00	0
+phiX174:2427	0	0.00	0
+phiX174:2428	0	0.00	0
+phiX174:2429	0	0.00	0
+phiX174:2430	0	0.00	0
+phiX174:2431	0	0.00	0
+phiX174:2432	0	0.00	0
+phiX174:2433	0	0.00	0
+phiX174:2434	0	0.00	0
+phiX174:2435	0	0.00	0
+phiX174:2436	0	0.00	0
+phiX174:2437	0	0.00	0
+phiX174:2438	0	0.00	0
+phiX174:2439	0	0.00	0
+phiX174:2440	0	0.00	0
+phiX174:2441	0	0.00	0
+phiX174:2442	0	0.00	0
+phiX174:2443	0	0.00	0
+phiX174:2444	0	0.00	0
+phiX174:2445	0	0.00	0
+phiX174:2446	0	0.00	0
+phiX174:2447	0	0.00	0
+phiX174:2448	0	0.00	0
+phiX174:2449	0	0.00	0
+phiX174:2450	0	0.00	0
+phiX174:2451	0	0.00	0
+phiX174:2452	0	0.00	0
+phiX174:2453	0	0.00	0
+phiX174:2454	0	0.00	0
+phiX174:2455	0	0.00	0
+phiX174:2456	0	0.00	0
+phiX174:2457	0	0.00	0
+phiX174:2458	0	0.00	0
+phiX174:2459	0	0.00	0
+phiX174:2460	0	0.00	0
+phiX174:2461	0	0.00	0
+phiX174:2462	0	0.00	0
+phiX174:2463	0	0.00	0
+phiX174:2464	0	0.00	0
+phiX174:2465	0	0.00	0
+phiX174:2466	0	0.00	0
+phiX174:2467	0	0.00	0
+phiX174:2468	0	0.00	0
+phiX174:2469	0	0.00	0
+phiX174:2470	0	0.00	0
+phiX174:2471	0	0.00	0
+phiX174:2472	0	0.00	0
+phiX174:2473	0	0.00	0
+phiX174:2474	0	0.00	0
+phiX174:2475	0	0.00	0
+phiX174:2476	0	0.00	0
+phiX174:2477	0	0.00	0
+phiX174:2478	0	0.00	0
+phiX174:2479	0	0.00	0
+phiX174:2480	0	0.00	0
+phiX174:2481	0	0.00	0
+phiX174:2482	0	0.00	0
+phiX174:2483	0	0.00	0
+phiX174:2484	0	0.00	0
+phiX174:2485	0	0.00	0
+phiX174:2486	0	0.00	0
+phiX174:2487	0	0.00	0
+phiX174:2488	0	0.00	0
+phiX174:2489	0	0.00	0
+phiX174:2490	0	0.00	0
+phiX174:2491	0	0.00	0
+phiX174:2492	0	0.00	0
+phiX174:2493	0	0.00	0
+phiX174:2494	0	0.00	0
+phiX174:2495	0	0.00	0
+phiX174:2496	0	0.00	0
+phiX174:2497	0	0.00	0
+phiX174:2498	0	0.00	0
+phiX174:2499	0	0.00	0
+phiX174:2500	0	0.00	0
+phiX174:2501	0	0.00	0
+phiX174:2502	0	0.00	0
+phiX174:2503	0	0.00	0
+phiX174:2504	0	0.00	0
+phiX174:2505	0	0.00	0
+phiX174:2506	0	0.00	0
+phiX174:2507	0	0.00	0
+phiX174:2508	0	0.00	0
+phiX174:2509	0	0.00	0
+phiX174:2510	0	0.00	0
+phiX174:2511	0	0.00	0
+phiX174:2512	0	0.00	0
+phiX174:2513	0	0.00	0
+phiX174:2514	0	0.00	0
+phiX174:2515	0	0.00	0
+phiX174:2516	0	0.00	0
+phiX174:2517	0	0.00	0
+phiX174:2518	0	0.00	0
+phiX174:2519	0	0.00	0
+phiX174:2520	0	0.00	0
+phiX174:2521	0	0.00	0
+phiX174:2522	0	0.00	0
+phiX174:2523	0	0.00	0
+phiX174:2524	0	0.00	0
+phiX174:2525	0	0.00	0
+phiX174:2526	0	0.00	0
+phiX174:2527	0	0.00	0
+phiX174:2528	0	0.00	0
+phiX174:2529	0	0.00	0
+phiX174:2530	0	0.00	0
+phiX174:2531	0	0.00	0
+phiX174:2532	0	0.00	0
+phiX174:2533	0	0.00	0
+phiX174:2534	0	0.00	0
+phiX174:2535	0	0.00	0
+phiX174:2536	0	0.00	0
+phiX174:2537	0	0.00	0
+phiX174:2538	0	0.00	0
+phiX174:2539	0	0.00	0
+phiX174:2540	0	0.00	0
+phiX174:2541	0	0.00	0
+phiX174:2542	0	0.00	0
+phiX174:2543	0	0.00	0
+phiX174:2544	0	0.00	0
+phiX174:2545	0	0.00	0
+phiX174:2546	0	0.00	0
+phiX174:2547	0	0.00	0
+phiX174:2548	0	0.00	0
+phiX174:2549	0	0.00	0
+phiX174:2550	0	0.00	0
+phiX174:2551	0	0.00	0
+phiX174:2552	0	0.00	0
+phiX174:2553	0	0.00	0
+phiX174:2554	0	0.00	0
+phiX174:2555	0	0.00	0
+phiX174:2556	0	0.00	0
+phiX174:2557	0	0.00	0
+phiX174:2558	0	0.00	0
+phiX174:2559	0	0.00	0
+phiX174:2560	0	0.00	0
+phiX174:2561	0	0.00	0
+phiX174:2562	0	0.00	0
+phiX174:2563	0	0.00	0
+phiX174:2564	0	0.00	0
+phiX174:2565	0	0.00	0
+phiX174:2566	0	0.00	0
+phiX174:2567	0	0.00	0
+phiX174:2568	0	0.00	0
+phiX174:2569	0	0.00	0
+phiX174:2570	0	0.00	0
+phiX174:2571	0	0.00	0
+phiX174:2572	0	0.00	0
+phiX174:2573	0	0.00	0
+phiX174:2574	0	0.00	0
+phiX174:2575	0	0.00	0
+phiX174:2576	0	0.00	0
+phiX174:2577	0	0.00	0
+phiX174:2578	0	0.00	0
+phiX174:2579	0	0.00	0
+phiX174:2580	0	0.00	0
+phiX174:2581	0	0.00	0
+phiX174:2582	0	0.00	0
+phiX174:2583	0	0.00	0
+phiX174:2584	0	0.00	0
+phiX174:2585	0	0.00	0
+phiX174:2586	0	0.00	0
+phiX174:2587	0	0.00	0
+phiX174:2588	0	0.00	0
+phiX174:2589	0	0.00	0
+phiX174:2590	0	0.00	0
+phiX174:2591	0	0.00	0
+phiX174:2592	0	0.00	0
+phiX174:2593	0	0.00	0
+phiX174:2594	0	0.00	0
+phiX174:2595	0	0.00	0
+phiX174:2596	0	0.00	0
+phiX174:2597	0	0.00	0
+phiX174:2598	0	0.00	0
+phiX174:2599	0	0.00	0
+phiX174:2600	0	0.00	0
+phiX174:2601	0	0.00	0
+phiX174:2602	0	0.00	0
+phiX174:2603	0	0.00	0
+phiX174:2604	0	0.00	0
+phiX174:2605	0	0.00	0
+phiX174:2606	0	0.00	0
+phiX174:2607	0	0.00	0
+phiX174:2608	0	0.00	0
+phiX174:2609	0	0.00	0
+phiX174:2610	0	0.00	0
+phiX174:2611	0	0.00	0
+phiX174:2612	0	0.00	0
+phiX174:2613	0	0.00	0
+phiX174:2614	0	0.00	0
+phiX174:2615	0	0.00	0
+phiX174:2616	0	0.00	0
+phiX174:2617	0	0.00	0
+phiX174:2618	0	0.00	0
+phiX174:2619	0	0.00	0
+phiX174:2620	0	0.00	0
+phiX174:2621	0	0.00	0
+phiX174:2622	0	0.00	0
+phiX174:2623	0	0.00	0
+phiX174:2624	0	0.00	0
+phiX174:2625	0	0.00	0
+phiX174:2626	0	0.00	0
+phiX174:2627	0	0.00	0
+phiX174:2628	0	0.00	0
+phiX174:2629	0	0.00	0
+phiX174:2630	0	0.00	0
+phiX174:2631	0	0.00	0
+phiX174:2632	0	0.00	0
+phiX174:2633	0	0.00	0
+phiX174:2634	0	0.00	0
+phiX174:2635	0	0.00	0
+phiX174:2636	0	0.00	0
+phiX174:2637	0	0.00	0
+phiX174:2638	0	0.00	0
+phiX174:2639	0	0.00	0
+phiX174:2640	0	0.00	0
+phiX174:2641	0	0.00	0
+phiX174:2642	0	0.00	0
+phiX174:2643	0	0.00	0
+phiX174:2644	0	0.00	0
+phiX174:2645	0	0.00	0
+phiX174:2646	0	0.00	0
+phiX174:2647	0	0.00	0
+phiX174:2648	0	0.00	0
+phiX174:2649	0	0.00	0
+phiX174:2650	0	0.00	0
+phiX174:2651	0	0.00	0
+phiX174:2652	0	0.00	0
+phiX174:2653	0	0.00	0
+phiX174:2654	0	0.00	0
+phiX174:2655	0	0.00	0
+phiX174:2656	0	0.00	0
+phiX174:2657	0	0.00	0
+phiX174:2658	0	0.00	0
+phiX174:2659	0	0.00	0
+phiX174:2660	0	0.00	0
+phiX174:2661	0	0.00	0
+phiX174:2662	0	0.00	0
+phiX174:2663	0	0.00	0
+phiX174:2664	0	0.00	0
+phiX174:2665	0	0.00	0
+phiX174:2666	0	0.00	0
+phiX174:2667	0	0.00	0
+phiX174:2668	0	0.00	0
+phiX174:2669	0	0.00	0
+phiX174:2670	0	0.00	0
+phiX174:2671	0	0.00	0
+phiX174:2672	0	0.00	0
+phiX174:2673	0	0.00	0
+phiX174:2674	0	0.00	0
+phiX174:2675	0	0.00	0
+phiX174:2676	0	0.00	0
+phiX174:2677	0	0.00	0
+phiX174:2678	0	0.00	0
+phiX174:2679	0	0.00	0
+phiX174:2680	0	0.00	0
+phiX174:2681	0	0.00	0
+phiX174:2682	0	0.00	0
+phiX174:2683	0	0.00	0
+phiX174:2684	0	0.00	0
+phiX174:2685	0	0.00	0
+phiX174:2686	0	0.00	0
+phiX174:2687	0	0.00	0
+phiX174:2688	0	0.00	0
+phiX174:2689	0	0.00	0
+phiX174:2690	0	0.00	0
+phiX174:2691	0	0.00	0
+phiX174:2692	0	0.00	0
+phiX174:2693	0	0.00	0
+phiX174:2694	0	0.00	0
+phiX174:2695	0	0.00	0
+phiX174:2696	0	0.00	0
+phiX174:2697	0	0.00	0
+phiX174:2698	0	0.00	0
+phiX174:2699	0	0.00	0
+phiX174:2700	0	0.00	0
+phiX174:2701	0	0.00	0
+phiX174:2702	0	0.00	0
+phiX174:2703	0	0.00	0
+phiX174:2704	0	0.00	0
+phiX174:2705	0	0.00	0
+phiX174:2706	0	0.00	0
+phiX174:2707	0	0.00	0
+phiX174:2708	0	0.00	0
+phiX174:2709	0	0.00	0
+phiX174:2710	0	0.00	0
+phiX174:2711	0	0.00	0
+phiX174:2712	0	0.00	0
+phiX174:2713	0	0.00	0
+phiX174:2714	0	0.00	0
+phiX174:2715	0	0.00	0
+phiX174:2716	0	0.00	0
+phiX174:2717	0	0.00	0
+phiX174:2718	0	0.00	0
+phiX174:2719	0	0.00	0
+phiX174:2720	0	0.00	0
+phiX174:2721	0	0.00	0
+phiX174:2722	0	0.00	0
+phiX174:2723	0	0.00	0
+phiX174:2724	0	0.00	0
+phiX174:2725	0	0.00	0
+phiX174:2726	0	0.00	0
+phiX174:2727	0	0.00	0
+phiX174:2728	0	0.00	0
+phiX174:2729	0	0.00	0
+phiX174:2730	0	0.00	0
+phiX174:2731	0	0.00	0
+phiX174:2732	0	0.00	0
+phiX174:2733	0	0.00	0
+phiX174:2734	0	0.00	0
+phiX174:2735	0	0.00	0
+phiX174:2736	0	0.00	0
+phiX174:2737	0	0.00	0
+phiX174:2738	0	0.00	0
+phiX174:2739	0	0.00	0
+phiX174:2740	0	0.00	0
+phiX174:2741	0	0.00	0
+phiX174:2742	0	0.00	0
+phiX174:2743	0	0.00	0
+phiX174:2744	0	0.00	0
+phiX174:2745	0	0.00	0
+phiX174:2746	0	0.00	0
+phiX174:2747	0	0.00	0
+phiX174:2748	0	0.00	0
+phiX174:2749	0	0.00	0
+phiX174:2750	0	0.00	0
+phiX174:2751	0	0.00	0
+phiX174:2752	0	0.00	0
+phiX174:2753	0	0.00	0
+phiX174:2754	0	0.00	0
+phiX174:2755	0	0.00	0
+phiX174:2756	0	0.00	0
+phiX174:2757	0	0.00	0
+phiX174:2758	0	0.00	0
+phiX174:2759	0	0.00	0
+phiX174:2760	0	0.00	0
+phiX174:2761	0	0.00	0
+phiX174:2762	0	0.00	0
+phiX174:2763	0	0.00	0
+phiX174:2764	0	0.00	0
+phiX174:2765	0	0.00	0
+phiX174:2766	0	0.00	0
+phiX174:2767	0	0.00	0
+phiX174:2768	0	0.00	0
+phiX174:2769	0	0.00	0
+phiX174:2770	0	0.00	0
+phiX174:2771	0	0.00	0
+phiX174:2772	0	0.00	0
+phiX174:2773	0	0.00	0
+phiX174:2774	0	0.00	0
+phiX174:2775	0	0.00	0
+phiX174:2776	0	0.00	0
+phiX174:2777	0	0.00	0
+phiX174:2778	0	0.00	0
+phiX174:2779	0	0.00	0
+phiX174:2780	0	0.00	0
+phiX174:2781	0	0.00	0
+phiX174:2782	0	0.00	0
+phiX174:2783	0	0.00	0
+phiX174:2784	0	0.00	0
+phiX174:2785	0	0.00	0
+phiX174:2786	0	0.00	0
+phiX174:2787	0	0.00	0
+phiX174:2788	0	0.00	0
+phiX174:2789	0	0.00	0
+phiX174:2790	0	0.00	0
+phiX174:2791	0	0.00	0
+phiX174:2792	0	0.00	0
+phiX174:2793	0	0.00	0
+phiX174:2794	0	0.00	0
+phiX174:2795	0	0.00	0
+phiX174:2796	0	0.00	0
+phiX174:2797	0	0.00	0
+phiX174:2798	0	0.00	0
+phiX174:2799	0	0.00	0
+phiX174:2800	0	0.00	0
+phiX174:2801	0	0.00	0
+phiX174:2802	0	0.00	0
+phiX174:2803	0	0.00	0
+phiX174:2804	0	0.00	0
+phiX174:2805	0	0.00	0
+phiX174:2806	0	0.00	0
+phiX174:2807	0	0.00	0
+phiX174:2808	0	0.00	0
+phiX174:2809	0	0.00	0
+phiX174:2810	0	0.00	0
+phiX174:2811	0	0.00	0
+phiX174:2812	0	0.00	0
+phiX174:2813	0	0.00	0
+phiX174:2814	0	0.00	0
+phiX174:2815	0	0.00	0
+phiX174:2816	0	0.00	0
+phiX174:2817	0	0.00	0
+phiX174:2818	0	0.00	0
+phiX174:2819	0	0.00	0
+phiX174:2820	0	0.00	0
+phiX174:2821	0	0.00	0
+phiX174:2822	0	0.00	0
+phiX174:2823	0	0.00	0
+phiX174:2824	0	0.00	0
+phiX174:2825	0	0.00	0
+phiX174:2826	0	0.00	0
+phiX174:2827	0	0.00	0
+phiX174:2828	0	0.00	0
+phiX174:2829	0	0.00	0
+phiX174:2830	0	0.00	0
+phiX174:2831	0	0.00	0
+phiX174:2832	0	0.00	0
+phiX174:2833	0	0.00	0
+phiX174:2834	0	0.00	0
+phiX174:2835	0	0.00	0
+phiX174:2836	0	0.00	0
+phiX174:2837	0	0.00	0
+phiX174:2838	0	0.00	0
+phiX174:2839	0	0.00	0
+phiX174:2840	0	0.00	0
+phiX174:2841	0	0.00	0
+phiX174:2842	0	0.00	0
+phiX174:2843	0	0.00	0
+phiX174:2844	0	0.00	0
+phiX174:2845	0	0.00	0
+phiX174:2846	0	0.00	0
+phiX174:2847	0	0.00	0
+phiX174:2848	0	0.00	0
+phiX174:2849	0	0.00	0
+phiX174:2850	0	0.00	0
+phiX174:2851	0	0.00	0
+phiX174:2852	0	0.00	0
+phiX174:2853	0	0.00	0
+phiX174:2854	0	0.00	0
+phiX174:2855	0	0.00	0
+phiX174:2856	0	0.00	0
+phiX174:2857	0	0.00	0
+phiX174:2858	0	0.00	0
+phiX174:2859	0	0.00	0
+phiX174:2860	0	0.00	0
+phiX174:2861	0	0.00	0
+phiX174:2862	0	0.00	0
+phiX174:2863	0	0.00	0
+phiX174:2864	0	0.00	0
+phiX174:2865	0	0.00	0
+phiX174:2866	0	0.00	0
+phiX174:2867	0	0.00	0
+phiX174:2868	0	0.00	0
+phiX174:2869	0	0.00	0
+phiX174:2870	0	0.00	0
+phiX174:2871	0	0.00	0
+phiX174:2872	0	0.00	0
+phiX174:2873	0	0.00	0
+phiX174:2874	0	0.00	0
+phiX174:2875	0	0.00	0
+phiX174:2876	0	0.00	0
+phiX174:2877	0	0.00	0
+phiX174:2878	0	0.00	0
+phiX174:2879	0	0.00	0
+phiX174:2880	0	0.00	0
+phiX174:2881	0	0.00	0
+phiX174:2882	0	0.00	0
+phiX174:2883	0	0.00	0
+phiX174:2884	0	0.00	0
+phiX174:2885	0	0.00	0
+phiX174:2886	0	0.00	0
+phiX174:2887	0	0.00	0
+phiX174:2888	0	0.00	0
+phiX174:2889	0	0.00	0
+phiX174:2890	0	0.00	0
+phiX174:2891	0	0.00	0
+phiX174:2892	0	0.00	0
+phiX174:2893	0	0.00	0
+phiX174:2894	0	0.00	0
+phiX174:2895	0	0.00	0
+phiX174:2896	0	0.00	0
+phiX174:2897	0	0.00	0
+phiX174:2898	0	0.00	0
+phiX174:2899	0	0.00	0
+phiX174:2900	0	0.00	0
+phiX174:2901	0	0.00	0
+phiX174:2902	0	0.00	0
+phiX174:2903	0	0.00	0
+phiX174:2904	0	0.00	0
+phiX174:2905	0	0.00	0
+phiX174:2906	0	0.00	0
+phiX174:2907	0	0.00	0
+phiX174:2908	0	0.00	0
+phiX174:2909	0	0.00	0
+phiX174:2910	0	0.00	0
+phiX174:2911	0	0.00	0
+phiX174:2912	0	0.00	0
+phiX174:2913	0	0.00	0
+phiX174:2914	0	0.00	0
+phiX174:2915	0	0.00	0
+phiX174:2916	0	0.00	0
+phiX174:2917	0	0.00	0
+phiX174:2918	0	0.00	0
+phiX174:2919	0	0.00	0
+phiX174:2920	0	0.00	0
+phiX174:2921	0	0.00	0
+phiX174:2922	0	0.00	0
+phiX174:2923	0	0.00	0
+phiX174:2924	0	0.00	0
+phiX174:2925	0	0.00	0
+phiX174:2926	0	0.00	0
+phiX174:2927	0	0.00	0
+phiX174:2928	0	0.00	0
+phiX174:2929	0	0.00	0
+phiX174:2930	0	0.00	0
+phiX174:2931	0	0.00	0
+phiX174:2932	0	0.00	0
+phiX174:2933	0	0.00	0
+phiX174:2934	0	0.00	0
+phiX174:2935	0	0.00	0
+phiX174:2936	0	0.00	0
+phiX174:2937	0	0.00	0
+phiX174:2938	0	0.00	0
+phiX174:2939	0	0.00	0
+phiX174:2940	0	0.00	0
+phiX174:2941	0	0.00	0
+phiX174:2942	0	0.00	0
+phiX174:2943	0	0.00	0
+phiX174:2944	0	0.00	0
+phiX174:2945	0	0.00	0
+phiX174:2946	0	0.00	0
+phiX174:2947	0	0.00	0
+phiX174:2948	0	0.00	0
+phiX174:2949	0	0.00	0
+phiX174:2950	0	0.00	0
+phiX174:2951	0	0.00	0
+phiX174:2952	0	0.00	0
+phiX174:2953	0	0.00	0
+phiX174:2954	0	0.00	0
+phiX174:2955	0	0.00	0
+phiX174:2956	0	0.00	0
+phiX174:2957	0	0.00	0
+phiX174:2958	0	0.00	0
+phiX174:2959	0	0.00	0
+phiX174:2960	0	0.00	0
+phiX174:2961	0	0.00	0
+phiX174:2962	0	0.00	0
+phiX174:2963	0	0.00	0
+phiX174:2964	0	0.00	0
+phiX174:2965	0	0.00	0
+phiX174:2966	0	0.00	0
+phiX174:2967	0	0.00	0
+phiX174:2968	0	0.00	0
+phiX174:2969	0	0.00	0
+phiX174:2970	0	0.00	0
+phiX174:2971	0	0.00	0
+phiX174:2972	0	0.00	0
+phiX174:2973	0	0.00	0
+phiX174:2974	0	0.00	0
+phiX174:2975	0	0.00	0
+phiX174:2976	0	0.00	0
+phiX174:2977	0	0.00	0
+phiX174:2978	0	0.00	0
+phiX174:2979	0	0.00	0
+phiX174:2980	0	0.00	0
+phiX174:2981	0	0.00	0
+phiX174:2982	0	0.00	0
+phiX174:2983	0	0.00	0
+phiX174:2984	0	0.00	0
+phiX174:2985	0	0.00	0
+phiX174:2986	0	0.00	0
+phiX174:2987	0	0.00	0
+phiX174:2988	0	0.00	0
+phiX174:2989	0	0.00	0
+phiX174:2990	0	0.00	0
+phiX174:2991	0	0.00	0
+phiX174:2992	0	0.00	0
+phiX174:2993	0	0.00	0
+phiX174:2994	0	0.00	0
+phiX174:2995	0	0.00	0
+phiX174:2996	0	0.00	0
+phiX174:2997	0	0.00	0
+phiX174:2998	0	0.00	0
+phiX174:2999	0	0.00	0
+phiX174:3000	0	0.00	0
+phiX174:3001	0	0.00	0
+phiX174:3002	0	0.00	0
+phiX174:3003	0	0.00	0
+phiX174:3004	0	0.00	0
+phiX174:3005	0	0.00	0
+phiX174:3006	0	0.00	0
+phiX174:3007	0	0.00	0
+phiX174:3008	0	0.00	0
+phiX174:3009	0	0.00	0
+phiX174:3010	0	0.00	0
+phiX174:3011	0	0.00	0
+phiX174:3012	0	0.00	0
+phiX174:3013	0	0.00	0
+phiX174:3014	0	0.00	0
+phiX174:3015	0	0.00	0
+phiX174:3016	0	0.00	0
+phiX174:3017	0	0.00	0
+phiX174:3018	0	0.00	0
+phiX174:3019	0	0.00	0
+phiX174:3020	0	0.00	0
+phiX174:3021	0	0.00	0
+phiX174:3022	0	0.00	0
+phiX174:3023	0	0.00	0
+phiX174:3024	0	0.00	0
+phiX174:3025	0	0.00	0
+phiX174:3026	0	0.00	0
+phiX174:3027	0	0.00	0
+phiX174:3028	0	0.00	0
+phiX174:3029	0	0.00	0
+phiX174:3030	0	0.00	0
+phiX174:3031	0	0.00	0
+phiX174:3032	0	0.00	0
+phiX174:3033	0	0.00	0
+phiX174:3034	0	0.00	0
+phiX174:3035	0	0.00	0
+phiX174:3036	0	0.00	0
+phiX174:3037	0	0.00	0
+phiX174:3038	0	0.00	0
+phiX174:3039	0	0.00	0
+phiX174:3040	0	0.00	0
+phiX174:3041	0	0.00	0
+phiX174:3042	0	0.00	0
+phiX174:3043	0	0.00	0
+phiX174:3044	0	0.00	0
+phiX174:3045	0	0.00	0
+phiX174:3046	0	0.00	0
+phiX174:3047	0	0.00	0
+phiX174:3048	0	0.00	0
+phiX174:3049	0	0.00	0
+phiX174:3050	0	0.00	0
+phiX174:3051	0	0.00	0
+phiX174:3052	0	0.00	0
+phiX174:3053	0	0.00	0
+phiX174:3054	0	0.00	0
+phiX174:3055	0	0.00	0
+phiX174:3056	0	0.00	0
+phiX174:3057	0	0.00	0
+phiX174:3058	0	0.00	0
+phiX174:3059	0	0.00	0
+phiX174:3060	0	0.00	0
+phiX174:3061	0	0.00	0
+phiX174:3062	0	0.00	0
+phiX174:3063	0	0.00	0
+phiX174:3064	0	0.00	0
+phiX174:3065	0	0.00	0
+phiX174:3066	0	0.00	0
+phiX174:3067	0	0.00	0
+phiX174:3068	0	0.00	0
+phiX174:3069	0	0.00	0
+phiX174:3070	0	0.00	0
+phiX174:3071	0	0.00	0
+phiX174:3072	0	0.00	0
+phiX174:3073	0	0.00	0
+phiX174:3074	0	0.00	0
+phiX174:3075	0	0.00	0
+phiX174:3076	0	0.00	0
+phiX174:3077	0	0.00	0
+phiX174:3078	0	0.00	0
+phiX174:3079	0	0.00	0
+phiX174:3080	0	0.00	0
+phiX174:3081	0	0.00	0
+phiX174:3082	0	0.00	0
+phiX174:3083	0	0.00	0
+phiX174:3084	0	0.00	0
+phiX174:3085	0	0.00	0
+phiX174:3086	0	0.00	0
+phiX174:3087	0	0.00	0
+phiX174:3088	0	0.00	0
+phiX174:3089	0	0.00	0
+phiX174:3090	0	0.00	0
+phiX174:3091	0	0.00	0
+phiX174:3092	0	0.00	0
+phiX174:3093	0	0.00	0
+phiX174:3094	0	0.00	0
+phiX174:3095	0	0.00	0
+phiX174:3096	0	0.00	0
+phiX174:3097	0	0.00	0
+phiX174:3098	0	0.00	0
+phiX174:3099	0	0.00	0
+phiX174:3100	0	0.00	0
+phiX174:3101	0	0.00	0
+phiX174:3102	0	0.00	0
+phiX174:3103	0	0.00	0
+phiX174:3104	0	0.00	0
+phiX174:3105	0	0.00	0
+phiX174:3106	0	0.00	0
+phiX174:3107	0	0.00	0
+phiX174:3108	0	0.00	0
+phiX174:3109	0	0.00	0
+phiX174:3110	0	0.00	0
+phiX174:3111	0	0.00	0
+phiX174:3112	0	0.00	0
+phiX174:3113	0	0.00	0
+phiX174:3114	0	0.00	0
+phiX174:3115	0	0.00	0
+phiX174:3116	0	0.00	0
+phiX174:3117	0	0.00	0
+phiX174:3118	0	0.00	0
+phiX174:3119	0	0.00	0
+phiX174:3120	0	0.00	0
+phiX174:3121	0	0.00	0
+phiX174:3122	0	0.00	0
+phiX174:3123	0	0.00	0
+phiX174:3124	0	0.00	0
+phiX174:3125	0	0.00	0
+phiX174:3126	0	0.00	0
+phiX174:3127	0	0.00	0
+phiX174:3128	0	0.00	0
+phiX174:3129	0	0.00	0
+phiX174:3130	0	0.00	0
+phiX174:3131	0	0.00	0
+phiX174:3132	0	0.00	0
+phiX174:3133	0	0.00	0
+phiX174:3134	0	0.00	0
+phiX174:3135	0	0.00	0
+phiX174:3136	0	0.00	0
+phiX174:3137	0	0.00	0
+phiX174:3138	0	0.00	0
+phiX174:3139	0	0.00	0
+phiX174:3140	0	0.00	0
+phiX174:3141	0	0.00	0
+phiX174:3142	0	0.00	0
+phiX174:3143	0	0.00	0
+phiX174:3144	0	0.00	0
+phiX174:3145	0	0.00	0
+phiX174:3146	0	0.00	0
+phiX174:3147	0	0.00	0
+phiX174:3148	0	0.00	0
+phiX174:3149	0	0.00	0
+phiX174:3150	0	0.00	0
+phiX174:3151	0	0.00	0
+phiX174:3152	0	0.00	0
+phiX174:3153	0	0.00	0
+phiX174:3154	0	0.00	0
+phiX174:3155	0	0.00	0
+phiX174:3156	0	0.00	0
+phiX174:3157	0	0.00	0
+phiX174:3158	0	0.00	0
+phiX174:3159	0	0.00	0
+phiX174:3160	0	0.00	0
+phiX174:3161	0	0.00	0
+phiX174:3162	0	0.00	0
+phiX174:3163	0	0.00	0
+phiX174:3164	0	0.00	0
+phiX174:3165	0	0.00	0
+phiX174:3166	0	0.00	0
+phiX174:3167	0	0.00	0
+phiX174:3168	0	0.00	0
+phiX174:3169	0	0.00	0
+phiX174:3170	0	0.00	0
+phiX174:3171	0	0.00	0
+phiX174:3172	0	0.00	0
+phiX174:3173	0	0.00	0
+phiX174:3174	0	0.00	0
+phiX174:3175	0	0.00	0
+phiX174:3176	0	0.00	0
+phiX174:3177	0	0.00	0
+phiX174:3178	0	0.00	0
+phiX174:3179	0	0.00	0
+phiX174:3180	0	0.00	0
+phiX174:3181	0	0.00	0
+phiX174:3182	0	0.00	0
+phiX174:3183	0	0.00	0
+phiX174:3184	0	0.00	0
+phiX174:3185	0	0.00	0
+phiX174:3186	0	0.00	0
+phiX174:3187	0	0.00	0
+phiX174:3188	0	0.00	0
+phiX174:3189	0	0.00	0
+phiX174:3190	0	0.00	0
+phiX174:3191	0	0.00	0
+phiX174:3192	0	0.00	0
+phiX174:3193	0	0.00	0
+phiX174:3194	0	0.00	0
+phiX174:3195	0	0.00	0
+phiX174:3196	0	0.00	0
+phiX174:3197	0	0.00	0
+phiX174:3198	0	0.00	0
+phiX174:3199	0	0.00	0
+phiX174:3200	0	0.00	0
+phiX174:3201	0	0.00	0
+phiX174:3202	0	0.00	0
+phiX174:3203	0	0.00	0
+phiX174:3204	0	0.00	0
+phiX174:3205	0	0.00	0
+phiX174:3206	0	0.00	0
+phiX174:3207	0	0.00	0
+phiX174:3208	0	0.00	0
+phiX174:3209	0	0.00	0
+phiX174:3210	0	0.00	0
+phiX174:3211	0	0.00	0
+phiX174:3212	0	0.00	0
+phiX174:3213	0	0.00	0
+phiX174:3214	0	0.00	0
+phiX174:3215	0	0.00	0
+phiX174:3216	0	0.00	0
+phiX174:3217	0	0.00	0
+phiX174:3218	0	0.00	0
+phiX174:3219	0	0.00	0
+phiX174:3220	0	0.00	0
+phiX174:3221	0	0.00	0
+phiX174:3222	0	0.00	0
+phiX174:3223	0	0.00	0
+phiX174:3224	0	0.00	0
+phiX174:3225	0	0.00	0
+phiX174:3226	0	0.00	0
+phiX174:3227	0	0.00	0
+phiX174:3228	0	0.00	0
+phiX174:3229	0	0.00	0
+phiX174:3230	0	0.00	0
+phiX174:3231	0	0.00	0
+phiX174:3232	0	0.00	0
+phiX174:3233	0	0.00	0
+phiX174:3234	0	0.00	0
+phiX174:3235	0	0.00	0
+phiX174:3236	0	0.00	0
+phiX174:3237	0	0.00	0
+phiX174:3238	0	0.00	0
+phiX174:3239	0	0.00	0
+phiX174:3240	0	0.00	0
+phiX174:3241	0	0.00	0
+phiX174:3242	0	0.00	0
+phiX174:3243	0	0.00	0
+phiX174:3244	0	0.00	0
+phiX174:3245	0	0.00	0
+phiX174:3246	0	0.00	0
+phiX174:3247	0	0.00	0
+phiX174:3248	0	0.00	0
+phiX174:3249	0	0.00	0
+phiX174:3250	0	0.00	0
+phiX174:3251	0	0.00	0
+phiX174:3252	0	0.00	0
+phiX174:3253	0	0.00	0
+phiX174:3254	0	0.00	0
+phiX174:3255	0	0.00	0
+phiX174:3256	0	0.00	0
+phiX174:3257	0	0.00	0
+phiX174:3258	0	0.00	0
+phiX174:3259	0	0.00	0
+phiX174:3260	0	0.00	0
+phiX174:3261	0	0.00	0
+phiX174:3262	0	0.00	0
+phiX174:3263	0	0.00	0
+phiX174:3264	0	0.00	0
+phiX174:3265	0	0.00	0
+phiX174:3266	0	0.00	0
+phiX174:3267	0	0.00	0
+phiX174:3268	0	0.00	0
+phiX174:3269	0	0.00	0
+phiX174:3270	0	0.00	0
+phiX174:3271	0	0.00	0
+phiX174:3272	0	0.00	0
+phiX174:3273	0	0.00	0
+phiX174:3274	0	0.00	0
+phiX174:3275	0	0.00	0
+phiX174:3276	0	0.00	0
+phiX174:3277	0	0.00	0
+phiX174:3278	0	0.00	0
+phiX174:3279	0	0.00	0
+phiX174:3280	0	0.00	0
+phiX174:3281	0	0.00	0
+phiX174:3282	0	0.00	0
+phiX174:3283	0	0.00	0
+phiX174:3284	0	0.00	0
+phiX174:3285	0	0.00	0
+phiX174:3286	0	0.00	0
+phiX174:3287	0	0.00	0
+phiX174:3288	0	0.00	0
+phiX174:3289	0	0.00	0
+phiX174:3290	0	0.00	0
+phiX174:3291	0	0.00	0
+phiX174:3292	0	0.00	0
+phiX174:3293	0	0.00	0
+phiX174:3294	0	0.00	0
+phiX174:3295	0	0.00	0
+phiX174:3296	0	0.00	0
+phiX174:3297	0	0.00	0
+phiX174:3298	0	0.00	0
+phiX174:3299	0	0.00	0
+phiX174:3300	0	0.00	0
+phiX174:3301	0	0.00	0
+phiX174:3302	0	0.00	0
+phiX174:3303	0	0.00	0
+phiX174:3304	0	0.00	0
+phiX174:3305	0	0.00	0
+phiX174:3306	0	0.00	0
+phiX174:3307	0	0.00	0
+phiX174:3308	0	0.00	0
+phiX174:3309	0	0.00	0
+phiX174:3310	0	0.00	0
+phiX174:3311	0	0.00	0
+phiX174:3312	0	0.00	0
+phiX174:3313	0	0.00	0
+phiX174:3314	0	0.00	0
+phiX174:3315	0	0.00	0
+phiX174:3316	0	0.00	0
+phiX174:3317	0	0.00	0
+phiX174:3318	0	0.00	0
+phiX174:3319	0	0.00	0
+phiX174:3320	0	0.00	0
+phiX174:3321	0	0.00	0
+phiX174:3322	0	0.00	0
+phiX174:3323	0	0.00	0
+phiX174:3324	0	0.00	0
+phiX174:3325	0	0.00	0
+phiX174:3326	0	0.00	0
+phiX174:3327	0	0.00	0
+phiX174:3328	0	0.00	0
+phiX174:3329	0	0.00	0
+phiX174:3330	0	0.00	0
+phiX174:3331	0	0.00	0
+phiX174:3332	0	0.00	0
+phiX174:3333	0	0.00	0
+phiX174:3334	0	0.00	0
+phiX174:3335	0	0.00	0
+phiX174:3336	0	0.00	0
+phiX174:3337	0	0.00	0
+phiX174:3338	0	0.00	0
+phiX174:3339	0	0.00	0
+phiX174:3340	0	0.00	0
+phiX174:3341	0	0.00	0
+phiX174:3342	0	0.00	0
+phiX174:3343	0	0.00	0
+phiX174:3344	0	0.00	0
+phiX174:3345	0	0.00	0
+phiX174:3346	0	0.00	0
+phiX174:3347	0	0.00	0
+phiX174:3348	0	0.00	0
+phiX174:3349	0	0.00	0
+phiX174:3350	0	0.00	0
+phiX174:3351	0	0.00	0
+phiX174:3352	0	0.00	0
+phiX174:3353	0	0.00	0
+phiX174:3354	0	0.00	0
+phiX174:3355	0	0.00	0
+phiX174:3356	0	0.00	0
+phiX174:3357	0	0.00	0
+phiX174:3358	0	0.00	0
+phiX174:3359	0	0.00	0
+phiX174:3360	0	0.00	0
+phiX174:3361	0	0.00	0
+phiX174:3362	0	0.00	0
+phiX174:3363	0	0.00	0
+phiX174:3364	0	0.00	0
+phiX174:3365	0	0.00	0
+phiX174:3366	0	0.00	0
+phiX174:3367	0	0.00	0
+phiX174:3368	0	0.00	0
+phiX174:3369	0	0.00	0
+phiX174:3370	0	0.00	0
+phiX174:3371	0	0.00	0
+phiX174:3372	0	0.00	0
+phiX174:3373	0	0.00	0
+phiX174:3374	0	0.00	0
+phiX174:3375	0	0.00	0
+phiX174:3376	0	0.00	0
+phiX174:3377	0	0.00	0
+phiX174:3378	0	0.00	0
+phiX174:3379	0	0.00	0
+phiX174:3380	0	0.00	0
+phiX174:3381	0	0.00	0
+phiX174:3382	0	0.00	0
+phiX174:3383	0	0.00	0
+phiX174:3384	0	0.00	0
+phiX174:3385	0	0.00	0
+phiX174:3386	0	0.00	0
+phiX174:3387	0	0.00	0
+phiX174:3388	0	0.00	0
+phiX174:3389	0	0.00	0
+phiX174:3390	0	0.00	0
+phiX174:3391	0	0.00	0
+phiX174:3392	0	0.00	0
+phiX174:3393	0	0.00	0
+phiX174:3394	0	0.00	0
+phiX174:3395	0	0.00	0
+phiX174:3396	0	0.00	0
+phiX174:3397	0	0.00	0
+phiX174:3398	0	0.00	0
+phiX174:3399	0	0.00	0
+phiX174:3400	0	0.00	0
+phiX174:3401	0	0.00	0
+phiX174:3402	0	0.00	0
+phiX174:3403	0	0.00	0
+phiX174:3404	0	0.00	0
+phiX174:3405	0	0.00	0
+phiX174:3406	0	0.00	0
+phiX174:3407	0	0.00	0
+phiX174:3408	0	0.00	0
+phiX174:3409	0	0.00	0
+phiX174:3410	0	0.00	0
+phiX174:3411	0	0.00	0
+phiX174:3412	0	0.00	0
+phiX174:3413	0	0.00	0
+phiX174:3414	0	0.00	0
+phiX174:3415	0	0.00	0
+phiX174:3416	0	0.00	0
+phiX174:3417	0	0.00	0
+phiX174:3418	0	0.00	0
+phiX174:3419	0	0.00	0
+phiX174:3420	0	0.00	0
+phiX174:3421	0	0.00	0
+phiX174:3422	0	0.00	0
+phiX174:3423	0	0.00	0
+phiX174:3424	0	0.00	0
+phiX174:3425	0	0.00	0
+phiX174:3426	0	0.00	0
+phiX174:3427	0	0.00	0
+phiX174:3428	0	0.00	0
+phiX174:3429	0	0.00	0
+phiX174:3430	0	0.00	0
+phiX174:3431	0	0.00	0
+phiX174:3432	0	0.00	0
+phiX174:3433	0	0.00	0
+phiX174:3434	0	0.00	0
+phiX174:3435	0	0.00	0
+phiX174:3436	0	0.00	0
+phiX174:3437	0	0.00	0
+phiX174:3438	0	0.00	0
+phiX174:3439	0	0.00	0
+phiX174:3440	0	0.00	0
+phiX174:3441	0	0.00	0
+phiX174:3442	0	0.00	0
+phiX174:3443	0	0.00	0
+phiX174:3444	0	0.00	0
+phiX174:3445	0	0.00	0
+phiX174:3446	0	0.00	0
+phiX174:3447	0	0.00	0
+phiX174:3448	0	0.00	0
+phiX174:3449	0	0.00	0
+phiX174:3450	0	0.00	0
+phiX174:3451	0	0.00	0
+phiX174:3452	0	0.00	0
+phiX174:3453	0	0.00	0
+phiX174:3454	0	0.00	0
+phiX174:3455	0	0.00	0
+phiX174:3456	0	0.00	0
+phiX174:3457	0	0.00	0
+phiX174:3458	0	0.00	0
+phiX174:3459	0	0.00	0
+phiX174:3460	0	0.00	0
+phiX174:3461	0	0.00	0
+phiX174:3462	0	0.00	0
+phiX174:3463	0	0.00	0
+phiX174:3464	0	0.00	0
+phiX174:3465	0	0.00	0
+phiX174:3466	0	0.00	0
+phiX174:3467	0	0.00	0
+phiX174:3468	0	0.00	0
+phiX174:3469	0	0.00	0
+phiX174:3470	0	0.00	0
+phiX174:3471	0	0.00	0
+phiX174:3472	0	0.00	0
+phiX174:3473	0	0.00	0
+phiX174:3474	0	0.00	0
+phiX174:3475	0	0.00	0
+phiX174:3476	0	0.00	0
+phiX174:3477	0	0.00	0
+phiX174:3478	0	0.00	0
+phiX174:3479	0	0.00	0
+phiX174:3480	0	0.00	0
+phiX174:3481	0	0.00	0
+phiX174:3482	0	0.00	0
+phiX174:3483	0	0.00	0
+phiX174:3484	0	0.00	0
+phiX174:3485	0	0.00	0
+phiX174:3486	0	0.00	0
+phiX174:3487	0	0.00	0
+phiX174:3488	0	0.00	0
+phiX174:3489	0	0.00	0
+phiX174:3490	0	0.00	0
+phiX174:3491	0	0.00	0
+phiX174:3492	0	0.00	0
+phiX174:3493	0	0.00	0
+phiX174:3494	0	0.00	0
+phiX174:3495	0	0.00	0
+phiX174:3496	0	0.00	0
+phiX174:3497	0	0.00	0
+phiX174:3498	0	0.00	0
+phiX174:3499	0	0.00	0
+phiX174:3500	0	0.00	0
+phiX174:3501	0	0.00	0
+phiX174:3502	0	0.00	0
+phiX174:3503	0	0.00	0
+phiX174:3504	0	0.00	0
+phiX174:3505	0	0.00	0
+phiX174:3506	0	0.00	0
+phiX174:3507	0	0.00	0
+phiX174:3508	0	0.00	0
+phiX174:3509	0	0.00	0
+phiX174:3510	0	0.00	0
+phiX174:3511	0	0.00	0
+phiX174:3512	0	0.00	0
+phiX174:3513	0	0.00	0
+phiX174:3514	0	0.00	0
+phiX174:3515	0	0.00	0
+phiX174:3516	0	0.00	0
+phiX174:3517	0	0.00	0
+phiX174:3518	0	0.00	0
+phiX174:3519	0	0.00	0
+phiX174:3520	0	0.00	0
+phiX174:3521	0	0.00	0
+phiX174:3522	0	0.00	0
+phiX174:3523	0	0.00	0
+phiX174:3524	0	0.00	0
+phiX174:3525	0	0.00	0
+phiX174:3526	0	0.00	0
+phiX174:3527	0	0.00	0
+phiX174:3528	0	0.00	0
+phiX174:3529	0	0.00	0
+phiX174:3530	0	0.00	0
+phiX174:3531	0	0.00	0
+phiX174:3532	0	0.00	0
+phiX174:3533	0	0.00	0
+phiX174:3534	0	0.00	0
+phiX174:3535	0	0.00	0
+phiX174:3536	0	0.00	0
+phiX174:3537	0	0.00	0
+phiX174:3538	0	0.00	0
+phiX174:3539	0	0.00	0
+phiX174:3540	0	0.00	0
+phiX174:3541	0	0.00	0
+phiX174:3542	0	0.00	0
+phiX174:3543	0	0.00	0
+phiX174:3544	0	0.00	0
+phiX174:3545	0	0.00	0
+phiX174:3546	0	0.00	0
+phiX174:3547	0	0.00	0
+phiX174:3548	0	0.00	0
+phiX174:3549	0	0.00	0
+phiX174:3550	0	0.00	0
+phiX174:3551	0	0.00	0
+phiX174:3552	0	0.00	0
+phiX174:3553	0	0.00	0
+phiX174:3554	0	0.00	0
+phiX174:3555	0	0.00	0
+phiX174:3556	0	0.00	0
+phiX174:3557	0	0.00	0
+phiX174:3558	0	0.00	0
+phiX174:3559	0	0.00	0
+phiX174:3560	0	0.00	0
+phiX174:3561	0	0.00	0
+phiX174:3562	0	0.00	0
+phiX174:3563	0	0.00	0
+phiX174:3564	0	0.00	0
+phiX174:3565	0	0.00	0
+phiX174:3566	0	0.00	0
+phiX174:3567	0	0.00	0
+phiX174:3568	0	0.00	0
+phiX174:3569	0	0.00	0
+phiX174:3570	0	0.00	0
+phiX174:3571	0	0.00	0
+phiX174:3572	0	0.00	0
+phiX174:3573	0	0.00	0
+phiX174:3574	0	0.00	0
+phiX174:3575	0	0.00	0
+phiX174:3576	0	0.00	0
+phiX174:3577	0	0.00	0
+phiX174:3578	0	0.00	0
+phiX174:3579	0	0.00	0
+phiX174:3580	0	0.00	0
+phiX174:3581	0	0.00	0
+phiX174:3582	0	0.00	0
+phiX174:3583	0	0.00	0
+phiX174:3584	0	0.00	0
+phiX174:3585	0	0.00	0
+phiX174:3586	0	0.00	0
+phiX174:3587	0	0.00	0
+phiX174:3588	0	0.00	0
+phiX174:3589	0	0.00	0
+phiX174:3590	0	0.00	0
+phiX174:3591	0	0.00	0
+phiX174:3592	0	0.00	0
+phiX174:3593	0	0.00	0
+phiX174:3594	0	0.00	0
+phiX174:3595	0	0.00	0
+phiX174:3596	0	0.00	0
+phiX174:3597	0	0.00	0
+phiX174:3598	0	0.00	0
+phiX174:3599	0	0.00	0
+phiX174:3600	0	0.00	0
+phiX174:3601	0	0.00	0
+phiX174:3602	0	0.00	0
+phiX174:3603	0	0.00	0
+phiX174:3604	0	0.00	0
+phiX174:3605	0	0.00	0
+phiX174:3606	0	0.00	0
+phiX174:3607	0	0.00	0
+phiX174:3608	0	0.00	0
+phiX174:3609	0	0.00	0
+phiX174:3610	0	0.00	0
+phiX174:3611	0	0.00	0
+phiX174:3612	0	0.00	0
+phiX174:3613	0	0.00	0
+phiX174:3614	0	0.00	0
+phiX174:3615	0	0.00	0
+phiX174:3616	0	0.00	0
+phiX174:3617	0	0.00	0
+phiX174:3618	0	0.00	0
+phiX174:3619	0	0.00	0
+phiX174:3620	0	0.00	0
+phiX174:3621	0	0.00	0
+phiX174:3622	0	0.00	0
+phiX174:3623	0	0.00	0
+phiX174:3624	0	0.00	0
+phiX174:3625	0	0.00	0
+phiX174:3626	0	0.00	0
+phiX174:3627	0	0.00	0
+phiX174:3628	0	0.00	0
+phiX174:3629	0	0.00	0
+phiX174:3630	0	0.00	0
+phiX174:3631	0	0.00	0
+phiX174:3632	0	0.00	0
+phiX174:3633	0	0.00	0
+phiX174:3634	0	0.00	0
+phiX174:3635	0	0.00	0
+phiX174:3636	0	0.00	0
+phiX174:3637	0	0.00	0
+phiX174:3638	0	0.00	0
+phiX174:3639	0	0.00	0
+phiX174:3640	0	0.00	0
+phiX174:3641	0	0.00	0
+phiX174:3642	0	0.00	0
+phiX174:3643	0	0.00	0
+phiX174:3644	0	0.00	0
+phiX174:3645	0	0.00	0
+phiX174:3646	0	0.00	0
+phiX174:3647	0	0.00	0
+phiX174:3648	0	0.00	0
+phiX174:3649	0	0.00	0
+phiX174:3650	0	0.00	0
+phiX174:3651	0	0.00	0
+phiX174:3652	0	0.00	0
+phiX174:3653	0	0.00	0
+phiX174:3654	0	0.00	0
+phiX174:3655	0	0.00	0
+phiX174:3656	0	0.00	0
+phiX174:3657	0	0.00	0
+phiX174:3658	0	0.00	0
+phiX174:3659	0	0.00	0
+phiX174:3660	0	0.00	0
+phiX174:3661	0	0.00	0
+phiX174:3662	0	0.00	0
+phiX174:3663	0	0.00	0
+phiX174:3664	0	0.00	0
+phiX174:3665	0	0.00	0
+phiX174:3666	0	0.00	0
+phiX174:3667	0	0.00	0
+phiX174:3668	0	0.00	0
+phiX174:3669	0	0.00	0
+phiX174:3670	0	0.00	0
+phiX174:3671	0	0.00	0
+phiX174:3672	0	0.00	0
+phiX174:3673	0	0.00	0
+phiX174:3674	0	0.00	0
+phiX174:3675	0	0.00	0
+phiX174:3676	0	0.00	0
+phiX174:3677	0	0.00	0
+phiX174:3678	0	0.00	0
+phiX174:3679	0	0.00	0
+phiX174:3680	0	0.00	0
+phiX174:3681	0	0.00	0
+phiX174:3682	0	0.00	0
+phiX174:3683	0	0.00	0
+phiX174:3684	0	0.00	0
+phiX174:3685	0	0.00	0
+phiX174:3686	0	0.00	0
+phiX174:3687	0	0.00	0
+phiX174:3688	0	0.00	0
+phiX174:3689	0	0.00	0
+phiX174:3690	0	0.00	0
+phiX174:3691	0	0.00	0
+phiX174:3692	0	0.00	0
+phiX174:3693	0	0.00	0
+phiX174:3694	0	0.00	0
+phiX174:3695	0	0.00	0
+phiX174:3696	0	0.00	0
+phiX174:3697	0	0.00	0
+phiX174:3698	0	0.00	0
+phiX174:3699	0	0.00	0
+phiX174:3700	0	0.00	0
+phiX174:3701	0	0.00	0
+phiX174:3702	0	0.00	0
+phiX174:3703	0	0.00	0
+phiX174:3704	0	0.00	0
+phiX174:3705	0	0.00	0
+phiX174:3706	0	0.00	0
+phiX174:3707	0	0.00	0
+phiX174:3708	0	0.00	0
+phiX174:3709	0	0.00	0
+phiX174:3710	0	0.00	0
+phiX174:3711	0	0.00	0
+phiX174:3712	0	0.00	0
+phiX174:3713	0	0.00	0
+phiX174:3714	0	0.00	0
+phiX174:3715	0	0.00	0
+phiX174:3716	0	0.00	0
+phiX174:3717	0	0.00	0
+phiX174:3718	0	0.00	0
+phiX174:3719	0	0.00	0
+phiX174:3720	0	0.00	0
+phiX174:3721	0	0.00	0
+phiX174:3722	0	0.00	0
+phiX174:3723	0	0.00	0
+phiX174:3724	0	0.00	0
+phiX174:3725	0	0.00	0
+phiX174:3726	0	0.00	0
+phiX174:3727	0	0.00	0
+phiX174:3728	0	0.00	0
+phiX174:3729	0	0.00	0
+phiX174:3730	0	0.00	0
+phiX174:3731	0	0.00	0
+phiX174:3732	0	0.00	0
+phiX174:3733	0	0.00	0
+phiX174:3734	0	0.00	0
+phiX174:3735	0	0.00	0
+phiX174:3736	0	0.00	0
+phiX174:3737	0	0.00	0
+phiX174:3738	0	0.00	0
+phiX174:3739	0	0.00	0
+phiX174:3740	0	0.00	0
+phiX174:3741	0	0.00	0
+phiX174:3742	0	0.00	0
+phiX174:3743	0	0.00	0
+phiX174:3744	0	0.00	0
+phiX174:3745	0	0.00	0
+phiX174:3746	0	0.00	0
+phiX174:3747	0	0.00	0
+phiX174:3748	0	0.00	0
+phiX174:3749	0	0.00	0
+phiX174:3750	0	0.00	0
+phiX174:3751	0	0.00	0
+phiX174:3752	0	0.00	0
+phiX174:3753	0	0.00	0
+phiX174:3754	0	0.00	0
+phiX174:3755	0	0.00	0
+phiX174:3756	0	0.00	0
+phiX174:3757	0	0.00	0
+phiX174:3758	0	0.00	0
+phiX174:3759	0	0.00	0
+phiX174:3760	0	0.00	0
+phiX174:3761	0	0.00	0
+phiX174:3762	0	0.00	0
+phiX174:3763	0	0.00	0
+phiX174:3764	0	0.00	0
+phiX174:3765	0	0.00	0
+phiX174:3766	0	0.00	0
+phiX174:3767	0	0.00	0
+phiX174:3768	0	0.00	0
+phiX174:3769	0	0.00	0
+phiX174:3770	0	0.00	0
+phiX174:3771	0	0.00	0
+phiX174:3772	0	0.00	0
+phiX174:3773	0	0.00	0
+phiX174:3774	0	0.00	0
+phiX174:3775	0	0.00	0
+phiX174:3776	0	0.00	0
+phiX174:3777	0	0.00	0
+phiX174:3778	0	0.00	0
+phiX174:3779	0	0.00	0
+phiX174:3780	0	0.00	0
+phiX174:3781	0	0.00	0
+phiX174:3782	0	0.00	0
+phiX174:3783	0	0.00	0
+phiX174:3784	0	0.00	0
+phiX174:3785	0	0.00	0
+phiX174:3786	0	0.00	0
+phiX174:3787	0	0.00	0
+phiX174:3788	0	0.00	0
+phiX174:3789	0	0.00	0
+phiX174:3790	0	0.00	0
+phiX174:3791	0	0.00	0
+phiX174:3792	0	0.00	0
+phiX174:3793	0	0.00	0
+phiX174:3794	0	0.00	0
+phiX174:3795	0	0.00	0
+phiX174:3796	0	0.00	0
+phiX174:3797	0	0.00	0
+phiX174:3798	0	0.00	0
+phiX174:3799	0	0.00	0
+phiX174:3800	0	0.00	0
+phiX174:3801	0	0.00	0
+phiX174:3802	0	0.00	0
+phiX174:3803	0	0.00	0
+phiX174:3804	0	0.00	0
+phiX174:3805	0	0.00	0
+phiX174:3806	0	0.00	0
+phiX174:3807	0	0.00	0
+phiX174:3808	0	0.00	0
+phiX174:3809	0	0.00	0
+phiX174:3810	0	0.00	0
+phiX174:3811	0	0.00	0
+phiX174:3812	0	0.00	0
+phiX174:3813	0	0.00	0
+phiX174:3814	0	0.00	0
+phiX174:3815	0	0.00	0
+phiX174:3816	0	0.00	0
+phiX174:3817	0	0.00	0
+phiX174:3818	0	0.00	0
+phiX174:3819	0	0.00	0
+phiX174:3820	0	0.00	0
+phiX174:3821	0	0.00	0
+phiX174:3822	0	0.00	0
+phiX174:3823	0	0.00	0
+phiX174:3824	0	0.00	0
+phiX174:3825	0	0.00	0
+phiX174:3826	0	0.00	0
+phiX174:3827	0	0.00	0
+phiX174:3828	0	0.00	0
+phiX174:3829	0	0.00	0
+phiX174:3830	0	0.00	0
+phiX174:3831	0	0.00	0
+phiX174:3832	0	0.00	0
+phiX174:3833	0	0.00	0
+phiX174:3834	0	0.00	0
+phiX174:3835	0	0.00	0
+phiX174:3836	0	0.00	0
+phiX174:3837	0	0.00	0
+phiX174:3838	0	0.00	0
+phiX174:3839	0	0.00	0
+phiX174:3840	0	0.00	0
+phiX174:3841	0	0.00	0
+phiX174:3842	0	0.00	0
+phiX174:3843	0	0.00	0
+phiX174:3844	0	0.00	0
+phiX174:3845	0	0.00	0
+phiX174:3846	0	0.00	0
+phiX174:3847	0	0.00	0
+phiX174:3848	0	0.00	0
+phiX174:3849	0	0.00	0
+phiX174:3850	0	0.00	0
+phiX174:3851	0	0.00	0
+phiX174:3852	0	0.00	0
+phiX174:3853	0	0.00	0
+phiX174:3854	0	0.00	0
+phiX174:3855	0	0.00	0
+phiX174:3856	0	0.00	0
+phiX174:3857	0	0.00	0
+phiX174:3858	0	0.00	0
+phiX174:3859	0	0.00	0
+phiX174:3860	0	0.00	0
+phiX174:3861	0	0.00	0
+phiX174:3862	0	0.00	0
+phiX174:3863	0	0.00	0
+phiX174:3864	0	0.00	0
+phiX174:3865	0	0.00	0
+phiX174:3866	0	0.00	0
+phiX174:3867	0	0.00	0
+phiX174:3868	0	0.00	0
+phiX174:3869	0	0.00	0
+phiX174:3870	0	0.00	0
+phiX174:3871	0	0.00	0
+phiX174:3872	0	0.00	0
+phiX174:3873	0	0.00	0
+phiX174:3874	0	0.00	0
+phiX174:3875	0	0.00	0
+phiX174:3876	0	0.00	0
+phiX174:3877	0	0.00	0
+phiX174:3878	0	0.00	0
+phiX174:3879	0	0.00	0
+phiX174:3880	0	0.00	0
+phiX174:3881	0	0.00	0
+phiX174:3882	0	0.00	0
+phiX174:3883	0	0.00	0
+phiX174:3884	0	0.00	0
+phiX174:3885	0	0.00	0
+phiX174:3886	0	0.00	0
+phiX174:3887	0	0.00	0
+phiX174:3888	0	0.00	0
+phiX174:3889	0	0.00	0
+phiX174:3890	0	0.00	0
+phiX174:3891	0	0.00	0
+phiX174:3892	0	0.00	0
+phiX174:3893	0	0.00	0
+phiX174:3894	0	0.00	0
+phiX174:3895	0	0.00	0
+phiX174:3896	0	0.00	0
+phiX174:3897	0	0.00	0
+phiX174:3898	0	0.00	0
+phiX174:3899	0	0.00	0
+phiX174:3900	0	0.00	0
+phiX174:3901	0	0.00	0
+phiX174:3902	0	0.00	0
+phiX174:3903	0	0.00	0
+phiX174:3904	0	0.00	0
+phiX174:3905	0	0.00	0
+phiX174:3906	0	0.00	0
+phiX174:3907	0	0.00	0
+phiX174:3908	0	0.00	0
+phiX174:3909	0	0.00	0
+phiX174:3910	0	0.00	0
+phiX174:3911	0	0.00	0
+phiX174:3912	0	0.00	0
+phiX174:3913	0	0.00	0
+phiX174:3914	0	0.00	0
+phiX174:3915	0	0.00	0
+phiX174:3916	0	0.00	0
+phiX174:3917	0	0.00	0
+phiX174:3918	0	0.00	0
+phiX174:3919	0	0.00	0
+phiX174:3920	0	0.00	0
+phiX174:3921	0	0.00	0
+phiX174:3922	0	0.00	0
+phiX174:3923	0	0.00	0
+phiX174:3924	0	0.00	0
+phiX174:3925	0	0.00	0
+phiX174:3926	0	0.00	0
+phiX174:3927	0	0.00	0
+phiX174:3928	0	0.00	0
+phiX174:3929	0	0.00	0
+phiX174:3930	0	0.00	0
+phiX174:3931	0	0.00	0
+phiX174:3932	0	0.00	0
+phiX174:3933	0	0.00	0
+phiX174:3934	0	0.00	0
+phiX174:3935	0	0.00	0
+phiX174:3936	0	0.00	0
+phiX174:3937	0	0.00	0
+phiX174:3938	0	0.00	0
+phiX174:3939	0	0.00	0
+phiX174:3940	0	0.00	0
+phiX174:3941	0	0.00	0
+phiX174:3942	0	0.00	0
+phiX174:3943	0	0.00	0
+phiX174:3944	0	0.00	0
+phiX174:3945	0	0.00	0
+phiX174:3946	0	0.00	0
+phiX174:3947	0	0.00	0
+phiX174:3948	0	0.00	0
+phiX174:3949	0	0.00	0
+phiX174:3950	0	0.00	0
+phiX174:3951	0	0.00	0
+phiX174:3952	0	0.00	0
+phiX174:3953	0	0.00	0
+phiX174:3954	0	0.00	0
+phiX174:3955	0	0.00	0
+phiX174:3956	0	0.00	0
+phiX174:3957	0	0.00	0
+phiX174:3958	0	0.00	0
+phiX174:3959	0	0.00	0
+phiX174:3960	0	0.00	0
+phiX174:3961	0	0.00	0
+phiX174:3962	0	0.00	0
+phiX174:3963	0	0.00	0
+phiX174:3964	0	0.00	0
+phiX174:3965	0	0.00	0
+phiX174:3966	0	0.00	0
+phiX174:3967	0	0.00	0
+phiX174:3968	0	0.00	0
+phiX174:3969	0	0.00	0
+phiX174:3970	0	0.00	0
+phiX174:3971	0	0.00	0
+phiX174:3972	0	0.00	0
+phiX174:3973	0	0.00	0
+phiX174:3974	0	0.00	0
+phiX174:3975	0	0.00	0
+phiX174:3976	0	0.00	0
+phiX174:3977	0	0.00	0
+phiX174:3978	0	0.00	0
+phiX174:3979	0	0.00	0
+phiX174:3980	0	0.00	0
+phiX174:3981	0	0.00	0
+phiX174:3982	0	0.00	0
+phiX174:3983	0	0.00	0
+phiX174:3984	0	0.00	0
+phiX174:3985	0	0.00	0
+phiX174:3986	0	0.00	0
+phiX174:3987	0	0.00	0
+phiX174:3988	0	0.00	0
+phiX174:3989	0	0.00	0
+phiX174:3990	0	0.00	0
+phiX174:3991	0	0.00	0
+phiX174:3992	0	0.00	0
+phiX174:3993	0	0.00	0
+phiX174:3994	0	0.00	0
+phiX174:3995	0	0.00	0
+phiX174:3996	0	0.00	0
+phiX174:3997	0	0.00	0
+phiX174:3998	0	0.00	0
+phiX174:3999	0	0.00	0
+phiX174:4000	0	0.00	0
+phiX174:4001	0	0.00	0
+phiX174:4002	0	0.00	0
+phiX174:4003	0	0.00	0
+phiX174:4004	0	0.00	0
+phiX174:4005	0	0.00	0
+phiX174:4006	0	0.00	0
+phiX174:4007	0	0.00	0
+phiX174:4008	0	0.00	0
+phiX174:4009	0	0.00	0
+phiX174:4010	0	0.00	0
+phiX174:4011	0	0.00	0
+phiX174:4012	0	0.00	0
+phiX174:4013	0	0.00	0
+phiX174:4014	0	0.00	0
+phiX174:4015	0	0.00	0
+phiX174:4016	0	0.00	0
+phiX174:4017	0	0.00	0
+phiX174:4018	0	0.00	0
+phiX174:4019	0	0.00	0
+phiX174:4020	0	0.00	0
+phiX174:4021	0	0.00	0
+phiX174:4022	0	0.00	0
+phiX174:4023	0	0.00	0
+phiX174:4024	0	0.00	0
+phiX174:4025	0	0.00	0
+phiX174:4026	0	0.00	0
+phiX174:4027	0	0.00	0
+phiX174:4028	0	0.00	0
+phiX174:4029	0	0.00	0
+phiX174:4030	0	0.00	0
+phiX174:4031	0	0.00	0
+phiX174:4032	0	0.00	0
+phiX174:4033	0	0.00	0
+phiX174:4034	0	0.00	0
+phiX174:4035	0	0.00	0
+phiX174:4036	0	0.00	0
+phiX174:4037	0	0.00	0
+phiX174:4038	0	0.00	0
+phiX174:4039	0	0.00	0
+phiX174:4040	0	0.00	0
+phiX174:4041	0	0.00	0
+phiX174:4042	0	0.00	0
+phiX174:4043	0	0.00	0
+phiX174:4044	0	0.00	0
+phiX174:4045	0	0.00	0
+phiX174:4046	0	0.00	0
+phiX174:4047	0	0.00	0
+phiX174:4048	0	0.00	0
+phiX174:4049	0	0.00	0
+phiX174:4050	0	0.00	0
+phiX174:4051	0	0.00	0
+phiX174:4052	0	0.00	0
+phiX174:4053	0	0.00	0
+phiX174:4054	0	0.00	0
+phiX174:4055	0	0.00	0
+phiX174:4056	0	0.00	0
+phiX174:4057	0	0.00	0
+phiX174:4058	0	0.00	0
+phiX174:4059	0	0.00	0
+phiX174:4060	0	0.00	0
+phiX174:4061	0	0.00	0
+phiX174:4062	0	0.00	0
+phiX174:4063	0	0.00	0
+phiX174:4064	0	0.00	0
+phiX174:4065	0	0.00	0
+phiX174:4066	0	0.00	0
+phiX174:4067	0	0.00	0
+phiX174:4068	0	0.00	0
+phiX174:4069	0	0.00	0
+phiX174:4070	0	0.00	0
+phiX174:4071	0	0.00	0
+phiX174:4072	0	0.00	0
+phiX174:4073	0	0.00	0
+phiX174:4074	0	0.00	0
+phiX174:4075	0	0.00	0
+phiX174:4076	0	0.00	0
+phiX174:4077	0	0.00	0
+phiX174:4078	0	0.00	0
+phiX174:4079	0	0.00	0
+phiX174:4080	0	0.00	0
+phiX174:4081	0	0.00	0
+phiX174:4082	0	0.00	0
+phiX174:4083	0	0.00	0
+phiX174:4084	0	0.00	0
+phiX174:4085	0	0.00	0
+phiX174:4086	0	0.00	0
+phiX174:4087	0	0.00	0
+phiX174:4088	0	0.00	0
+phiX174:4089	0	0.00	0
+phiX174:4090	0	0.00	0
+phiX174:4091	0	0.00	0
+phiX174:4092	0	0.00	0
+phiX174:4093	0	0.00	0
+phiX174:4094	0	0.00	0
+phiX174:4095	0	0.00	0
+phiX174:4096	0	0.00	0
+phiX174:4097	0	0.00	0
+phiX174:4098	0	0.00	0
+phiX174:4099	0	0.00	0
+phiX174:4100	0	0.00	0
+phiX174:4101	0	0.00	0
+phiX174:4102	0	0.00	0
+phiX174:4103	0	0.00	0
+phiX174:4104	0	0.00	0
+phiX174:4105	0	0.00	0
+phiX174:4106	0	0.00	0
+phiX174:4107	0	0.00	0
+phiX174:4108	0	0.00	0
+phiX174:4109	0	0.00	0
+phiX174:4110	0	0.00	0
+phiX174:4111	0	0.00	0
+phiX174:4112	0	0.00	0
+phiX174:4113	0	0.00	0
+phiX174:4114	0	0.00	0
+phiX174:4115	0	0.00	0
+phiX174:4116	0	0.00	0
+phiX174:4117	0	0.00	0
+phiX174:4118	0	0.00	0
+phiX174:4119	0	0.00	0
+phiX174:4120	0	0.00	0
+phiX174:4121	0	0.00	0
+phiX174:4122	0	0.00	0
+phiX174:4123	0	0.00	0
+phiX174:4124	0	0.00	0
+phiX174:4125	0	0.00	0
+phiX174:4126	0	0.00	0
+phiX174:4127	0	0.00	0
+phiX174:4128	0	0.00	0
+phiX174:4129	0	0.00	0
+phiX174:4130	0	0.00	0
+phiX174:4131	0	0.00	0
+phiX174:4132	0	0.00	0
+phiX174:4133	0	0.00	0
+phiX174:4134	0	0.00	0
+phiX174:4135	0	0.00	0
+phiX174:4136	0	0.00	0
+phiX174:4137	0	0.00	0
+phiX174:4138	0	0.00	0
+phiX174:4139	0	0.00	0
+phiX174:4140	0	0.00	0
+phiX174:4141	0	0.00	0
+phiX174:4142	0	0.00	0
+phiX174:4143	0	0.00	0
+phiX174:4144	0	0.00	0
+phiX174:4145	0	0.00	0
+phiX174:4146	0	0.00	0
+phiX174:4147	0	0.00	0
+phiX174:4148	0	0.00	0
+phiX174:4149	0	0.00	0
+phiX174:4150	0	0.00	0
+phiX174:4151	0	0.00	0
+phiX174:4152	0	0.00	0
+phiX174:4153	0	0.00	0
+phiX174:4154	0	0.00	0
+phiX174:4155	0	0.00	0
+phiX174:4156	0	0.00	0
+phiX174:4157	0	0.00	0
+phiX174:4158	0	0.00	0
+phiX174:4159	0	0.00	0
+phiX174:4160	0	0.00	0
+phiX174:4161	0	0.00	0
+phiX174:4162	0	0.00	0
+phiX174:4163	0	0.00	0
+phiX174:4164	0	0.00	0
+phiX174:4165	0	0.00	0
+phiX174:4166	0	0.00	0
+phiX174:4167	0	0.00	0
+phiX174:4168	0	0.00	0
+phiX174:4169	0	0.00	0
+phiX174:4170	0	0.00	0
+phiX174:4171	0	0.00	0
+phiX174:4172	0	0.00	0
+phiX174:4173	0	0.00	0
+phiX174:4174	0	0.00	0
+phiX174:4175	0	0.00	0
+phiX174:4176	0	0.00	0
+phiX174:4177	0	0.00	0
+phiX174:4178	0	0.00	0
+phiX174:4179	0	0.00	0
+phiX174:4180	0	0.00	0
+phiX174:4181	0	0.00	0
+phiX174:4182	0	0.00	0
+phiX174:4183	0	0.00	0
+phiX174:4184	0	0.00	0
+phiX174:4185	0	0.00	0
+phiX174:4186	0	0.00	0
+phiX174:4187	0	0.00	0
+phiX174:4188	0	0.00	0
+phiX174:4189	0	0.00	0
+phiX174:4190	0	0.00	0
+phiX174:4191	0	0.00	0
+phiX174:4192	0	0.00	0
+phiX174:4193	0	0.00	0
+phiX174:4194	0	0.00	0
+phiX174:4195	0	0.00	0
+phiX174:4196	0	0.00	0
+phiX174:4197	0	0.00	0
+phiX174:4198	0	0.00	0
+phiX174:4199	0	0.00	0
+phiX174:4200	0	0.00	0
+phiX174:4201	0	0.00	0
+phiX174:4202	0	0.00	0
+phiX174:4203	0	0.00	0
+phiX174:4204	0	0.00	0
+phiX174:4205	0	0.00	0
+phiX174:4206	0	0.00	0
+phiX174:4207	0	0.00	0
+phiX174:4208	0	0.00	0
+phiX174:4209	0	0.00	0
+phiX174:4210	0	0.00	0
+phiX174:4211	0	0.00	0
+phiX174:4212	0	0.00	0
+phiX174:4213	0	0.00	0
+phiX174:4214	0	0.00	0
+phiX174:4215	0	0.00	0
+phiX174:4216	0	0.00	0
+phiX174:4217	0	0.00	0
+phiX174:4218	0	0.00	0
+phiX174:4219	0	0.00	0
+phiX174:4220	0	0.00	0
+phiX174:4221	0	0.00	0
+phiX174:4222	0	0.00	0
+phiX174:4223	0	0.00	0
+phiX174:4224	0	0.00	0
+phiX174:4225	0	0.00	0
+phiX174:4226	0	0.00	0
+phiX174:4227	0	0.00	0
+phiX174:4228	0	0.00	0
+phiX174:4229	0	0.00	0
+phiX174:4230	0	0.00	0
+phiX174:4231	0	0.00	0
+phiX174:4232	0	0.00	0
+phiX174:4233	0	0.00	0
+phiX174:4234	0	0.00	0
+phiX174:4235	0	0.00	0
+phiX174:4236	0	0.00	0
+phiX174:4237	0	0.00	0
+phiX174:4238	0	0.00	0
+phiX174:4239	0	0.00	0
+phiX174:4240	0	0.00	0
+phiX174:4241	0	0.00	0
+phiX174:4242	0	0.00	0
+phiX174:4243	0	0.00	0
+phiX174:4244	0	0.00	0
+phiX174:4245	0	0.00	0
+phiX174:4246	0	0.00	0
+phiX174:4247	0	0.00	0
+phiX174:4248	0	0.00	0
+phiX174:4249	0	0.00	0
+phiX174:4250	0	0.00	0
+phiX174:4251	0	0.00	0
+phiX174:4252	0	0.00	0
+phiX174:4253	0	0.00	0
+phiX174:4254	0	0.00	0
+phiX174:4255	0	0.00	0
+phiX174:4256	0	0.00	0
+phiX174:4257	0	0.00	0
+phiX174:4258	0	0.00	0
+phiX174:4259	0	0.00	0
+phiX174:4260	0	0.00	0
+phiX174:4261	0	0.00	0
+phiX174:4262	0	0.00	0
+phiX174:4263	0	0.00	0
+phiX174:4264	0	0.00	0
+phiX174:4265	0	0.00	0
+phiX174:4266	0	0.00	0
+phiX174:4267	0	0.00	0
+phiX174:4268	0	0.00	0
+phiX174:4269	0	0.00	0
+phiX174:4270	0	0.00	0
+phiX174:4271	0	0.00	0
+phiX174:4272	0	0.00	0
+phiX174:4273	0	0.00	0
+phiX174:4274	0	0.00	0
+phiX174:4275	0	0.00	0
+phiX174:4276	0	0.00	0
+phiX174:4277	0	0.00	0
+phiX174:4278	0	0.00	0
+phiX174:4279	0	0.00	0
+phiX174:4280	0	0.00	0
+phiX174:4281	0	0.00	0
+phiX174:4282	0	0.00	0
+phiX174:4283	0	0.00	0
+phiX174:4284	0	0.00	0
+phiX174:4285	0	0.00	0
+phiX174:4286	0	0.00	0
+phiX174:4287	0	0.00	0
+phiX174:4288	0	0.00	0
+phiX174:4289	0	0.00	0
+phiX174:4290	0	0.00	0
+phiX174:4291	0	0.00	0
+phiX174:4292	0	0.00	0
+phiX174:4293	0	0.00	0
+phiX174:4294	0	0.00	0
+phiX174:4295	0	0.00	0
+phiX174:4296	0	0.00	0
+phiX174:4297	0	0.00	0
+phiX174:4298	0	0.00	0
+phiX174:4299	0	0.00	0
+phiX174:4300	0	0.00	0
+phiX174:4301	0	0.00	0
+phiX174:4302	0	0.00	0
+phiX174:4303	0	0.00	0
+phiX174:4304	0	0.00	0
+phiX174:4305	0	0.00	0
+phiX174:4306	0	0.00	0
+phiX174:4307	0	0.00	0
+phiX174:4308	0	0.00	0
+phiX174:4309	0	0.00	0
+phiX174:4310	0	0.00	0
+phiX174:4311	0	0.00	0
+phiX174:4312	0	0.00	0
+phiX174:4313	0	0.00	0
+phiX174:4314	0	0.00	0
+phiX174:4315	0	0.00	0
+phiX174:4316	0	0.00	0
+phiX174:4317	0	0.00	0
+phiX174:4318	0	0.00	0
+phiX174:4319	0	0.00	0
+phiX174:4320	0	0.00	0
+phiX174:4321	0	0.00	0
+phiX174:4322	0	0.00	0
+phiX174:4323	0	0.00	0
+phiX174:4324	0	0.00	0
+phiX174:4325	0	0.00	0
+phiX174:4326	0	0.00	0
+phiX174:4327	0	0.00	0
+phiX174:4328	0	0.00	0
+phiX174:4329	0	0.00	0
+phiX174:4330	0	0.00	0
+phiX174:4331	0	0.00	0
+phiX174:4332	0	0.00	0
+phiX174:4333	0	0.00	0
+phiX174:4334	0	0.00	0
+phiX174:4335	0	0.00	0
+phiX174:4336	0	0.00	0
+phiX174:4337	0	0.00	0
+phiX174:4338	0	0.00	0
+phiX174:4339	0	0.00	0
+phiX174:4340	0	0.00	0
+phiX174:4341	0	0.00	0
+phiX174:4342	0	0.00	0
+phiX174:4343	0	0.00	0
+phiX174:4344	0	0.00	0
+phiX174:4345	0	0.00	0
+phiX174:4346	0	0.00	0
+phiX174:4347	0	0.00	0
+phiX174:4348	0	0.00	0
+phiX174:4349	0	0.00	0
+phiX174:4350	0	0.00	0
+phiX174:4351	0	0.00	0
+phiX174:4352	0	0.00	0
+phiX174:4353	0	0.00	0
+phiX174:4354	0	0.00	0
+phiX174:4355	0	0.00	0
+phiX174:4356	0	0.00	0
+phiX174:4357	0	0.00	0
+phiX174:4358	0	0.00	0
+phiX174:4359	0	0.00	0
+phiX174:4360	0	0.00	0
+phiX174:4361	0	0.00	0
+phiX174:4362	0	0.00	0
+phiX174:4363	0	0.00	0
+phiX174:4364	0	0.00	0
+phiX174:4365	0	0.00	0
+phiX174:4366	0	0.00	0
+phiX174:4367	0	0.00	0
+phiX174:4368	0	0.00	0
+phiX174:4369	0	0.00	0
+phiX174:4370	0	0.00	0
+phiX174:4371	0	0.00	0
+phiX174:4372	0	0.00	0
+phiX174:4373	0	0.00	0
+phiX174:4374	0	0.00	0
+phiX174:4375	0	0.00	0
+phiX174:4376	0	0.00	0
+phiX174:4377	0	0.00	0
+phiX174:4378	0	0.00	0
+phiX174:4379	0	0.00	0
+phiX174:4380	0	0.00	0
+phiX174:4381	0	0.00	0
+phiX174:4382	0	0.00	0
+phiX174:4383	0	0.00	0
+phiX174:4384	0	0.00	0
+phiX174:4385	0	0.00	0
+phiX174:4386	0	0.00	0
+phiX174:4387	0	0.00	0
+phiX174:4388	0	0.00	0
+phiX174:4389	0	0.00	0
+phiX174:4390	0	0.00	0
+phiX174:4391	0	0.00	0
+phiX174:4392	0	0.00	0
+phiX174:4393	0	0.00	0
+phiX174:4394	0	0.00	0
+phiX174:4395	0	0.00	0
+phiX174:4396	0	0.00	0
+phiX174:4397	0	0.00	0
+phiX174:4398	0	0.00	0
+phiX174:4399	0	0.00	0
+phiX174:4400	0	0.00	0
+phiX174:4401	0	0.00	0
+phiX174:4402	0	0.00	0
+phiX174:4403	0	0.00	0
+phiX174:4404	0	0.00	0
+phiX174:4405	0	0.00	0
+phiX174:4406	0	0.00	0
+phiX174:4407	0	0.00	0
+phiX174:4408	0	0.00	0
+phiX174:4409	0	0.00	0
+phiX174:4410	0	0.00	0
+phiX174:4411	0	0.00	0
+phiX174:4412	0	0.00	0
+phiX174:4413	0	0.00	0
+phiX174:4414	0	0.00	0
+phiX174:4415	0	0.00	0
+phiX174:4416	0	0.00	0
+phiX174:4417	0	0.00	0
+phiX174:4418	0	0.00	0
+phiX174:4419	0	0.00	0
+phiX174:4420	0	0.00	0
+phiX174:4421	0	0.00	0
+phiX174:4422	0	0.00	0
+phiX174:4423	0	0.00	0
+phiX174:4424	0	0.00	0
+phiX174:4425	0	0.00	0
+phiX174:4426	0	0.00	0
+phiX174:4427	0	0.00	0
+phiX174:4428	0	0.00	0
+phiX174:4429	0	0.00	0
+phiX174:4430	0	0.00	0
+phiX174:4431	0	0.00	0
+phiX174:4432	0	0.00	0
+phiX174:4433	0	0.00	0
+phiX174:4434	0	0.00	0
+phiX174:4435	0	0.00	0
+phiX174:4436	0	0.00	0
+phiX174:4437	0	0.00	0
+phiX174:4438	0	0.00	0
+phiX174:4439	0	0.00	0
+phiX174:4440	0	0.00	0
+phiX174:4441	0	0.00	0
+phiX174:4442	0	0.00	0
+phiX174:4443	0	0.00	0
+phiX174:4444	0	0.00	0
+phiX174:4445	0	0.00	0
+phiX174:4446	0	0.00	0
+phiX174:4447	0	0.00	0
+phiX174:4448	0	0.00	0
+phiX174:4449	0	0.00	0
+phiX174:4450	0	0.00	0
+phiX174:4451	0	0.00	0
+phiX174:4452	0	0.00	0
+phiX174:4453	0	0.00	0
+phiX174:4454	0	0.00	0
+phiX174:4455	0	0.00	0
+phiX174:4456	0	0.00	0
+phiX174:4457	0	0.00	0
+phiX174:4458	0	0.00	0
+phiX174:4459	0	0.00	0
+phiX174:4460	0	0.00	0
+phiX174:4461	0	0.00	0
+phiX174:4462	0	0.00	0
+phiX174:4463	0	0.00	0
+phiX174:4464	0	0.00	0
+phiX174:4465	0	0.00	0
+phiX174:4466	0	0.00	0
+phiX174:4467	0	0.00	0
+phiX174:4468	0	0.00	0
+phiX174:4469	0	0.00	0
+phiX174:4470	0	0.00	0
+phiX174:4471	0	0.00	0
+phiX174:4472	0	0.00	0
+phiX174:4473	0	0.00	0
+phiX174:4474	0	0.00	0
+phiX174:4475	0	0.00	0
+phiX174:4476	0	0.00	0
+phiX174:4477	0	0.00	0
+phiX174:4478	0	0.00	0
+phiX174:4479	0	0.00	0
+phiX174:4480	0	0.00	0
+phiX174:4481	0	0.00	0
+phiX174:4482	0	0.00	0
+phiX174:4483	0	0.00	0
+phiX174:4484	0	0.00	0
+phiX174:4485	0	0.00	0
+phiX174:4486	0	0.00	0
+phiX174:4487	0	0.00	0
+phiX174:4488	0	0.00	0
+phiX174:4489	0	0.00	0
+phiX174:4490	0	0.00	0
+phiX174:4491	0	0.00	0
+phiX174:4492	0	0.00	0
+phiX174:4493	0	0.00	0
+phiX174:4494	0	0.00	0
+phiX174:4495	0	0.00	0
+phiX174:4496	0	0.00	0
+phiX174:4497	0	0.00	0
+phiX174:4498	0	0.00	0
+phiX174:4499	0	0.00	0
+phiX174:4500	0	0.00	0
+phiX174:4501	0	0.00	0
+phiX174:4502	0	0.00	0
+phiX174:4503	0	0.00	0
+phiX174:4504	0	0.00	0
+phiX174:4505	0	0.00	0
+phiX174:4506	0	0.00	0
+phiX174:4507	0	0.00	0
+phiX174:4508	0	0.00	0
+phiX174:4509	0	0.00	0
+phiX174:4510	0	0.00	0
+phiX174:4511	0	0.00	0
+phiX174:4512	0	0.00	0
+phiX174:4513	0	0.00	0
+phiX174:4514	0	0.00	0
+phiX174:4515	0	0.00	0
+phiX174:4516	0	0.00	0
+phiX174:4517	0	0.00	0
+phiX174:4518	0	0.00	0
+phiX174:4519	0	0.00	0
+phiX174:4520	0	0.00	0
+phiX174:4521	0	0.00	0
+phiX174:4522	0	0.00	0
+phiX174:4523	0	0.00	0
+phiX174:4524	0	0.00	0
+phiX174:4525	0	0.00	0
+phiX174:4526	0	0.00	0
+phiX174:4527	0	0.00	0
+phiX174:4528	0	0.00	0
+phiX174:4529	0	0.00	0
+phiX174:4530	0	0.00	0
+phiX174:4531	0	0.00	0
+phiX174:4532	0	0.00	0
+phiX174:4533	0	0.00	0
+phiX174:4534	0	0.00	0
+phiX174:4535	0	0.00	0
+phiX174:4536	0	0.00	0
+phiX174:4537	0	0.00	0
+phiX174:4538	0	0.00	0
+phiX174:4539	0	0.00	0
+phiX174:4540	0	0.00	0
+phiX174:4541	0	0.00	0
+phiX174:4542	0	0.00	0
+phiX174:4543	0	0.00	0
+phiX174:4544	0	0.00	0
+phiX174:4545	0	0.00	0
+phiX174:4546	0	0.00	0
+phiX174:4547	0	0.00	0
+phiX174:4548	0	0.00	0
+phiX174:4549	0	0.00	0
+phiX174:4550	0	0.00	0
+phiX174:4551	0	0.00	0
+phiX174:4552	0	0.00	0
+phiX174:4553	0	0.00	0
+phiX174:4554	0	0.00	0
+phiX174:4555	0	0.00	0
+phiX174:4556	0	0.00	0
+phiX174:4557	0	0.00	0
+phiX174:4558	0	0.00	0
+phiX174:4559	0	0.00	0
+phiX174:4560	0	0.00	0
+phiX174:4561	0	0.00	0
+phiX174:4562	0	0.00	0
+phiX174:4563	0	0.00	0
+phiX174:4564	0	0.00	0
+phiX174:4565	0	0.00	0
+phiX174:4566	0	0.00	0
+phiX174:4567	0	0.00	0
+phiX174:4568	0	0.00	0
+phiX174:4569	0	0.00	0
+phiX174:4570	0	0.00	0
+phiX174:4571	0	0.00	0
+phiX174:4572	0	0.00	0
+phiX174:4573	0	0.00	0
+phiX174:4574	0	0.00	0
+phiX174:4575	0	0.00	0
+phiX174:4576	0	0.00	0
+phiX174:4577	0	0.00	0
+phiX174:4578	0	0.00	0
+phiX174:4579	0	0.00	0
+phiX174:4580	0	0.00	0
+phiX174:4581	0	0.00	0
+phiX174:4582	0	0.00	0
+phiX174:4583	0	0.00	0
+phiX174:4584	0	0.00	0
+phiX174:4585	0	0.00	0
+phiX174:4586	0	0.00	0
+phiX174:4587	0	0.00	0
+phiX174:4588	0	0.00	0
+phiX174:4589	0	0.00	0
+phiX174:4590	0	0.00	0
+phiX174:4591	0	0.00	0
+phiX174:4592	0	0.00	0
+phiX174:4593	0	0.00	0
+phiX174:4594	0	0.00	0
+phiX174:4595	0	0.00	0
+phiX174:4596	0	0.00	0
+phiX174:4597	0	0.00	0
+phiX174:4598	0	0.00	0
+phiX174:4599	0	0.00	0
+phiX174:4600	0	0.00	0
+phiX174:4601	0	0.00	0
+phiX174:4602	0	0.00	0
+phiX174:4603	0	0.00	0
+phiX174:4604	0	0.00	0
+phiX174:4605	0	0.00	0
+phiX174:4606	0	0.00	0
+phiX174:4607	0	0.00	0
+phiX174:4608	0	0.00	0
+phiX174:4609	0	0.00	0
+phiX174:4610	0	0.00	0
+phiX174:4611	0	0.00	0
+phiX174:4612	0	0.00	0
+phiX174:4613	0	0.00	0
+phiX174:4614	0	0.00	0
+phiX174:4615	0	0.00	0
+phiX174:4616	0	0.00	0
+phiX174:4617	0	0.00	0
+phiX174:4618	0	0.00	0
+phiX174:4619	0	0.00	0
+phiX174:4620	0	0.00	0
+phiX174:4621	0	0.00	0
+phiX174:4622	0	0.00	0
+phiX174:4623	0	0.00	0
+phiX174:4624	0	0.00	0
+phiX174:4625	0	0.00	0
+phiX174:4626	0	0.00	0
+phiX174:4627	0	0.00	0
+phiX174:4628	0	0.00	0
+phiX174:4629	0	0.00	0
+phiX174:4630	0	0.00	0
+phiX174:4631	0	0.00	0
+phiX174:4632	0	0.00	0
+phiX174:4633	0	0.00	0
+phiX174:4634	0	0.00	0
+phiX174:4635	0	0.00	0
+phiX174:4636	0	0.00	0
+phiX174:4637	0	0.00	0
+phiX174:4638	0	0.00	0
+phiX174:4639	0	0.00	0
+phiX174:4640	0	0.00	0
+phiX174:4641	0	0.00	0
+phiX174:4642	0	0.00	0
+phiX174:4643	0	0.00	0
+phiX174:4644	0	0.00	0
+phiX174:4645	0	0.00	0
+phiX174:4646	0	0.00	0
+phiX174:4647	0	0.00	0
+phiX174:4648	0	0.00	0
+phiX174:4649	0	0.00	0
+phiX174:4650	0	0.00	0
+phiX174:4651	0	0.00	0
+phiX174:4652	0	0.00	0
+phiX174:4653	0	0.00	0
+phiX174:4654	0	0.00	0
+phiX174:4655	0	0.00	0
+phiX174:4656	0	0.00	0
+phiX174:4657	0	0.00	0
+phiX174:4658	0	0.00	0
+phiX174:4659	0	0.00	0
+phiX174:4660	0	0.00	0
+phiX174:4661	0	0.00	0
+phiX174:4662	0	0.00	0
+phiX174:4663	0	0.00	0
+phiX174:4664	0	0.00	0
+phiX174:4665	0	0.00	0
+phiX174:4666	0	0.00	0
+phiX174:4667	0	0.00	0
+phiX174:4668	0	0.00	0
+phiX174:4669	0	0.00	0
+phiX174:4670	0	0.00	0
+phiX174:4671	0	0.00	0
+phiX174:4672	0	0.00	0
+phiX174:4673	0	0.00	0
+phiX174:4674	0	0.00	0
+phiX174:4675	0	0.00	0
+phiX174:4676	0	0.00	0
+phiX174:4677	0	0.00	0
+phiX174:4678	0	0.00	0
+phiX174:4679	0	0.00	0
+phiX174:4680	0	0.00	0
+phiX174:4681	0	0.00	0
+phiX174:4682	0	0.00	0
+phiX174:4683	0	0.00	0
+phiX174:4684	0	0.00	0
+phiX174:4685	0	0.00	0
+phiX174:4686	0	0.00	0
+phiX174:4687	0	0.00	0
+phiX174:4688	0	0.00	0
+phiX174:4689	0	0.00	0
+phiX174:4690	0	0.00	0
+phiX174:4691	0	0.00	0
+phiX174:4692	0	0.00	0
+phiX174:4693	0	0.00	0
+phiX174:4694	0	0.00	0
+phiX174:4695	0	0.00	0
+phiX174:4696	0	0.00	0
+phiX174:4697	0	0.00	0
+phiX174:4698	0	0.00	0
+phiX174:4699	0	0.00	0
+phiX174:4700	0	0.00	0
+phiX174:4701	0	0.00	0
+phiX174:4702	0	0.00	0
+phiX174:4703	0	0.00	0
+phiX174:4704	0	0.00	0
+phiX174:4705	0	0.00	0
+phiX174:4706	0	0.00	0
+phiX174:4707	0	0.00	0
+phiX174:4708	0	0.00	0
+phiX174:4709	0	0.00	0
+phiX174:4710	0	0.00	0
+phiX174:4711	0	0.00	0
+phiX174:4712	0	0.00	0
+phiX174:4713	0	0.00	0
+phiX174:4714	0	0.00	0
+phiX174:4715	0	0.00	0
+phiX174:4716	0	0.00	0
+phiX174:4717	0	0.00	0
+phiX174:4718	0	0.00	0
+phiX174:4719	0	0.00	0
+phiX174:4720	0	0.00	0
+phiX174:4721	0	0.00	0
+phiX174:4722	0	0.00	0
+phiX174:4723	0	0.00	0
+phiX174:4724	0	0.00	0
+phiX174:4725	0	0.00	0
+phiX174:4726	0	0.00	0
+phiX174:4727	0	0.00	0
+phiX174:4728	0	0.00	0
+phiX174:4729	0	0.00	0
+phiX174:4730	0	0.00	0
+phiX174:4731	0	0.00	0
+phiX174:4732	0	0.00	0
+phiX174:4733	0	0.00	0
+phiX174:4734	0	0.00	0
+phiX174:4735	0	0.00	0
+phiX174:4736	0	0.00	0
+phiX174:4737	0	0.00	0
+phiX174:4738	0	0.00	0
+phiX174:4739	0	0.00	0
+phiX174:4740	0	0.00	0
+phiX174:4741	0	0.00	0
+phiX174:4742	0	0.00	0
+phiX174:4743	0	0.00	0
+phiX174:4744	0	0.00	0
+phiX174:4745	0	0.00	0
+phiX174:4746	0	0.00	0
+phiX174:4747	0	0.00	0
+phiX174:4748	0	0.00	0
+phiX174:4749	0	0.00	0
+phiX174:4750	0	0.00	0
+phiX174:4751	0	0.00	0
+phiX174:4752	0	0.00	0
+phiX174:4753	0	0.00	0
+phiX174:4754	0	0.00	0
+phiX174:4755	0	0.00	0
+phiX174:4756	0	0.00	0
+phiX174:4757	0	0.00	0
+phiX174:4758	0	0.00	0
+phiX174:4759	0	0.00	0
+phiX174:4760	0	0.00	0
+phiX174:4761	0	0.00	0
+phiX174:4762	0	0.00	0
+phiX174:4763	0	0.00	0
+phiX174:4764	0	0.00	0
+phiX174:4765	0	0.00	0
+phiX174:4766	0	0.00	0
+phiX174:4767	0	0.00	0
+phiX174:4768	0	0.00	0
+phiX174:4769	0	0.00	0
+phiX174:4770	0	0.00	0
+phiX174:4771	0	0.00	0
+phiX174:4772	0	0.00	0
+phiX174:4773	0	0.00	0
+phiX174:4774	0	0.00	0
+phiX174:4775	0	0.00	0
+phiX174:4776	0	0.00	0
+phiX174:4777	0	0.00	0
+phiX174:4778	0	0.00	0
+phiX174:4779	0	0.00	0
+phiX174:4780	0	0.00	0
+phiX174:4781	0	0.00	0
+phiX174:4782	0	0.00	0
+phiX174:4783	0	0.00	0
+phiX174:4784	0	0.00	0
+phiX174:4785	0	0.00	0
+phiX174:4786	0	0.00	0
+phiX174:4787	0	0.00	0
+phiX174:4788	0	0.00	0
+phiX174:4789	0	0.00	0
+phiX174:4790	0	0.00	0
+phiX174:4791	0	0.00	0
+phiX174:4792	0	0.00	0
+phiX174:4793	0	0.00	0
+phiX174:4794	0	0.00	0
+phiX174:4795	0	0.00	0
+phiX174:4796	0	0.00	0
+phiX174:4797	0	0.00	0
+phiX174:4798	0	0.00	0
+phiX174:4799	0	0.00	0
+phiX174:4800	0	0.00	0
+phiX174:4801	0	0.00	0
+phiX174:4802	0	0.00	0
+phiX174:4803	0	0.00	0
+phiX174:4804	0	0.00	0
+phiX174:4805	0	0.00	0
+phiX174:4806	0	0.00	0
+phiX174:4807	0	0.00	0
+phiX174:4808	0	0.00	0
+phiX174:4809	0	0.00	0
+phiX174:4810	0	0.00	0
+phiX174:4811	0	0.00	0
+phiX174:4812	0	0.00	0
+phiX174:4813	0	0.00	0
+phiX174:4814	0	0.00	0
+phiX174:4815	0	0.00	0
+phiX174:4816	0	0.00	0
+phiX174:4817	0	0.00	0
+phiX174:4818	0	0.00	0
+phiX174:4819	0	0.00	0
+phiX174:4820	0	0.00	0
+phiX174:4821	0	0.00	0
+phiX174:4822	0	0.00	0
+phiX174:4823	0	0.00	0
+phiX174:4824	0	0.00	0
+phiX174:4825	0	0.00	0
+phiX174:4826	0	0.00	0
+phiX174:4827	0	0.00	0
+phiX174:4828	0	0.00	0
+phiX174:4829	0	0.00	0
+phiX174:4830	0	0.00	0
+phiX174:4831	0	0.00	0
+phiX174:4832	0	0.00	0
+phiX174:4833	0	0.00	0
+phiX174:4834	0	0.00	0
+phiX174:4835	0	0.00	0
+phiX174:4836	0	0.00	0
+phiX174:4837	0	0.00	0
+phiX174:4838	0	0.00	0
+phiX174:4839	0	0.00	0
+phiX174:4840	0	0.00	0
+phiX174:4841	0	0.00	0
+phiX174:4842	0	0.00	0
+phiX174:4843	0	0.00	0
+phiX174:4844	0	0.00	0
+phiX174:4845	0	0.00	0
+phiX174:4846	0	0.00	0
+phiX174:4847	0	0.00	0
+phiX174:4848	0	0.00	0
+phiX174:4849	0	0.00	0
+phiX174:4850	0	0.00	0
+phiX174:4851	0	0.00	0
+phiX174:4852	0	0.00	0
+phiX174:4853	0	0.00	0
+phiX174:4854	0	0.00	0
+phiX174:4855	0	0.00	0
+phiX174:4856	0	0.00	0
+phiX174:4857	0	0.00	0
+phiX174:4858	0	0.00	0
+phiX174:4859	0	0.00	0
+phiX174:4860	0	0.00	0
+phiX174:4861	0	0.00	0
+phiX174:4862	0	0.00	0
+phiX174:4863	0	0.00	0
+phiX174:4864	0	0.00	0
+phiX174:4865	0	0.00	0
+phiX174:4866	0	0.00	0
+phiX174:4867	0	0.00	0
+phiX174:4868	0	0.00	0
+phiX174:4869	0	0.00	0
+phiX174:4870	0	0.00	0
+phiX174:4871	0	0.00	0
+phiX174:4872	0	0.00	0
+phiX174:4873	0	0.00	0
+phiX174:4874	0	0.00	0
+phiX174:4875	0	0.00	0
+phiX174:4876	0	0.00	0
+phiX174:4877	0	0.00	0
+phiX174:4878	0	0.00	0
+phiX174:4879	0	0.00	0
+phiX174:4880	0	0.00	0
+phiX174:4881	0	0.00	0
+phiX174:4882	0	0.00	0
+phiX174:4883	0	0.00	0
+phiX174:4884	0	0.00	0
+phiX174:4885	0	0.00	0
+phiX174:4886	0	0.00	0
+phiX174:4887	0	0.00	0
+phiX174:4888	0	0.00	0
+phiX174:4889	0	0.00	0
+phiX174:4890	0	0.00	0
+phiX174:4891	0	0.00	0
+phiX174:4892	0	0.00	0
+phiX174:4893	0	0.00	0
+phiX174:4894	0	0.00	0
+phiX174:4895	0	0.00	0
+phiX174:4896	0	0.00	0
+phiX174:4897	0	0.00	0
+phiX174:4898	0	0.00	0
+phiX174:4899	0	0.00	0
+phiX174:4900	0	0.00	0
+phiX174:4901	0	0.00	0
+phiX174:4902	0	0.00	0
+phiX174:4903	0	0.00	0
+phiX174:4904	0	0.00	0
+phiX174:4905	0	0.00	0
+phiX174:4906	0	0.00	0
+phiX174:4907	0	0.00	0
+phiX174:4908	0	0.00	0
+phiX174:4909	0	0.00	0
+phiX174:4910	0	0.00	0
+phiX174:4911	0	0.00	0
+phiX174:4912	0	0.00	0
+phiX174:4913	0	0.00	0
+phiX174:4914	0	0.00	0
+phiX174:4915	0	0.00	0
+phiX174:4916	0	0.00	0
+phiX174:4917	0	0.00	0
+phiX174:4918	0	0.00	0
+phiX174:4919	0	0.00	0
+phiX174:4920	0	0.00	0
+phiX174:4921	0	0.00	0
+phiX174:4922	0	0.00	0
+phiX174:4923	0	0.00	0
+phiX174:4924	0	0.00	0
+phiX174:4925	0	0.00	0
+phiX174:4926	0	0.00	0
+phiX174:4927	0	0.00	0
+phiX174:4928	0	0.00	0
+phiX174:4929	0	0.00	0
+phiX174:4930	0	0.00	0
+phiX174:4931	0	0.00	0
+phiX174:4932	0	0.00	0
+phiX174:4933	0	0.00	0
+phiX174:4934	0	0.00	0
+phiX174:4935	0	0.00	0
+phiX174:4936	0	0.00	0
+phiX174:4937	0	0.00	0
+phiX174:4938	0	0.00	0
+phiX174:4939	0	0.00	0
+phiX174:4940	0	0.00	0
+phiX174:4941	0	0.00	0
+phiX174:4942	0	0.00	0
+phiX174:4943	0	0.00	0
+phiX174:4944	0	0.00	0
+phiX174:4945	0	0.00	0
+phiX174:4946	0	0.00	0
+phiX174:4947	0	0.00	0
+phiX174:4948	0	0.00	0
+phiX174:4949	0	0.00	0
+phiX174:4950	0	0.00	0
+phiX174:4951	0	0.00	0
+phiX174:4952	0	0.00	0
+phiX174:4953	0	0.00	0
+phiX174:4954	0	0.00	0
+phiX174:4955	0	0.00	0
+phiX174:4956	0	0.00	0
+phiX174:4957	0	0.00	0
+phiX174:4958	0	0.00	0
+phiX174:4959	0	0.00	0
+phiX174:4960	0	0.00	0
+phiX174:4961	0	0.00	0
+phiX174:4962	0	0.00	0
+phiX174:4963	0	0.00	0
+phiX174:4964	0	0.00	0
+phiX174:4965	0	0.00	0
+phiX174:4966	0	0.00	0
+phiX174:4967	0	0.00	0
+phiX174:4968	0	0.00	0
+phiX174:4969	0	0.00	0
+phiX174:4970	0	0.00	0
+phiX174:4971	0	0.00	0
+phiX174:4972	0	0.00	0
+phiX174:4973	0	0.00	0
+phiX174:4974	0	0.00	0
+phiX174:4975	0	0.00	0
+phiX174:4976	0	0.00	0
+phiX174:4977	0	0.00	0
+phiX174:4978	0	0.00	0
+phiX174:4979	0	0.00	0
+phiX174:4980	0	0.00	0
+phiX174:4981	0	0.00	0
+phiX174:4982	0	0.00	0
+phiX174:4983	0	0.00	0
+phiX174:4984	0	0.00	0
+phiX174:4985	0	0.00	0
+phiX174:4986	0	0.00	0
+phiX174:4987	0	0.00	0
+phiX174:4988	0	0.00	0
+phiX174:4989	0	0.00	0
+phiX174:4990	0	0.00	0
+phiX174:4991	0	0.00	0
+phiX174:4992	0	0.00	0
+phiX174:4993	0	0.00	0
+phiX174:4994	0	0.00	0
+phiX174:4995	0	0.00	0
+phiX174:4996	0	0.00	0
+phiX174:4997	0	0.00	0
+phiX174:4998	0	0.00	0
+phiX174:4999	0	0.00	0
+phiX174:5000	0	0.00	0
+phiX174:5001	0	0.00	0
+phiX174:5002	0	0.00	0
+phiX174:5003	0	0.00	0
+phiX174:5004	0	0.00	0
+phiX174:5005	0	0.00	0
+phiX174:5006	0	0.00	0
+phiX174:5007	0	0.00	0
+phiX174:5008	0	0.00	0
+phiX174:5009	0	0.00	0
+phiX174:5010	0	0.00	0
+phiX174:5011	0	0.00	0
+phiX174:5012	0	0.00	0
+phiX174:5013	0	0.00	0
+phiX174:5014	0	0.00	0
+phiX174:5015	0	0.00	0
+phiX174:5016	0	0.00	0
+phiX174:5017	0	0.00	0
+phiX174:5018	0	0.00	0
+phiX174:5019	0	0.00	0
+phiX174:5020	0	0.00	0
+phiX174:5021	0	0.00	0
+phiX174:5022	0	0.00	0
+phiX174:5023	0	0.00	0
+phiX174:5024	0	0.00	0
+phiX174:5025	0	0.00	0
+phiX174:5026	0	0.00	0
+phiX174:5027	0	0.00	0
+phiX174:5028	0	0.00	0
+phiX174:5029	0	0.00	0
+phiX174:5030	0	0.00	0
+phiX174:5031	0	0.00	0
+phiX174:5032	0	0.00	0
+phiX174:5033	0	0.00	0
+phiX174:5034	0	0.00	0
+phiX174:5035	0	0.00	0
+phiX174:5036	0	0.00	0
+phiX174:5037	0	0.00	0
+phiX174:5038	0	0.00	0
+phiX174:5039	0	0.00	0
+phiX174:5040	0	0.00	0
+phiX174:5041	0	0.00	0
+phiX174:5042	0	0.00	0
+phiX174:5043	0	0.00	0
+phiX174:5044	0	0.00	0
+phiX174:5045	0	0.00	0
+phiX174:5046	0	0.00	0
+phiX174:5047	0	0.00	0
+phiX174:5048	0	0.00	0
+phiX174:5049	0	0.00	0
+phiX174:5050	0	0.00	0
+phiX174:5051	0	0.00	0
+phiX174:5052	0	0.00	0
+phiX174:5053	0	0.00	0
+phiX174:5054	0	0.00	0
+phiX174:5055	0	0.00	0
+phiX174:5056	0	0.00	0
+phiX174:5057	0	0.00	0
+phiX174:5058	0	0.00	0
+phiX174:5059	0	0.00	0
+phiX174:5060	0	0.00	0
+phiX174:5061	0	0.00	0
+phiX174:5062	0	0.00	0
+phiX174:5063	0	0.00	0
+phiX174:5064	0	0.00	0
+phiX174:5065	0	0.00	0
+phiX174:5066	0	0.00	0
+phiX174:5067	0	0.00	0
+phiX174:5068	0	0.00	0
+phiX174:5069	0	0.00	0
+phiX174:5070	0	0.00	0
+phiX174:5071	0	0.00	0
+phiX174:5072	0	0.00	0
+phiX174:5073	0	0.00	0
+phiX174:5074	0	0.00	0
+phiX174:5075	0	0.00	0
+phiX174:5076	0	0.00	0
+phiX174:5077	0	0.00	0
+phiX174:5078	0	0.00	0
+phiX174:5079	0	0.00	0
+phiX174:5080	0	0.00	0
+phiX174:5081	0	0.00	0
+phiX174:5082	0	0.00	0
+phiX174:5083	0	0.00	0
+phiX174:5084	0	0.00	0
+phiX174:5085	0	0.00	0
+phiX174:5086	0	0.00	0
+phiX174:5087	0	0.00	0
+phiX174:5088	0	0.00	0
+phiX174:5089	0	0.00	0
+phiX174:5090	0	0.00	0
+phiX174:5091	0	0.00	0
+phiX174:5092	0	0.00	0
+phiX174:5093	0	0.00	0
+phiX174:5094	0	0.00	0
+phiX174:5095	0	0.00	0
+phiX174:5096	0	0.00	0
+phiX174:5097	0	0.00	0
+phiX174:5098	0	0.00	0
+phiX174:5099	0	0.00	0
+phiX174:5100	0	0.00	0
+phiX174:5101	0	0.00	0
+phiX174:5102	0	0.00	0
+phiX174:5103	0	0.00	0
+phiX174:5104	0	0.00	0
+phiX174:5105	0	0.00	0
+phiX174:5106	0	0.00	0
+phiX174:5107	0	0.00	0
+phiX174:5108	0	0.00	0
+phiX174:5109	0	0.00	0
+phiX174:5110	0	0.00	0
+phiX174:5111	0	0.00	0
+phiX174:5112	0	0.00	0
+phiX174:5113	0	0.00	0
+phiX174:5114	0	0.00	0
+phiX174:5115	0	0.00	0
+phiX174:5116	0	0.00	0
+phiX174:5117	0	0.00	0
+phiX174:5118	0	0.00	0
+phiX174:5119	0	0.00	0
+phiX174:5120	0	0.00	0
+phiX174:5121	0	0.00	0
+phiX174:5122	0	0.00	0
+phiX174:5123	0	0.00	0
+phiX174:5124	0	0.00	0
+phiX174:5125	0	0.00	0
+phiX174:5126	0	0.00	0
+phiX174:5127	0	0.00	0
+phiX174:5128	0	0.00	0
+phiX174:5129	0	0.00	0
+phiX174:5130	0	0.00	0
+phiX174:5131	0	0.00	0
+phiX174:5132	0	0.00	0
+phiX174:5133	0	0.00	0
+phiX174:5134	0	0.00	0
+phiX174:5135	0	0.00	0
+phiX174:5136	0	0.00	0
+phiX174:5137	0	0.00	0
+phiX174:5138	0	0.00	0
+phiX174:5139	0	0.00	0
+phiX174:5140	0	0.00	0
+phiX174:5141	0	0.00	0
+phiX174:5142	0	0.00	0
+phiX174:5143	0	0.00	0
+phiX174:5144	0	0.00	0
+phiX174:5145	0	0.00	0
+phiX174:5146	0	0.00	0
+phiX174:5147	0	0.00	0
+phiX174:5148	0	0.00	0
+phiX174:5149	0	0.00	0
+phiX174:5150	0	0.00	0
+phiX174:5151	0	0.00	0
+phiX174:5152	0	0.00	0
+phiX174:5153	0	0.00	0
+phiX174:5154	0	0.00	0
+phiX174:5155	0	0.00	0
+phiX174:5156	0	0.00	0
+phiX174:5157	0	0.00	0
+phiX174:5158	0	0.00	0
+phiX174:5159	0	0.00	0
+phiX174:5160	0	0.00	0
+phiX174:5161	0	0.00	0
+phiX174:5162	0	0.00	0
+phiX174:5163	0	0.00	0
+phiX174:5164	0	0.00	0
+phiX174:5165	0	0.00	0
+phiX174:5166	0	0.00	0
+phiX174:5167	0	0.00	0
+phiX174:5168	0	0.00	0
+phiX174:5169	0	0.00	0
+phiX174:5170	0	0.00	0
+phiX174:5171	0	0.00	0
+phiX174:5172	0	0.00	0
+phiX174:5173	0	0.00	0
+phiX174:5174	0	0.00	0
+phiX174:5175	0	0.00	0
+phiX174:5176	0	0.00	0
+phiX174:5177	0	0.00	0
+phiX174:5178	0	0.00	0
+phiX174:5179	0	0.00	0
+phiX174:5180	0	0.00	0
+phiX174:5181	0	0.00	0
+phiX174:5182	0	0.00	0
+phiX174:5183	0	0.00	0
+phiX174:5184	0	0.00	0
+phiX174:5185	0	0.00	0
+phiX174:5186	0	0.00	0
+phiX174:5187	0	0.00	0
+phiX174:5188	0	0.00	0
+phiX174:5189	0	0.00	0
+phiX174:5190	0	0.00	0
+phiX174:5191	0	0.00	0
+phiX174:5192	0	0.00	0
+phiX174:5193	0	0.00	0
+phiX174:5194	0	0.00	0
+phiX174:5195	0	0.00	0
+phiX174:5196	0	0.00	0
+phiX174:5197	0	0.00	0
+phiX174:5198	0	0.00	0
+phiX174:5199	0	0.00	0
+phiX174:5200	0	0.00	0
+phiX174:5201	0	0.00	0
+phiX174:5202	0	0.00	0
+phiX174:5203	0	0.00	0
+phiX174:5204	0	0.00	0
+phiX174:5205	0	0.00	0
+phiX174:5206	0	0.00	0
+phiX174:5207	0	0.00	0
+phiX174:5208	0	0.00	0
+phiX174:5209	0	0.00	0
+phiX174:5210	0	0.00	0
+phiX174:5211	0	0.00	0
+phiX174:5212	0	0.00	0
+phiX174:5213	0	0.00	0
+phiX174:5214	0	0.00	0
+phiX174:5215	0	0.00	0
+phiX174:5216	0	0.00	0
+phiX174:5217	0	0.00	0
+phiX174:5218	0	0.00	0
+phiX174:5219	0	0.00	0
+phiX174:5220	0	0.00	0
+phiX174:5221	0	0.00	0
+phiX174:5222	0	0.00	0
+phiX174:5223	0	0.00	0
+phiX174:5224	0	0.00	0
+phiX174:5225	0	0.00	0
+phiX174:5226	0	0.00	0
+phiX174:5227	0	0.00	0
+phiX174:5228	0	0.00	0
+phiX174:5229	0	0.00	0
+phiX174:5230	0	0.00	0
+phiX174:5231	0	0.00	0
+phiX174:5232	0	0.00	0
+phiX174:5233	0	0.00	0
+phiX174:5234	0	0.00	0
+phiX174:5235	0	0.00	0
+phiX174:5236	0	0.00	0
+phiX174:5237	0	0.00	0
+phiX174:5238	0	0.00	0
+phiX174:5239	0	0.00	0
+phiX174:5240	0	0.00	0
+phiX174:5241	0	0.00	0
+phiX174:5242	0	0.00	0
+phiX174:5243	0	0.00	0
+phiX174:5244	0	0.00	0
+phiX174:5245	0	0.00	0
+phiX174:5246	0	0.00	0
+phiX174:5247	0	0.00	0
+phiX174:5248	0	0.00	0
+phiX174:5249	0	0.00	0
+phiX174:5250	0	0.00	0
+phiX174:5251	0	0.00	0
+phiX174:5252	0	0.00	0
+phiX174:5253	0	0.00	0
+phiX174:5254	0	0.00	0
+phiX174:5255	0	0.00	0
+phiX174:5256	0	0.00	0
+phiX174:5257	0	0.00	0
+phiX174:5258	0	0.00	0
+phiX174:5259	0	0.00	0
+phiX174:5260	0	0.00	0
+phiX174:5261	0	0.00	0
+phiX174:5262	0	0.00	0
+phiX174:5263	0	0.00	0
+phiX174:5264	0	0.00	0
+phiX174:5265	0	0.00	0
+phiX174:5266	0	0.00	0
+phiX174:5267	0	0.00	0
+phiX174:5268	0	0.00	0
+phiX174:5269	0	0.00	0
+phiX174:5270	0	0.00	0
+phiX174:5271	0	0.00	0
+phiX174:5272	0	0.00	0
+phiX174:5273	0	0.00	0
+phiX174:5274	0	0.00	0
+phiX174:5275	0	0.00	0
+phiX174:5276	0	0.00	0
+phiX174:5277	0	0.00	0
+phiX174:5278	0	0.00	0
+phiX174:5279	0	0.00	0
+phiX174:5280	0	0.00	0
+phiX174:5281	0	0.00	0
+phiX174:5282	0	0.00	0
+phiX174:5283	0	0.00	0
+phiX174:5284	0	0.00	0
+phiX174:5285	0	0.00	0
+phiX174:5286	0	0.00	0
+phiX174:5287	0	0.00	0
+phiX174:5288	0	0.00	0
+phiX174:5289	0	0.00	0
+phiX174:5290	0	0.00	0
+phiX174:5291	0	0.00	0
+phiX174:5292	0	0.00	0
+phiX174:5293	0	0.00	0
+phiX174:5294	0	0.00	0
+phiX174:5295	0	0.00	0
+phiX174:5296	0	0.00	0
+phiX174:5297	0	0.00	0
+phiX174:5298	0	0.00	0
+phiX174:5299	0	0.00	0
+phiX174:5300	0	0.00	0
+phiX174:5301	0	0.00	0
+phiX174:5302	0	0.00	0
+phiX174:5303	0	0.00	0
+phiX174:5304	0	0.00	0
+phiX174:5305	0	0.00	0
+phiX174:5306	0	0.00	0
+phiX174:5307	0	0.00	0
+phiX174:5308	0	0.00	0
+phiX174:5309	0	0.00	0
+phiX174:5310	0	0.00	0
+phiX174:5311	0	0.00	0
+phiX174:5312	0	0.00	0
+phiX174:5313	0	0.00	0
+phiX174:5314	0	0.00	0
+phiX174:5315	0	0.00	0
+phiX174:5316	0	0.00	0
+phiX174:5317	0	0.00	0
+phiX174:5318	0	0.00	0
+phiX174:5319	0	0.00	0
+phiX174:5320	0	0.00	0
+phiX174:5321	0	0.00	0
+phiX174:5322	0	0.00	0
+phiX174:5323	0	0.00	0
+phiX174:5324	0	0.00	0
+phiX174:5325	0	0.00	0
+phiX174:5326	0	0.00	0
+phiX174:5327	0	0.00	0
+phiX174:5328	0	0.00	0
+phiX174:5329	0	0.00	0
+phiX174:5330	0	0.00	0
+phiX174:5331	0	0.00	0
+phiX174:5332	0	0.00	0
+phiX174:5333	0	0.00	0
+phiX174:5334	0	0.00	0
+phiX174:5335	0	0.00	0
+phiX174:5336	0	0.00	0
+phiX174:5337	0	0.00	0
+phiX174:5338	0	0.00	0
+phiX174:5339	0	0.00	0
+phiX174:5340	0	0.00	0
+phiX174:5341	0	0.00	0
+phiX174:5342	0	0.00	0
+phiX174:5343	0	0.00	0
+phiX174:5344	0	0.00	0
+phiX174:5345	0	0.00	0
+phiX174:5346	0	0.00	0
+phiX174:5347	0	0.00	0
+phiX174:5348	0	0.00	0
+phiX174:5349	0	0.00	0
+phiX174:5350	0	0.00	0
+phiX174:5351	0	0.00	0
+phiX174:5352	0	0.00	0
+phiX174:5353	0	0.00	0
+phiX174:5354	0	0.00	0
+phiX174:5355	0	0.00	0
+phiX174:5356	0	0.00	0
+phiX174:5357	0	0.00	0
+phiX174:5358	0	0.00	0
+phiX174:5359	0	0.00	0
+phiX174:5360	0	0.00	0
+phiX174:5361	0	0.00	0
+phiX174:5362	0	0.00	0
+phiX174:5363	0	0.00	0
+phiX174:5364	0	0.00	0
+phiX174:5365	0	0.00	0
+phiX174:5366	0	0.00	0
+phiX174:5367	0	0.00	0
+phiX174:5368	0	0.00	0
+phiX174:5369	0	0.00	0
+phiX174:5370	0	0.00	0
+phiX174:5371	0	0.00	0
+phiX174:5372	0	0.00	0
+phiX174:5373	0	0.00	0
+phiX174:5374	0	0.00	0
+phiX174:5375	0	0.00	0
+phiX174:5376	0	0.00	0
+phiX174:5377	0	0.00	0
+phiX174:5378	0	0.00	0
+phiX174:5379	0	0.00	0
+phiX174:5380	0	0.00	0
+phiX174:5381	0	0.00	0
+phiX174:5382	0	0.00	0
+phiX174:5383	0	0.00	0
+phiX174:5384	0	0.00	0
+phiX174:5385	0	0.00	0
+phiX174:5386	0	0.00	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,2 @@
+Source_of_reads	from_0_to_1)	from_1_to_2)	from_2_to_3)	from_3_to_4)	from_4_to_5)	from_5_to_6)	from_6_to_7)	from_7_to_8)	from_8_to_9)	from_9_to_10)	from_10_to_11)	from_11_to_12)	from_12_to_13)	from_13_to_14)	from_14_to_15)	from_15_to_16)	from_16_to_17)	from_17_to_18)	from_18_to_19)	from_19_to_20)	from_20_to_21)	from_21_to_22)	from_22_to_23)	from_23_to_24)	from_24_to_25)	from_25_to_26)	from_26_to_27)	from_27_to_28)	from_28_to_29)	from_29_to_30)	from_30_to_31)	from_31_to_32)	from_32_to_33)	from_33_to_34)	from_34_to_35)	from_35_to_36)	from_36_to_37)	from_37_to_38)	from_38_to_39)	from_39_to_40)	from_40_to_41)	from_41_to_42)	from_42_to_43)	from_43_to_44)	from_44_to_45)	from_45_to_46)	from_46_to_47)	from_47_to_48)	from_48_to_49)	from_49_to_50)	from_50_to_51)	from_51_to_52)	from_52_to_53)	from_53_to_54)	from_54_to_55)	from_55_to_56)	from_56_to_57)	from_57_to_58)	from_58_to_59)	from_59_to_60)	from_60_to_61)	from_61_to_62)	from_62_to_63)	from_63_to_64)	from_64_to_65)	from_65_to_66)	from_66_to_67)	from_67_to_68)	from_68_to_69)	from_69_to_70)	from_70_to_71)	from_71_to_72)	from_72_to_73)	from_73_to_74)	from_74_to_75)	from_75_to_76)	from_76_to_77)	from_77_to_78)	from_78_to_79)	from_79_to_80)	from_80_to_81)	from_81_to_82)	from_82_to_83)	from_83_to_84)	from_84_to_85)	from_85_to_86)	from_86_to_87)	from_87_to_88)	from_88_to_89)	from_89_to_90)	from_90_to_91)	from_91_to_92)	from_92_to_93)	from_93_to_94)	from_94_to_95)	from_95_to_96)	from_96_to_97)	from_97_to_98)	from_98_to_99)	from_99_to_100)	from_100_to_101)	from_101_to_102)	from_102_to_103)	from_103_to_104)	from_104_to_105)	from_105_to_106)	from_106_to_107)	from_107_to_108)	from_108_to_109)	from_109_to_110)	from_110_to_111)	from_111_to_112)	from_112_to_113)	from_113_to_114)	from_114_to_115)	from_115_to_116)	from_116_to_117)	from_117_to_118)	from_118_to_119)	from_119_to_120)	from_120_to_121)	from_121_to_122)	from_122_to_123)	from_123_to_124)	from_124_to_125)	from_125_to_126)	from_126_to_127)	from_127_to_128)	from_128_to_129)	from_129_to_130)	from_130_to_131)	from_131_to_132)	from_132_to_133)	from_133_to_134)	from_134_to_135)	from_135_to_136)	from_136_to_137)	from_137_to_138)	from_138_to_139)	from_139_to_140)	from_140_to_141)	from_141_to_142)	from_142_to_143)	from_143_to_144)	from_144_to_145)	from_145_to_146)	from_146_to_147)	from_147_to_148)	from_148_to_149)	from_149_to_150)	from_150_to_151)	from_151_to_152)	from_152_to_153)	from_153_to_154)	from_154_to_155)	from_155_to_156)	from_156_to_157)	from_157_to_158)	from_158_to_159)	from_159_to_160)	from_160_to_161)	from_161_to_162)	from_162_to_163)	from_163_to_164)	from_164_to_165)	from_165_to_166)	from_166_to_167)	from_167_to_168)	from_168_to_169)	from_169_to_170)	from_170_to_171)	from_171_to_172)	from_172_to_173)	from_173_to_174)	from_174_to_175)	from_175_to_176)	from_176_to_177)	from_177_to_178)	from_178_to_179)	from_179_to_180)	from_180_to_181)	from_181_to_182)	from_182_to_183)	from_183_to_184)	from_184_to_185)	from_185_to_186)	from_186_to_187)	from_187_to_188)	from_188_to_189)	from_189_to_190)	from_190_to_191)	from_191_to_192)	from_192_to_193)	from_193_to_194)	from_194_to_195)	from_195_to_196)	from_196_to_197)	from_197_to_198)	from_198_to_199)	from_199_to_200)	from_200_to_201)	from_201_to_202)	from_202_to_203)	from_203_to_204)	from_204_to_205)	from_205_to_206)	from_206_to_207)	from_207_to_208)	from_208_to_209)	from_209_to_210)	from_210_to_211)	from_211_to_212)	from_212_to_213)	from_213_to_214)	from_214_to_215)	from_215_to_216)	from_216_to_217)	from_217_to_218)	from_218_to_219)	from_219_to_220)	from_220_to_221)	from_221_to_222)	from_222_to_223)	from_223_to_224)	from_224_to_225)	from_225_to_226)	from_226_to_227)	from_227_to_228)	from_228_to_229)	from_229_to_230)	from_230_to_231)	from_231_to_232)	from_232_to_233)	from_233_to_234)	from_234_to_235)	from_235_to_236)	from_236_to_237)	from_237_to_238)	from_238_to_239)	from_239_to_240)	from_240_to_241)	from_241_to_242)	from_242_to_243)	from_243_to_244)	from_244_to_245)	from_245_to_246)	from_246_to_247)	from_247_to_248)	from_248_to_249)	from_249_to_250)	from_250_to_251)	from_251_to_252)	from_252_to_253)	from_253_to_254)	from_254_to_255)	from_255_to_256)	from_256_to_257)	from_257_to_258)	from_258_to_259)	from_259_to_260)	from_260_to_261)	from_261_to_262)	from_262_to_263)	from_263_to_264)	from_264_to_265)	from_265_to_266)	from_266_to_267)	from_267_to_268)	from_268_to_269)	from_269_to_270)	from_270_to_271)	from_271_to_272)	from_272_to_273)	from_273_to_274)	from_274_to_275)	from_275_to_276)	from_276_to_277)	from_277_to_278)	from_278_to_279)	from_279_to_280)	from_280_to_281)	from_281_to_282)	from_282_to_283)	from_283_to_284)	from_284_to_285)	from_285_to_286)	from_286_to_287)	from_287_to_288)	from_288_to_289)	from_289_to_290)	from_290_to_291)	from_291_to_292)	from_292_to_293)	from_293_to_294)	from_294_to_295)	from_295_to_296)	from_296_to_297)	from_297_to_298)	from_298_to_299)	from_299_to_300)	from_300_to_301)	from_301_to_302)	from_302_to_303)	from_303_to_304)	from_304_to_305)	from_305_to_306)	from_306_to_307)	from_307_to_308)	from_308_to_309)	from_309_to_310)	from_310_to_311)	from_311_to_312)	from_312_to_313)	from_313_to_314)	from_314_to_315)	from_315_to_316)	from_316_to_317)	from_317_to_318)	from_318_to_319)	from_319_to_320)	from_320_to_321)	from_321_to_322)	from_322_to_323)	from_323_to_324)	from_324_to_325)	from_325_to_326)	from_326_to_327)	from_327_to_328)	from_328_to_329)	from_329_to_330)	from_330_to_331)	from_331_to_332)	from_332_to_333)	from_333_to_334)	from_334_to_335)	from_335_to_336)	from_336_to_337)	from_337_to_338)	from_338_to_339)	from_339_to_340)	from_340_to_341)	from_341_to_342)	from_342_to_343)	from_343_to_344)	from_344_to_345)	from_345_to_346)	from_346_to_347)	from_347_to_348)	from_348_to_349)	from_349_to_350)	from_350_to_351)	from_351_to_352)	from_352_to_353)	from_353_to_354)	from_354_to_355)	from_355_to_356)	from_356_to_357)	from_357_to_358)	from_358_to_359)	from_359_to_360)	from_360_to_361)	from_361_to_362)	from_362_to_363)	from_363_to_364)	from_364_to_365)	from_365_to_366)	from_366_to_367)	from_367_to_368)	from_368_to_369)	from_369_to_370)	from_370_to_371)	from_371_to_372)	from_372_to_373)	from_373_to_374)	from_374_to_375)	from_375_to_376)	from_376_to_377)	from_377_to_378)	from_378_to_379)	from_379_to_380)	from_380_to_381)	from_381_to_382)	from_382_to_383)	from_383_to_384)	from_384_to_385)	from_385_to_386)	from_386_to_387)	from_387_to_388)	from_388_to_389)	from_389_to_390)	from_390_to_391)	from_391_to_392)	from_392_to_393)	from_393_to_394)	from_394_to_395)	from_395_to_396)	from_396_to_397)	from_397_to_398)	from_398_to_399)	from_399_to_400)	from_400_to_401)	from_401_to_402)	from_402_to_403)	from_403_to_404)	from_404_to_405)	from_405_to_406)	from_406_to_407)	from_407_to_408)	from_408_to_409)	from_409_to_410)	from_410_to_411)	from_411_to_412)	from_412_to_413)	from_413_to_414)	from_414_to_415)	from_415_to_416)	from_416_to_417)	from_417_to_418)	from_418_to_419)	from_419_to_420)	from_420_to_421)	from_421_to_422)	from_422_to_423)	from_423_to_424)	from_424_to_425)	from_425_to_426)	from_426_to_427)	from_427_to_428)	from_428_to_429)	from_429_to_430)	from_430_to_431)	from_431_to_432)	from_432_to_433)	from_433_to_434)	from_434_to_435)	from_435_to_436)	from_436_to_437)	from_437_to_438)	from_438_to_439)	from_439_to_440)	from_440_to_441)	from_441_to_442)	from_442_to_443)	from_443_to_444)	from_444_to_445)	from_445_to_446)	from_446_to_447)	from_447_to_448)	from_448_to_449)	from_449_to_450)	from_450_to_451)	from_451_to_452)	from_452_to_453)	from_453_to_454)	from_454_to_455)	from_455_to_456)	from_456_to_457)	from_457_to_458)	from_458_to_459)	from_459_to_460)	from_460_to_461)	from_461_to_462)	from_462_to_463)	from_463_to_464)	from_464_to_465)	from_465_to_466)	from_466_to_467)	from_467_to_468)	from_468_to_469)	from_469_to_470)	from_470_to_471)	from_471_to_472)	from_472_to_473)	from_473_to_474)	from_474_to_475)	from_475_to_476)	from_476_to_477)	from_477_to_478)	from_478_to_479)	from_479_to_480)	from_480_to_481)	from_481_to_482)	from_482_to_483)	from_483_to_484)	from_484_to_485)	from_485_to_486)	from_486_to_487)	from_487_to_488)	from_488_to_489)	from_489_to_490)	from_490_to_491)	from_491_to_492)	from_492_to_493)	from_493_to_494)	from_494_to_495)	from_495_to_496)	from_496_to_497)	from_497_to_498)	from_498_to_499)	from_499_to_500)	from_500_to_inf
+sample_A Fake phiX Sample	5343	2	1	2	1	1	2	2	2	1	29	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,3 @@
+sample_id	total	mean	granular_third_quartile	granular_median	granular_first_quartile	%_bases_above_15
+A Fake phiX Sample	360	0.07	1	1	1	0.0
+Total	360	0.07	N/A	N/A	N/A
Binary file test-data/gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,4 @@
+GenomeAnalysisEngine - Strictness is SILENT 
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
+TraversalEngine - Total runtime
+TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%) 
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_print_reads/gatk_print_reads_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,5 @@
+SAMDataSource$SAMReaders - Initializing SAMRecords in serial
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING]
+TraversalEngine -        Location processed.reads  runtime per.1M.reads completed total.runtime remaining 
+Walker - [REDUCE RESULT] Traversal result is: org.broadinstitute.sting.gatk.io.stubs.SAMFileWriterStub
+TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.gatk_interval	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,1 @@
+phiX174:1446-1447
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_realigner_target_creator/gatk_realigner_target_creator_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,4 @@
+GenomeAnalysisEngine - Strictness is SILENT
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
+TraversalEngine - Total runtime
+TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%)
\ No newline at end of file
Binary file test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,16 @@
+GenomeAnalysisEngine - Strictness is SILENT
+TableRecalibrationWalker - Reading in the data from input csv file...
+TableRecalibrationWalker - ...done!
+TableRecalibrationWalker - The covariates being used here:
+TableRecalibrationWalker - 	ReadGroupCovariate
+TableRecalibrationWalker - 	QualityScoreCovariate
+TableRecalibrationWalker - 	CycleCovariate
+TableRecalibrationWalker - 	DinucCovariate
+TableRecalibrationWalker - 	HomopolymerCovariate
+TableRecalibrationWalker - 	MinimumNQSCovariate
+TableRecalibrationWalker - 	PositionCovariate
+TableRecalibrationWalker - Generating tables of empirical qualities for use in sequential calculation...
+TableRecalibrationWalker - ...done!
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING]
+TraversalEngine - Total runtime
+TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%)
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,12 @@
+Program Args: -T UnifiedGenotyper
+GenomeAnalysisEngine - Strictness is SILENT
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING]
+TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining
+UnifiedGenotyper - Visited bases                                5387
+UnifiedGenotyper - Callable bases                               5344
+UnifiedGenotyper - Confidently called bases                     5344
+UnifiedGenotyper - % callable bases of all loci                 99.202
+UnifiedGenotyper - % confidently called bases of all loci       99.202
+UnifiedGenotyper - % confidently called bases of callable loci  100.000
+UnifiedGenotyper - Actual calls made                            1
+TraversalEngine - Total runtime
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.metrics	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,7 @@
+Visited bases                                5387
+Callable bases                               5344
+Confidently called bases                     5344
+% callable bases of all loci                 99.202
+% confidently called bases of all loci       99.202
+% confidently called bases of callable loci  100.000
+Actual calls made                            1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.vcf	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,28 @@
+##fileformat=VCFv4.1
+##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
+##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
+##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
+##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
+##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
+##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias">
+##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
+##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
+##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
+##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
+##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
+##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
+##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
+##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">
+##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input_0.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=4 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=DISCOVERY output_mode=EMIT_ALL_CONFIDENT_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=4.0 computeSLOD=false alleles=(RodBinding name= source=UNBOUND) assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=-1.0 min_indel_count_for_genotyping=2 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=3.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/input_dbsnp_0.vcf) out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null annotation=[]"
+##contig=<ID=phiX174,length=5386>
+##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A Fake phiX Sample
+phiX174	1443	.	AC	.	0	.	DB;DP=10;MQ=37.74;MQ0=0	GT	./.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_validate_variants/gatk_validate_variants_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,1 @@
+Found 1 records with failures.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,5 @@
+GenomeAnalysisEngine - Strictness is SILENT 
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
+TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining 
+VariantAnnotator - Processed 1 loci.
+TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%) 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,31 @@
+##fileformat=VCFv4.1
+##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
+##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
+##INFO=<ID=AB,Number=1,Type=Float,Description="Allele Balance for hets (ref/(ref+alt))">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
+##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
+##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
+##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
+##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias">
+##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
+##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
+##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
+##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
+##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
+##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
+##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
+##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">
+##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input_0.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=4 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=DISCOVERY output_mode=EMIT_ALL_CONFIDENT_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=4.0 computeSLOD=false alleles=(RodBinding name= source=UNBOUND) assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=-1.0 min_indel_count_for_genotyping=2 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=3.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/input_dbsnp_0.vcf) out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null annotation=[]"
+##VariantAnnotator="analysis_type=VariantAnnotator input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false variant=(RodBinding name=variant source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_variant.vcf) snpEffFile=(RodBinding name= source=UNBOUND) dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_dbsnp_dbsnp.vcf) comp=[] resource=[] out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub annotation=[SpanningDeletions, MappingQualityZero, AlleleBalance, RMSMappingQuality, HaplotypeScore, HomopolymerRun, DepthOfCoverage, MappingQualityRankSumTest, BaseQualityRankSumTest, QualByDepth] group=[] expression=[] useAllAnnotations=false list=false assume_single_sample_reads=null vcfContainsOnlyIndels=false"
+##contig=<ID=phiX174,length=5386>
+##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta
+##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A Fake phiX Sample
+phiX174	1443	.	AC	.	0	.	DB;DP=10;MQ=37.74;MQ0=0	GT	./.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_combine/gatk_variant_combine_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,5 @@
+HelpFormatter - Program Args: -T CombineVariants
+GenomeAnalysisEngine - Strictness is SILENT
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING]
+TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining
+TraversalEngine - Total runtime
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_combine/gatk_variant_combine_out_1.vcf	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,33 @@
+##fileformat=VCFv4.1
+##CombineVariants="analysis_type=CombineVariants input_file=[] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-bFIpbp/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false variant=[(RodBinding name=from_variant_annotator source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-bFIpbp/input_variant_from_variant_annotator.vcf)] out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub genotypemergeoption=PRIORITIZE filteredrecordsmergetype=KEEP_IF_ANY_UNFILTERED rod_priority_list=from_variant_annotator printComplexMerges=false filteredAreUncalled=false minimalVCF=false setKey=set assumeIdenticalSamples=false minimumN=1 mergeInfoWithMaxAC=false"
+##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
+##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
+##INFO=<ID=AB,Number=1,Type=Float,Description="Allele Balance for hets (ref/(ref+alt))">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
+##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
+##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
+##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
+##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias">
+##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
+##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
+##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
+##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
+##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
+##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
+##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
+##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">
+##INFO=<ID=set,Number=1,Type=String,Description="Source VCF for the merged record in CombineVariants">
+##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input_0.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=4 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=DISCOVERY output_mode=EMIT_ALL_CONFIDENT_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=4.0 computeSLOD=false alleles=(RodBinding name= source=UNBOUND) assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=-1.0 min_indel_count_for_genotyping=2 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=3.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/input_dbsnp_0.vcf) out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null annotation=[]"
+##VariantAnnotator="analysis_type=VariantAnnotator input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false variant=(RodBinding name=variant source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_variant.vcf) snpEffFile=(RodBinding name= source=UNBOUND) dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_dbsnp_dbsnp.vcf) comp=[] resource=[] out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub annotation=[SpanningDeletions, MappingQualityZero, AlleleBalance, RMSMappingQuality, HaplotypeScore, HomopolymerRun, DepthOfCoverage, MappingQualityRankSumTest, BaseQualityRankSumTest, QualByDepth] group=[] expression=[] useAllAnnotations=false list=false assume_single_sample_reads=null vcfContainsOnlyIndels=false"
+##contig=<ID=phiX174,length=5386>
+##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta
+##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-bFIpbp/gatk_input.fasta
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A Fake phiX Sample
+phiX174	1443	.	AC	.	.	PASS	AC=0;AF=0.00;AN=0;DB;DP=10;MQ=37.74;MQ0=0;set=ReferenceInAll	GT	./.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_eval/gatk_variant_eval_out_1.gatk_report	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,30 @@
+##:GATKReport.v0.2 CompOverlap : The overlap between eval and comp sites
+CompOverlap  CompRod  EvalRod  JexlExpression  Novelty  nEvalVariants  novelSites  nVariantsAtComp  compRate  nConcordant  concordantRate
+CompOverlap  dbsnp    input_0  none            all                  0           0                0      0.00            0            0.00
+CompOverlap  dbsnp    input_0  none            known                0           0                0      0.00            0            0.00
+CompOverlap  dbsnp    input_0  none            novel                0           0                0      0.00            0            0.00
+
+##:GATKReport.v0.2 CountVariants : Counts different classes of variants in the sample
+CountVariants  CompRod  EvalRod  JexlExpression  Novelty  nProcessedLoci  nCalledLoci  nRefLoci  nVariantLoci  variantRate  variantRatePerBp  nSNPs  nMNPs  nInsertions  nDeletions  nComplex  nSymbolic  nMixed  nNoCalls  nHets  nHomRef  nHomVar  nSingletons  nHomDerived  heterozygosity  heterozygosityPerBp  hetHomRatio  indelRate  indelRatePerBp  deletionInsertionRatio
+CountVariants  dbsnp    input_0  none            all                5386            1         1             0   0.00000000        0.00000000      0      0            0           0         0          0       0         1      0        0        0            0            0        0.00e+00                 0.00         0.00   0.00e+00            0.00                    0.00
+CountVariants  dbsnp    input_0  none            known              5386            1         1             0   0.00000000        0.00000000      0      0            0           0         0          0       0         1      0        0        0            0            0        0.00e+00                 0.00         0.00   0.00e+00            0.00                    0.00
+CountVariants  dbsnp    input_0  none            novel              5386            0         0             0   0.00000000        0.00000000      0      0            0           0         0          0       0         0      0        0        0            0            0        0.00e+00                 0.00         0.00   0.00e+00            0.00                    0.00
+
+##:GATKReport.v0.2 TiTvVariantEvaluator : Ti/Tv Variant Evaluator
+TiTvVariantEvaluator  CompRod  EvalRod  JexlExpression  Novelty  nTi  nTv  tiTvRatio  nTiInComp  nTvInComp  TiTvRatioStandard  nTiDerived  nTvDerived  tiTvDerivedRatio
+TiTvVariantEvaluator  dbsnp    input_0  none            all        0    0       0.00          0          0               0.00           0           0              0.00
+TiTvVariantEvaluator  dbsnp    input_0  none            known      0    0       0.00          0          0               0.00           0           0              0.00
+TiTvVariantEvaluator  dbsnp    input_0  none            novel      0    0       0.00          0          0               0.00           0           0              0.00
+
+##:GATKReport.v0.2 ValidationReport : Assess site accuracy and sensitivity of callset against follow-up validation assay
+ValidationReport  CompRod  EvalRod  JexlExpression  Novelty  nComp  TP  FP  FN  TN  sensitivity  specificity  PPV  FDR  CompMonoEvalNoCall  CompMonoEvalFiltered  CompMonoEvalMono  CompMonoEvalPoly  CompPolyEvalNoCall  CompPolyEvalFiltered  CompPolyEvalMono  CompPolyEvalPoly  CompFiltered  nDifferentAlleleSites
+ValidationReport  dbsnp    input_0  none            all         43   0   0   0  43          NaN       100.00  NaN  NaN                  42                     0                 1                 0                   0                     0                 0                 0             0                      0
+ValidationReport  dbsnp    input_0  none            known        1   0   0   0   1          NaN       100.00  NaN  NaN                   0                     0                 1                 0                   0                     0                 0                 0             0                      0
+ValidationReport  dbsnp    input_0  none            novel       42   0   0   0  42          NaN       100.00  NaN  NaN                  42                     0                 0                 0                   0                     0                 0                 0             0                      0
+
+##:GATKReport.v0.2 VariantSummary : 1000 Genomes Phase I summary of variants table
+VariantSummary  CompRod  EvalRod  JexlExpression  Novelty  nSamples  nProcessedLoci  nSNPs  TiTvRatio  SNPNoveltyRate  nSNPsPerSample  TiTvRatioPerSample  SNPDPPerSample  nIndels  IndelNoveltyRate  nIndelsPerSample  IndelDPPerSample  nSVs  SVNoveltyRate  nSVsPerSample
+VariantSummary  dbsnp    input_0  none            all             1            5386      0       0.00              NA               0                0.00             0.0        0                NA                 0               0.0     0             NA              0
+VariantSummary  dbsnp    input_0  none            known           1            5386      0       0.00              NA               0                0.00             0.0        0                NA                 0               0.0     0             NA              0
+VariantSummary  dbsnp    input_0  none            novel           1            5386      0       0.00              NA               0                0.00             0.0        0                NA                 0               0.0     0             NA              0
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_eval/gatk_variant_eval_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,5 @@
+HelpFormatter - Program Args: -T VariantEval
+GenomeAnalysisEngine - Strictness is SILENT
+TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining
+VariantEvalWalker - Finalizing variant report
+TraversalEngine - Total runtime
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_filtration/gatk_variant_filtration_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,4 @@
+GenomeAnalysisEngine - Strictness is SILENT 
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
+TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining 
+TraversalEngine - Total runtime 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_select/gatk_variant_select_out_1.log.contains	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,4 @@
+GenomeAnalysisEngine - Strictness is SILENT 
+SelectVariants - Including sample 'A Fake phiX Sample' 
+TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining 
+SelectVariants - 1 records processed. 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_variant_select/gatk_variant_select_out_1.vcf	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,32 @@
+##fileformat=VCFv4.1
+##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
+##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
+##INFO=<ID=AB,Number=1,Type=Float,Description="Allele Balance for hets (ref/(ref+alt))">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities">
+##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered">
+##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
+##INFO=<ID=Dels,Number=1,Type=Float,Description="Fraction of Reads Containing Spanning Deletions">
+##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias">
+##INFO=<ID=HRun,Number=1,Type=Integer,Description="Largest Contiguous Homopolymer Run of Variant Allele In Either Direction">
+##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description="Consistency of the site with at most two segregating haplotypes">
+##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description="Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation">
+##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality">
+##INFO=<ID=MQ0,Number=1,Type=Integer,Description="Total Mapping Quality Zero Reads">
+##INFO=<ID=MQRankSum,Number=1,Type=Float,Description="Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities">
+##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth">
+##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description="Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias">
+##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input_0.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=4 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=DISCOVERY output_mode=EMIT_ALL_CONFIDENT_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=4.0 computeSLOD=false alleles=(RodBinding name= source=UNBOUND) assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=-1.0 min_indel_count_for_genotyping=2 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=3.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/input_dbsnp_0.vcf) out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null annotation=[]"
+##VariantAnnotator="analysis_type=VariantAnnotator input_file=[/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.bam] sample_metadata=[] read_buffer_size=null phone_home=NO_ET read_filter=[] intervals=null excludeIntervals=null reference_sequence=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta rodBind=[] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false variant=(RodBinding name=variant source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_variant.vcf) snpEffFile=(RodBinding name= source=UNBOUND) dbsnp=(RodBinding name=dbsnp source=/var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/input_dbsnp_dbsnp.vcf) comp=[] resource=[] out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub annotation=[SpanningDeletions, MappingQualityZero, AlleleBalance, RMSMappingQuality, HaplotypeScore, HomopolymerRun, DepthOfCoverage, MappingQualityRankSumTest, BaseQualityRankSumTest, QualByDepth] group=[] expression=[] useAllAnnotations=false list=false assume_single_sample_reads=null vcfContainsOnlyIndels=false"
+##contig=<ID=phiX174,length=5386>
+##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-aSMuO5/gatk_input.fasta
+##reference=file:///var/folders/78/786YaG3QH58XnzrWynoDBk+++TI/-Tmp-/tmp-gatk-gaJtgB/gatk_input.fasta
+##source=SelectVariants
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A Fake phiX Sample
+phiX174	1443	.	AC	.	0	.	AC=0;AF=0.00;AN=0;DB;DP=0;MQ=37.74;MQ0=0	GT	./.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,12 @@
+<tables>
+    <!-- Location of Picard dict files valid for GATK -->
+    <table name="gatk2_picard_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/gatk2_picard_index.loc" />
+    </table>
+    <!-- Available of GATK references -->
+    <table name="gatk2_annotations" comment_char="#">
+        <columns>value, name, gatk_value, tools_valid_for</columns>
+        <file path="tool-data/gatk2_annotations.txt" />
+    </table>
+</tables>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,30 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <set_environment version="1.0">
+        <environment_variable action="set_to" name="GATK2_PATH">/please set the path to your GATK2 dir in the corresponding env.sh file/</environment_variable>
+    </set_environment>
+    <!--
+    Use GATK2_SITE_OPTIONS to set additional parameters that should be inserted in every GATK2 call.
+    The intended use case was to prohibit GATK2 to collect and send data.
+    For example:
+
+    -et "NO_ET" -K "/data/gatk2_key_file" ##ET no phone home
+    -->
+    <set_environment version="1.0">
+        <environment_variable action="set_to" name="GATK2_SITE_OPTIONS"> </environment_variable>
+    </set_environment>
+
+    <set_environment version="1.0">
+        <environment_variable action="set_to" name="GATK2_JAVA_OPTIONS"> </environment_variable>
+    </set_environment>
+
+    <package name="samtools" version="0.1.19">
+        <repository changeset_revision="a0ab0fae27e5" name="package_samtools_0_1_19" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="picard" version="1.56.0">
+        <repository changeset_revision="7206dbf34dcd" name="package_picard_1_56_0" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="ggplot2" version="0.9.3">
+        <repository changeset_revision="ade406d47752" name="package_r_ggplot2_0_9_3" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/unified_genotyper.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,289 @@
+<tool id="gatk2_unified_genotyper" name="Unified Genotyper" version="@VERSION@.1">
+  <description>SNP and indel caller</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    @BAM_INPUTS@
+    -p '
+    @JAR_PATH@
+    -T "UnifiedGenotyper"
+    @THREADS@
+    --out "${output_vcf}"
+    --metrics_file "${output_metrics}"
+    \$GATK2_SITE_OPTIONS
+
+    ## according to http://www.broadinstitute.org/gatk/guide/article?id=1975
+    --num_cpu_threads_per_data_thread 1
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    --genotype_likelihoods_model "${genotype_likelihoods_model}"
+    --standard_min_confidence_threshold_for_calling "${standard_min_confidence_threshold_for_calling}"
+    --standard_min_confidence_threshold_for_emitting "${standard_min_confidence_threshold_for_emitting}"
+   '
+    @DBSNP_OPTIONS@
+    $allow_n_cigar_reads
+    #include source=$standard_gatk_options#
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        --heterozygosity "${analysis_param_type.heterozygosity}"
+        --pcr_error_rate "${analysis_param_type.pcr_error_rate}"
+        --genotyping_mode "${analysis_param_type.genotyping_mode_type.genotyping_mode}"
+        #if str( $analysis_param_type.genotyping_mode_type.genotyping_mode ) == 'GENOTYPE_GIVEN_ALLELES':
+            --alleles "${analysis_param_type.genotyping_mode_type.input_alleles_rod}"
+        #end if
+        --output_mode "${analysis_param_type.output_mode}"
+        ${analysis_param_type.compute_SLOD}
+        --min_base_quality_score "${analysis_param_type.min_base_quality_score}"
+        --max_deletion_fraction "${analysis_param_type.max_deletion_fraction}"
+        --max_alternate_alleles "${analysis_param_type.max_alternate_alleles}"
+        --min_indel_count_for_genotyping "${analysis_param_type.min_indel_count_for_genotyping}"
+        --indel_heterozygosity "${analysis_param_type.indel_heterozygosity}"
+        --indelGapContinuationPenalty "${analysis_param_type.indelGapContinuationPenalty}"
+        --indelGapOpenPenalty "${analysis_param_type.indelGapOpenPenalty}"
+        --indelHaplotypeSize "${analysis_param_type.indelHaplotypeSize}"
+        ${analysis_param_type.doContextDependentGapPenalties}
+        #if str( $analysis_param_type.annotation ) != "None":
+            #for $annotation in str( $analysis_param_type.annotation.fields.gatk_value ).split( ','):
+                --annotation "${annotation}"
+            #end for
+        #end if
+        #for $additional_annotation in $analysis_param_type.additional_annotations:
+            --annotation "${additional_annotation.additional_annotation_name}"
+        #end for
+        #if str( $analysis_param_type.group ) != "None":
+            #for $group in str( $analysis_param_type.group ).split( ','):
+                --group "${group}"
+            #end for
+        #end if
+        #if str( $analysis_param_type.exclude_annotations ) != "None":
+            #for $annotation in str( $analysis_param_type.exclude_annotations.fields.gatk_value ).split( ','):
+                --excludeAnnotation "${annotation}"
+            #end for
+        #end if
+        #if str( $analysis_param_type.sample_ploidy ) != '':
+          --sample_ploidy "$analysis_param_type.sample_ploidy"
+        #end if
+        '
+##        #if str( $analysis_param_type.snpEff_rod_bind_type.snpEff_rod_bind_type_selector ) == 'set_snpEff':
+##            -p '--annotation "SnpEff"'
+##            -d "--snpEffFile:${analysis_param_type.snpEff_rod_bind_type.snpEff_rod_name},%(file_type)s" "${analysis_param_type.snpEff_rod_bind_type.snpEff_input_rod}" "${analysis_param_type.snpEff_rod_bind_type.snpEff_input_rod.ext}" "input_snpEff_${analysis_param_type.snpEff_rod_bind_type.snpEff_rod_name}"
+##        #else:
+##            -p '--excludeAnnotation "SnpEff"'
+##        #end if
+    #end if
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <expand macro="input_bams_cached" />
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> does not yet work in a repeat...-->
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <expand macro="input_bams_history" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+    <expand macro="dbsnp_param" />
+
+    <param name="genotype_likelihoods_model" type="select" label="Genotype likelihoods calculation model to employ" help="-glm,--genotype_likelihoods_model &amp;lt;genotype_likelihoods_model&amp;gt;">
+      <option value="BOTH" selected="True">BOTH</option>
+      <option value="SNP">SNP</option>
+      <option value="INDEL">INDEL</option>
+    </param>
+
+    <param name="standard_min_confidence_threshold_for_calling" type="float" value="30.0" label="The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be called" help="-stand_call_conf,--standard_min_confidence_threshold_for_calling &amp;lt;standard_min_confidence_threshold_for_calling&amp;gt;" />
+    <param name="standard_min_confidence_threshold_for_emitting" type="float" value="30.0" label="The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be emitted (and filtered if less than the calling threshold)" help="-stand_emit_conf,--standard_min_confidence_threshold_for_emitting &amp;lt;standard_min_confidence_threshold_for_emitting&amp;gt;" />
+
+    <expand macro="allow_n_cigar_reads" />
+    <expand macro="gatk_param_type_conditional" />
+
+    <expand macro="analysis_type_conditional">
+        <param name="heterozygosity" type="float" value="1e-3" label="Heterozygosity value used to compute prior likelihoods for any locus"
+            help="-hets,--heterozygosity &amp;lt;heterozygosity&amp;gt;" />
+        <param name="pcr_error_rate" type="float" value="1e-4" label="The PCR error rate to be used for computing fragment-based likelihoods"
+            help="-pcr_error,--pcr_error_rate &amp;lt;pcr_error_rate&amp;gt;" />
+        <conditional name="genotyping_mode_type">
+          <param name="genotyping_mode" type="select" label="How to determine the alternate allele to use for genotyping" help="-gt_mode,--genotyping_mode &amp;lt;genotyping_mode&amp;gt;">
+            <option value="DISCOVERY" selected="True">DISCOVERY</option>
+            <option value="GENOTYPE_GIVEN_ALLELES">GENOTYPE_GIVEN_ALLELES</option>
+          </param>
+          <when value="DISCOVERY">
+            <!-- Do nothing here -->
+          </when>
+          <when value="GENOTYPE_GIVEN_ALLELES">
+            <param name="input_alleles_rod" type="data" format="vcf" label="Alleles ROD file" help="-alleles,--alleles &amp;lt;alleles&amp;gt;" />
+          </when>
+        </conditional>
+        <param name="output_mode" type="select" label="Should we output confident genotypes (i.e. including ref calls) or just the variants?" help="-out_mode,--output_mode &amp;lt;output_mode&amp;gt;">
+          <option value="EMIT_VARIANTS_ONLY" selected="True">EMIT_VARIANTS_ONLY</option>
+          <option value="EMIT_ALL_CONFIDENT_SITES">EMIT_ALL_CONFIDENT_SITES</option>
+          <option value="EMIT_ALL_SITES">EMIT_ALL_SITES</option>
+        </param>
+        <param name="compute_SLOD" type="boolean" truevalue="--computeSLOD" falsevalue="" label="Compute the SLOD" help="--computeSLOD" />
+        <param name="min_base_quality_score" type="integer" value="17" label="Minimum base quality required to consider a base for calling" help="-mbq,--min_base_quality_score &amp;lt;min_base_quality_score&amp;gt;" />
+        <param name="max_deletion_fraction" type="float" value="0.05" label="Maximum fraction of reads with deletions spanning this locus for it to be callable" help="to disable, set to &lt; 0 or &gt; 1 (-deletions,--max_deletion_fraction &amp;lt;max_deletion_fraction&amp;gt;)" />
+        <param name="max_alternate_alleles" type="integer" value="6" label="Maximum number of alternate alleles to genotype" help="-maxAlleles,--max_alternate_alleles &amp;lt;max_alternate_alleles&amp;gt;" />
+        <param name="min_indel_count_for_genotyping" type="integer" value="5" label="Minimum number of consensus indels required to trigger genotyping run" help="-minIndelCnt,--min_indel_count_for_genotyping &amp;lt;min_indel_count_for_genotyping&amp;gt;" />
+        <param name="indel_heterozygosity" type="float" value="0.000125" label="Heterozygosity for indel calling" help="1.0/8000==0.000125 (-indelHeterozygosity,--indel_heterozygosity &amp;lt;indel_heterozygosity&amp;gt;)"/>
+        <param name="indelGapContinuationPenalty" type="integer" value="10" label="Indel gap continuation penalty" help="As Phred-scaled probability, i.e. 30 => 10^-30/10 (--indelGapContinuationPenalty)">
+          <validator type="in_range" message="value between 0 and 255" min="0" max="255" />
+        </param>
+        <param name="indelGapOpenPenalty" type="integer" value="45" label="Indel gap open penalty" help="As Phred-scaled probability, i.e. 30 => 10^-30/10 (--indelGapOpenPenalty)">
+          <validator type="in_range" message="value between 0 and 255" min="0" max="255" />
+        </param>
+        <!-- indelHaplotypeSize - Gone in GATK 2.4? -->
+        <param name="indelHaplotypeSize" type="integer" value="80" label="Indel haplotype size" help="--indelHaplotypeSize" />
+        <param name="doContextDependentGapPenalties" type="boolean" truevalue="--doContextDependentGapPenalties" falsevalue="" label="Vary gap penalties by context" help="--doContextDependentGapPenalties" />
+        <param name="annotation" type="select" multiple="True" display="checkboxes" label="Annotation Types" help="-A,--annotation &amp;lt;annotation&amp;gt;">
+          <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs -->
+          <options from_data_table="gatk2_annotations">
+            <filter type="multiple_splitter" column="tools_valid_for" separator=","/>
+            <filter type="static_value" value="UnifiedGenotyper" column="tools_valid_for"/>
+          </options>
+        </param>
+        <repeat name="additional_annotations" title="Additional annotation" help="-A,--annotation &amp;lt;annotation&amp;gt;">
+          <param name="additional_annotation_name" type="text" value="" label="Annotation name" />
+        </repeat>
+<!--
+        <conditional name="snpEff_rod_bind_type">
+          <param name="snpEff_rod_bind_type_selector" type="select" label="Provide a snpEff reference-ordered data file">
+            <option value="set_snpEff">Set snpEff</option>
+            <option value="exclude_snpEff" selected="True">Don't set snpEff</option>
+          </param>
+          <when value="exclude_snpEff">
+          </when>
+          <when value="set_snpEff">
+            <param name="snpEff_input_rod" type="data" format="vcf" label="ROD file" />
+            <param name="snpEff_rod_name" type="hidden" value="snpEff" label="ROD Name"/>
+          </when>
+        </conditional>
+-->
+        <param name="group" type="select" multiple="True" display="checkboxes" label="Annotation Interfaces/Groups" help="-G,--group &amp;lt;group&amp;gt;">
+            <option value="RodRequiringAnnotation">RodRequiringAnnotation</option>
+            <option value="Standard">Standard</option>
+            <option value="Experimental">Experimental</option>
+            <option value="WorkInProgress">WorkInProgress</option>
+            <option value="RankSumTest">RankSumTest</option>
+            <!-- <option value="none">none</option> -->
+        </param>
+    <!--     <param name="family_string" type="text" value="" label="Family String"/> -->
+        <param name="exclude_annotations" type="select" multiple="True" display="checkboxes" label="Annotations to exclude"
+            help="-XA,--excludeAnnotation &amp;lt;excludeAnnotation&amp;gt;" >
+          <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs -->
+          <options from_data_table="gatk2_annotations">
+            <filter type="multiple_splitter" column="tools_valid_for" separator=","/>
+            <filter type="static_value" value="UnifiedGenotyper" column="tools_valid_for"/>
+          </options>
+        </param>
+        <param name="sample_ploidy" type="integer" value="2"
+            label="Ploidy (number of chromosomes) per sample. For pooled data, set to (Number of samples in each pool * Sample Ploidy)" help="-ploidy,--sample_ploidy" />
+    </expand>
+  </inputs>
+  <outputs>
+    <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (VCF)" />
+    <data format="txt" name="output_metrics" label="${tool.name} on ${on_string} (metrics)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <trackster_conf/>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" />
+          <param name="dbsnp_rod_bind_type_selector" value="set_dbsnp" />
+          <param name="dbsnp_input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" />
+          <param name="dbsnp_rod_name" value="dbsnp" />
+          <param name="standard_min_confidence_threshold_for_calling" value="0" />
+          <param name="standard_min_confidence_threshold_for_emitting" value="4" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="advanced" />
+          <param name="genotype_likelihoods_model" value="BOTH" />
+          <param name="heterozygosity" value="0.001" />
+          <param name="pcr_error_rate" value="0.0001" />
+          <param name="genotyping_mode" value="DISCOVERY" />
+          <param name="output_mode" value="EMIT_ALL_CONFIDENT_SITES" />
+          <param name="compute_SLOD" />
+          <param name="min_base_quality_score" value="17" />
+          <param name="max_deletion_fraction" value="-1" />
+          <param name="min_indel_count_for_genotyping" value="2" />
+          <param name="indel_heterozygosity" value="0.000125" />
+          <param name="indelGapContinuationPenalty" value="10" />
+          <param name="indelGapOpenPenalty" value="3" />
+          <param name="indelHaplotypeSize" value="80" />
+          <param name="doContextDependentGapPenalties" />
+          <!-- <param name="annotation" value="" />
+          <param name="group" value="" /> -->
+          <output name="output_vcf" file="gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.vcf" lines_diff="4" />
+          <output name="output_metrics" file="gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.metrics" />
+          <output name="output_log" file="gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+A variant caller which unifies the approaches of several disparate callers.  Works for single-sample and multi-sample data.  The user can choose from several different incorporated calculation models.
+
+For more information on the GATK Unified Genotyper, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_genotyper_UnifiedGenotyper.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: UnifiedGenotyper accepts an aligned BAM input file.
+
+
+**Outputs**
+
+The output is in VCF format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ genotype_likelihoods_model                        Genotype likelihoods calculation model to employ -- BOTH is the default option, while INDEL is also available for calling indels and SNP is available for calling SNPs only (SNP|INDEL|BOTH)
+ heterozygosity                                    Heterozygosity value used to compute prior likelihoods for any locus
+ pcr_error_rate                                    The PCR error rate to be used for computing fragment-based likelihoods
+ genotyping_mode                                   Should we output confident genotypes (i.e. including ref calls) or just the variants? (DISCOVERY|GENOTYPE_GIVEN_ALLELES)
+ output_mode                                       Should we output confident genotypes (i.e. including ref calls) or just the variants? (EMIT_VARIANTS_ONLY|EMIT_ALL_CONFIDENT_SITES|EMIT_ALL_SITES)
+ standard_min_confidence_threshold_for_calling     The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be called
+ standard_min_confidence_threshold_for_emitting    The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be emitted (and filtered if less than the calling threshold)
+ noSLOD                                            If provided, we will not calculate the SLOD
+ min_base_quality_score                            Minimum base quality required to consider a base for calling
+ max_deletion_fraction                             Maximum fraction of reads with deletions spanning this locus for it to be callable [to disable, set to &lt; 0 or &gt; 1; default:0.05]
+ min_indel_count_for_genotyping                    Minimum number of consensus indels required to trigger genotyping run
+ indel_heterozygosity                              Heterozygosity for indel calling
+ indelGapContinuationPenalty                       Indel gap continuation penalty
+ indelGapOpenPenalty                               Indel gap open penalty
+ indelHaplotypeSize                                Indel haplotype size
+ doContextDependentGapPenalties                    Vary gap penalties by context
+ indel_recal_file                                  Filename for the input covariates table recalibration .csv file - EXPERIMENTAL, DO NO USE
+ indelDebug                                        Output indel debug info
+ out                                               File to which variants should be written
+ annotation                                        One or more specific annotations to apply to variant calls
+ group                                             One or more classes/groups of annotations to apply to variant calls
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_annotator.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,249 @@
+<tool id="gatk2_variant_annotator" name="Variant Annotator" version="@VERSION@.0">
+  <description></description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    #if str( $reference_source.input_bam ) != "None":
+        -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input"
+        #if str( $reference_source.input_bam.metadata.bam_index ) != "None":
+            -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index
+        #end if
+    #end if
+    -d "--variant" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant"
+    -p '
+    @JAR_PATH@
+    -T "VariantAnnotator"
+    \$GATK2_SITE_OPTIONS
+
+    @THREADS@
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    -o "${output_vcf}"
+    #if str( $annotations_type.annotations_type_selector ) == "use_all_annotations":
+        --useAllAnnotations
+    #else:
+        #if $annotations_type.annotations:
+            #for $annotation in str( $annotations_type.annotations.fields.gatk_value ).split( ',' ):
+                --annotation "${annotation}"
+            #end for
+        #end if
+    #end if
+    #if $exclude_annotations:
+        #for $annotation in str( $exclude_annotations.fields.gatk_value ).split( ',' ):
+            --excludeAnnotation "${annotation}"
+        #end for
+    #end if
+    #for $additional_annotation in $additional_annotations:
+        --annotation "${additional_annotation.additional_annotation_name}"
+    #end for
+    '
+    #if $reference_source.input_variant_bti:
+        -d "--intervals" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant_bti"
+    #end if
+
+    #for $rod_binding in $comp_rod_bind:
+        -d "--comp:${rod_binding.comp_rod_name},%(file_type)s" "${rod_binding.comp_input_rod}" "${rod_binding.comp_input_rod.ext}" "input_comp_${rod_binding.comp_rod_name}"
+    #end for
+
+    @DBSNP_OPTIONS@
+
+    #for $rod_binding in $resource_rod_bind:
+        -d "--resource:${rod_binding.resource_rod_name},%(file_type)s" "${rod_binding.resource_input_rod}" "${rod_binding.resource_input_rod.ext}" "input_resource_${rod_binding.resource_rod_name}"
+    #end for
+
+    #if str( $snpEff_rod_bind_type.snpEff_rod_bind_type_selector ) == 'set_snpEff':
+        -p '--annotation "SnpEff"'
+        -d "--snpEffFile:${snpEff_rod_bind_type.snpEff_rod_name},%(file_type)s" "${snpEff_rod_bind_type.snpEff_input_rod}" "${snpEff_rod_bind_type.snpEff_input_rod.ext}" "input_snpEff_${snpEff_rod_bind_type.snpEff_rod_name}"
+    #else:
+        -p '--excludeAnnotation "SnpEff"'
+    #end if
+
+    #for $expression in $expressions:
+        -p '--expression "${expression.expression}"'
+    #end for
+
+    #include source=$standard_gatk_options#
+
+    -p '
+    #if str( $annotation_group ) != "None":
+        #for $group in str( $annotation_group ).split( ',' ):
+            --group "${group}"
+        #end for
+    #end if
+    #if str( $family_string ) != "":
+        --family_string "${family_string}"
+    #end if
+    --MendelViolationGenotypeQualityThreshold "${mendel_violation_genotype_quality_threshold}"
+        '
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_variant" type="data" format="vcf" label="Variant file to annotate" help="-V,--variant &amp;lt;variant&amp;gt;"/>
+        <param name="input_variant_bti" type="boolean" truevalue="-BTI variant" falsevalue="" label="Increase efficiency for small variant files." help="-BTI variant"/>
+        <param name="input_bam" type="data" format="bam" label="BAM file" optional="True" help="Not needed for all annotations. (-I,--input_file &amp;lt;input_file&amp;gt;)" >
+          <validator type="unspecified_build" />
+          <validator type="dataset_metadata_in_data_table" table_name="gatk2_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->
+        </param>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <param name="input_variant" type="data" format="vcf" label="Variant file to annotate" help="-V,--variant &amp;lt;variant&amp;gt;"/>
+        <param name="input_variant_bti" type="boolean" truevalue="-BTI variant" falsevalue="" label="Increase efficiency for small variant files."  help="-BTI variant"/>
+        <param name="input_bam" type="data" format="bam" label="BAM file" optional="True" help="Not needed for all annotations. (-I,--input_file &amp;lt;input_file&amp;gt;)" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+    <conditional name="annotations_type">
+      <param name="annotations_type_selector" type="select" label="Use all possible annotations">
+        <option value="use_all_annotations">Use all</option>
+        <option value="choose" selected="True">Use selected</option>
+      </param>
+      <when value="use_all_annotations">
+          <!-- no extra options here -->
+      </when>
+      <when value="choose">
+        <param name="annotations" type="select" multiple="True" display="checkboxes" label="Annotations to apply" help="-A,--annotation &amp;lt;annotation&amp;gt;" >
+          <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs -->
+          <options from_data_table="gatk2_annotations">
+            <filter type="multiple_splitter" column="tools_valid_for" separator=","/>
+            <filter type="static_value" value="VariantAnnotator" column="tools_valid_for"/>
+          </options>
+        </param>
+      </when>
+    </conditional>
+
+    <repeat name="additional_annotations" title="Additional annotation" help="-A,--annotation &amp;lt;annotation&amp;gt;">
+      <param name="additional_annotation_name" type="text" value="" label="Annotation name" />
+    </repeat>
+
+    <repeat name="comp_rod_bind" title="Binding for reference-ordered comparison data" help="-comp,--comp &amp;lt;comp&amp;gt;">
+      <param name="comp_input_rod" type="data" format="vcf" label="ROD file" />
+      <param name="comp_rod_name" type="text" value="Unnamed" label="ROD Name"/>
+    </repeat>
+    <expand macro="dbsnp_param" />
+
+    <repeat name="resource_rod_bind" title="Binding for reference-ordered resource data" help="-resource,--resource &amp;lt;resource&amp;gt;">
+      <param name="resource_input_rod" type="data" format="vcf" label="ROD file" />
+      <param name="resource_rod_name" type="text" value="Unnamed" label="ROD Name"/>
+    </repeat>
+
+    <conditional name="snpEff_rod_bind_type">
+      <param name="snpEff_rod_bind_type_selector" type="select" label="Provide a snpEff reference-ordered data file (VCF)" help="-snpEffFile,--snpEffFile &amp;lt;snpEffFile&amp;gt;">
+        <option value="set_snpEff">Set snpEff</option>
+        <option value="exclude_snpEff" selected="True">Don't set snpEff</option>
+      </param>
+      <when value="exclude_snpEff">
+        <!-- Do nothing here -->
+      </when>
+      <when value="set_snpEff">
+        <param name="snpEff_input_rod" type="data" format="vcf" label="ROD file" />
+        <param name="snpEff_rod_name" type="hidden" value="snpEff" label="ROD Name"/>
+      </when>
+    </conditional>
+
+    <repeat name="expressions" title="Expression" help="-E,--expression &amp;lt;expression&amp;gt;">
+      <param name="expression" type="text" value="" label="Expression"/>
+    </repeat>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <param name="annotation_group" type="select" multiple="True" display="checkboxes" label="annotation interfaces/groups to apply to variant calls" help="-G,--group &amp;lt;group&amp;gt;">
+      <option value="RodRequiringAnnotation">RodRequiringAnnotation</option>
+      <option value="Standard">Standard</option>
+      <option value="Experimental">Experimental</option>
+      <option value="WorkInProgress">WorkInProgress</option>
+      <option value="RankSumTest">RankSumTest</option>
+    </param>
+    <param name="family_string" type="text" value="" label="Family String" help="--family_string"/>
+    <param name="mendel_violation_genotype_quality_threshold" type="float" value="0.0" label="genotype quality treshold in order to annotate mendelian violation ratio." help="-mvq,--MendelViolationGenotypeQualityThreshold &amp;lt;MendelViolationGenotypeQualityThreshold&amp;gt;"/>
+    <param name="exclude_annotations" type="select" multiple="True" display="checkboxes" label="Annotations to exclude" help="-XA,--excludeAnnotation &amp;lt;excludeAnnotation&amp;gt;" >
+      <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs -->
+      <options from_data_table="gatk2_annotations">
+        <filter type="multiple_splitter" column="tools_valid_for" separator=","/>
+        <filter type="static_value" value="VariantAnnotator" column="tools_valid_for"/>
+      </options>
+    </param>
+
+  </inputs>
+  <outputs>
+    <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (Variant File)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" />
+          <param name="input_variant" value="gatk/gatk_unified_genotyper/gatk_unified_genotyper_out_1.vcf" ftype="vcf" />
+          <param name="input_variant_bti" />
+          <param name="annotations_type_selector" value="choose" />
+          <param name="annotations" value="AlleleBalance,BaseQualityRankSumTest,DepthOfCoverage,HomopolymerRun,MappingQualityRankSumTest,MappingQualityZero,QualByDepth,RMSMappingQuality,SpanningDeletions,HaplotypeScore" />
+          <param name="additional_annotations" value="0" />
+          <param name="dbsnp_rod_bind_type_selector" value="set_dbsnp" />
+          <param name="dbsnp_input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" />
+          <param name="dbsnp_rod_name" value="dbsnp" />
+          <param name="snpEff_rod_bind_type_selector" value="exclude_snpEff" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <output name="output_vcf" file="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" lines_diff="4" />
+          <output name="output_log" file="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.log.contains" compare="contains" />
+          <param name="comp_rod_bind" value="0" />
+          <param name="resource_rod_bind" value="0" />
+          <param name="expressions" value="0" />
+          <!-- <param name="annotation_group" /> -->
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+Annotates variant calls with context information.  Users can specify which of the available annotations to use.
+
+For more information on using the VariantAnnotator, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_annotator_VariantAnnotator.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+
+**Inputs**
+
+GenomeAnalysisTK: VariantAnnotator accepts a variant input file.
+
+
+**Outputs**
+
+The output is in VCF format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+
+ sampleName           The sample (NA-ID) corresponding to the variant input (for non-VCF input only)
+ annotation           One or more specific annotations to apply to variant calls
+ group                One or more classes/groups of annotations to apply to variant calls
+ expression           One or more specific expressions to apply to variant calls; see documentation for more details
+ useAllAnnotations    Use all possible annotations (not for the faint of heart)
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_apply_recalibration.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,136 @@
+<tool id="gatk2_variant_apply_recalibration" name="Apply Variant Recalibration" version="@VERSION@.1">
+  <description></description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    #for $var_count, $variant in enumerate( $reference_source.input_variants ):
+        -d "--input:input_${var_count},%(file_type)s" "${variant}" "${variant.ext}" "input_variants_${var_count}"
+    #end for
+   -p '
+   @JAR_PATH@
+    -T "ApplyRecalibration"
+    \$GATK2_SITE_OPTIONS
+
+    @THREADS@
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    --recal_file "${reference_source.input_recal}"
+    --tranches_file "${reference_source.input_tranches}"
+    --out "${output_variants}"
+   '
+
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    -p '
+    --mode "${mode}"
+
+    #for $ignore_filter in $ignore_filters:
+        #set $ignore_filter_name = str( $ignore_filter.ignore_filter_type.ignore_filter_type_selector )
+        #if $ignore_filter_name == "custom":
+          #set $ignore_filter_name = str( $ignore_filter.ignore_filter_type.filter_name )
+        #end if
+        --ignore_filter "${ignore_filter_name}"
+    #end for
+    --ts_filter_level "${ts_filter_level}"
+    '
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <expand macro="input_variants" />
+        <param name="input_recal" type="data" format="gatk_recal" label="Variant Recalibration file" help="-recalFile,--recal_file &amp;lt;recal_file&amp;gt;" />
+        <param name="input_tranches" type="data" format="gatk_tranche" label="Variant Tranches file" help="-tranchesFile,--tranches_file &amp;lt;tranches_file&amp;gt;" />
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <!-- <filter type="data_meta" key="dbkey" ref="variants[0].input_variants" column="dbkey"/> -->
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <expand macro="input_variants" />
+        <param name="input_recal" type="data" format="gatk_recal" label="Variant Recalibration file" help="-recalFile,--recal_file &amp;lt;recal_file&amp;gt;" />
+        <param name="input_tranches" type="data" format="gatk_tranche" label="Variant Tranches file" help="-tranchesFile,--tranches_file &amp;lt;tranches_file&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+
+    <expand macro="gatk_param_type_conditional" />
+
+        <param name="mode" type="select" label="Recalibration mode" help="-mode,--mode &amp;lt;mode&amp;gt;">
+          <option value="SNP" selected="True">SNP</option>
+          <option value="INDEL">INDEL</option>
+          <option value="BOTH">BOTH</option>
+        </param>
+       <repeat name="ignore_filters" title="Ignore Filter" help="-ignoreFilter,--ignore_filter &amp;lt;ignore_filter&amp;gt;">
+          <conditional name="ignore_filter_type">
+            <param name="ignore_filter_type_selector" type="select" label="Filter Type">
+              <option value="HARD_TO_VALIDATE">HARD_TO_VALIDATE</option>
+              <option value="LowQual" >LowQual</option>
+              <option value="custom" selected="True">Other</option>
+            </param>
+            <when value="custom">
+              <param name="filter_name" type="text" value="" label="Filter name"/>
+            </when>
+            <when value="HARD_TO_VALIDATE" />
+            <when value="LowQual" />
+          </conditional>
+        </repeat>
+    <param name="ts_filter_level" type="float" label="truth sensitivity level at which to start filtering, used here to indicate filtered variants in plots" value="99.0" help="-ts_filter_level,--ts_filter_level &amp;lt;ts_filter_level&amp;gt;"/>
+  </inputs>
+  <outputs>
+    <data format="vcf" name="output_variants" label="${tool.name} on ${on_string} (Variants File)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <!-- ADD TESTS -->
+  </tests>
+  <help>
+**What it does**
+
+Applies cuts to the input vcf file (by adding filter lines) to achieve the desired novel FDR levels which were specified during VariantRecalibration
+
+For more information on using the ApplyRecalibration module, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantrecalibration_ApplyRecalibration.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: ApplyRecalibration accepts a variant input file, a recalibration file and a tranches file.
+
+
+**Outputs**
+
+The output is in VCF format.
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+
+ recal_file         The output recal file used by ApplyRecalibration
+ tranches_file      The input tranches file describing where to cut the data
+ out                The output filtered, recalibrated VCF file
+ ts_filter_level    The truth sensitivity level at which to start filtering
+ ignore_filter      If specified the optimizer will use variants even if the specified filter name is marked in the input VCF file
+ mode               Recalibration mode to employ: 1.) SNP for recalibrating only SNPs (emitting indels untouched in the output VCF); 2.) INDEL for indels; and 3.) BOTH for recalibrating both SNPs and indels simultaneously. (SNP|INDEL|BOTH)
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_combine.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,168 @@
+<tool id="gatk2_variant_combine" name="Combine Variants" version="@VERSION@.0">
+  <description></description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+
+    #set $priority_order = []
+    #for $input_variant in $reference_source.input_variants:
+        -d "--variant:${input_variant.input_variant_name},%(file_type)s" "${input_variant.input_variant}" "${input_variant.input_variant.ext}" "input_variant_${input_variant.input_variant_name}"
+        #set $input_variant_name = str( $input_variant.input_variant_name )
+        #assert $input_variant_name not in $priority_order, "Variant Names must be unique" ##this should be handled by a validator
+        #silent $priority_order.append( $input_variant_name )
+    #end for
+    -p '
+    @JAR_PATH@
+    -T "CombineVariants"
+    --out "${output_variants}"
+    \$GATK2_SITE_OPTIONS
+
+    @THREADS@
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+   --genotypemergeoption "${genotype_merge_option}"
+   --rod_priority_list "${ ','.join( $priority_order ) }"
+   '
+
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        --filteredrecordsmergetype "${analysis_param_type.filtered_records_merge_type}"
+        ${analysis_param_type.print_complex_merges}
+        ${analysis_param_type.filtered_are_uncalled}
+        ${analysis_param_type.minimal_vcf}
+        ${analysis_param_type.assume_identical_samples}
+
+        #if str( $analysis_param_type.set_key ):
+            --setKey "${analysis_param_type.set_key}"
+        #end if
+
+        --minimumN "${analysis_param_type.minimum_n}"
+        '
+    #end if
+  </command>
+  <inputs>
+
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <repeat min="1" name="input_variants" title="Variants to Merge" help="Records will be prioritized in the order that you list them here (-V,--variant &amp;lt;variant&amp;gt;)">
+          <param name="input_variant" type="data" format="vcf" label="Input variant file" />
+          <param name="input_variant_name" type="text" value="" label="Variant name" help="Names must be unique">
+            <validator type="length" min="1" message="You must provide a unique name for this set of variants" />
+          </param>
+        </repeat>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <!-- <filter type="data_meta" key="dbkey" ref="input_variants.input_variant" column="dbkey"/> -->
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <repeat min="1" name="input_variants" title="Variants to Merge" help="Records will be prioritized in the order that you list them here (-V,--variant &amp;lt;variant&amp;gt;)">
+          <param name="input_variant" type="data" format="vcf" label="Input variant file" />
+          <param name="input_variant_name" type="text" value="" label="Variant name" help="Names must be unique">
+            <validator type="length" min="1" message="You must provide a unique name for this set of variants" />
+          </param>
+        </repeat>
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+
+    <param name="genotype_merge_option" type="select" label="How should we merge genotype records across records for samples shared across the ROD files" help="-genotypeMergeOptions,--genotypemergeoption &amp;lt;genotypemergeoption&amp;gt;" >
+      <option value="UNIQUIFY" />
+      <option value="PRIORITIZE" selected="true"/>
+      <option value="UNSORTED" />
+      <option value="REQUIRE_UNIQUE" />
+    </param>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <expand macro="analysis_type_conditional">
+        <param name="filtered_records_merge_type" type="select" label="How should we deal with records seen at the same site in the VCF, but with different FILTER fields?" help="-filteredRecordsMergeType,--filteredrecordsmergetype &amp;lt;filteredrecordsmergetype&amp;gt;" >
+          <option value="KEEP_IF_ANY_UNFILTERED" selected="true"/>
+          <option value="KEEP_IF_ALL_UNFILTERED" />
+        </param>
+
+        <param name="print_complex_merges" checked="false" type="boolean" truevalue="--printComplexMerges" falsevalue="" label="Print out interesting sites requiring complex compatibility merging" help="-printComplexMerges,--printComplexMerges" />
+        <param name="filtered_are_uncalled" checked="false" type="boolean" truevalue="--filteredAreUncalled" falsevalue="" label="If true, then filtered VCFs are treated as uncalled, so that filtered set annotation don't appear in the combined VCF" help="-filteredAreUncalled,--filteredAreUncalled" />
+        <param name="minimal_vcf" checked="false" type="boolean" truevalue="--minimalVCF" falsevalue="" label="If true, then the output VCF will contain no INFO or genotype INFO field" help="-minimalVCF,--minimalVCF" />
+
+        <param name="set_key" type="text" value="" label="Key, by default set, in the INFO key=value tag emitted describing which set the combined VCF record came from." help="-setKey,--setKey &amp;lt;setKey&amp;gt;"/>
+        <param name="assume_identical_samples" checked="false" type="boolean" truevalue="--assumeIdenticalSamples" falsevalue="" label="If true, assume input VCFs have identical sample sets and disjoint calls so that one can simply perform a merge sort to combine the VCFs into one, drastically reducing the runtime." help="-assumeIdenticalSamples,--assumeIdenticalSamples" />
+        <param name="minimum_n" type="integer" value="1" label="Combine variants and output site only if variant is present in at least N input files." help="-minN,--minimumN &amp;lt;minimumN&amp;gt;"/>
+    </expand>
+
+  </inputs>
+  <outputs>
+    <data format="vcf" name="output_variants" label="${tool.name} on ${on_string} (variants)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" />
+          <param name="input_variant_name" value="from_variant_annotator" />
+          <param name="genotype_merge_option" value="PRIORITIZE" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_variants" file="gatk/gatk_variant_combine/gatk_variant_combine_out_1.vcf" lines_diff="4" />
+          <output name="output_log" file="gatk/gatk_variant_combine/gatk_variant_combine_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+Combines VCF records from different sources; supports both full merges and set unions. Merge: combines multiple records into a single one; if sample names overlap then they are uniquified. Union: assumes each rod represents the same set of samples (although this is not enforced); using the priority list (if provided), emits a single record instance at every position represented in the rods.
+
+For more information on using the CombineVariants module, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantutils_CombineVariants.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: CombineVariants accepts variant files as input.
+
+------
+
+**Outputs**
+
+The output is a combined vcf file.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ out                         File to which variants should be written
+ genotypemergeoption         How should we merge genotype records for samples shared across the ROD files? (UNIQUIFY|PRIORITIZE|UNSORTED|REQUIRE_UNIQUE)
+ filteredrecordsmergetype    How should we deal with records seen at the same site in the VCF, but with different FILTER fields? KEEP_IF_ANY_UNFILTERED PASSes the record if any record is unfiltered, KEEP_IF_ALL_UNFILTERED requires all records to be unfiltered (KEEP_IF_ANY_UNFILTERED|KEEP_IF_ALL_UNFILTERED)
+ rod_priority_list           When taking the union of variants containing genotypes: a comma-separated string describing the priority ordering for the genotypes as far as which record gets emitted; a complete priority list MUST be provided
+ printComplexMerges          Print out interesting sites requiring complex compatibility merging
+ filteredAreUncalled         If true, then filtered VCFs are treated as uncalled, so that filtered set annotation don't appear in the combined VCF
+ minimalVCF                  If true, then the output VCF will contain no INFO or genotype INFO field
+ setKey                      Key, by default set, in the INFO key=value tag emitted describing which set the combined VCF record came from.  Set to null if you don't want the set field emitted.
+ assumeIdenticalSamples      If true, assume input VCFs have identical sample sets and disjoint calls so that one can simply perform a merge sort to combine the VCFs into one, drastically reducing the runtime.
+ minimumN                    Combine variants and output site only if variant is present in at least N input files.
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_eval.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,276 @@
+<tool id="gatk2_variant_eval" name="Eval Variants" version="@VERSION@.1">
+  <description></description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+   #from binascii import hexlify
+
+    gatk2_wrapper.py
+   --stdout "${output_log}"
+    #for $var_count, $variant in enumerate( $reference_source.input_variants ):
+       -d "--eval:input_${var_count},%(file_type)s" "${variant}" "${variant.ext}" "input_variants_${var_count}"
+    #end for
+    -p '
+    @JAR_PATH@
+    -T "VariantEval"
+    --out "${output_report}"
+    \$GATK2_SITE_OPTIONS
+
+    @THREADS@
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+   '
+
+    #for $rod_binding in $comp_rod_bind:
+        -d "--comp:${rod_binding.comp_rod_name},%(file_type)s" "${rod_binding.comp_input_rod}" "${rod_binding.comp_input_rod.ext}" "input_comp_${rod_binding.comp_rod_name}"
+        #if str( $rod_binding.comp_known_names ):
+            -p '--known_names "${rod_binding.comp_rod_name}"'
+        #end if
+    #end for
+
+    #if $dbsnp_rod_bind_type.dbsnp_rod_bind_type_selector == 'set_dbsnp'
+        -d "--dbsnp:${dbsnp_rod_bind_type.dbsnp_rod_name},%(file_type)s" "${dbsnp_rod_bind_type.dbsnp_input_rod}" "${dbsnp_rod_bind_type.dbsnp_input_rod.ext}" "input_dbsnp_${dbsnp_rod_bind_type.dbsnp_rod_name}"
+        #if $dbsnp_rod_bind_type.dbsnp_known_names
+            -p '--known_names "${dbsnp_rod_bind_type.dbsnp_rod_name}"'
+        #end if
+    #end if
+
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        #for $stratification in $analysis_param_type.stratifications:
+            #set $select_string = "--select_exps '%s' --select_names '%s'" % ( str( $stratification.select_exps ), str( $stratification.select_name )  )
+            -o '${ hexlify( $select_string ) }'
+        #end for
+        -p '
+
+        #for $sample in $analysis_param_type.samples:
+            --sample "${sample.sample}"
+        #end for
+
+        #if str( $analysis_param_type.stratification_modules ) != "None":
+            #for $stratification_module in str( $analysis_param_type.stratification_modules).split( ',' ):
+                --stratificationModule "${stratification_module}"
+            #end for
+        #end if
+
+        ${analysis_param_type.do_not_use_all_standard_stratifications}
+
+        #for $variant_type in $analysis_param_type.only_variants_of_type:
+            --onlyVariantsOfType "${variant_type.variant_type}"
+        #end for
+
+        #if str( $analysis_param_type.eval_modules ) != "None":
+            #for $eval_module in str( $analysis_param_type.eval_modules).split( ',' ):
+                --evalModule "${eval_module}"
+            #end for
+        #end if
+
+        ${analysis_param_type.do_not_use_all_standard_modules}
+
+        #if str( $analysis_param_type.num_samples ) != "0":
+            --numSamples "${analysis_param_type.num_samples}"
+        #end if
+
+        --minPhaseQuality "${analysis_param_type.min_phase_quality}"
+
+        --mendelianViolationQualThreshold "${analysis_param_type.mendelian_violation_qual_threshold}"
+
+        #if str( $analysis_param_type.ancestral_alignments ) != "None":
+            --ancestralAlignments "${analysis_param_type.ancestral_alignments}"
+        #end if
+        '
+        #if str( $analysis_param_type.known_cnvs ) != "None":
+            -d "--knownCNVs" "${analysis_param_type.known_cnvs}" "${analysis_param_type.known_cnvs.ext}" "input_known_cnvs"
+        #end if
+
+        #if str( $analysis_param_type.strat_intervals ) != "None":
+            -d "--stratIntervals" "${analysis_param_type.strat_intervals}" "${analysis_param_type.strat_intervals.ext}" "input_strat_intervals"
+        #end if
+    #end if
+  </command>
+  <inputs>
+
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <expand macro="input_variants" help="-eval,--eval &amp;lt;eval&amp;gt;"/>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <!-- <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/> -->
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <expand macro="input_variants" help="-eval,--eval &amp;lt;eval&amp;gt;"/>
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+
+    <repeat name="comp_rod_bind" title="Comparison Reference-Ordered Data (ROD) file" help="-comp,--comp &amp;lt;comp&amp;gt;">
+      <param name="comp_input_rod" type="data" format="vcf" label="Comparison ROD file" />
+      <param name="comp_rod_name" type="text" value="" label="Comparison ROD name">
+          <validator type="regex" message="Value must be a not empty string composed by alphanumeric characters and underscores">^\w+$</validator>
+      </param>
+      <param name="comp_known_names" type="boolean" label="Use comparison ROD file as known_names" help="-knownName,--known_names &amp;lt;known_names&amp;gt;"/>
+    </repeat>
+    <conditional name="dbsnp_rod_bind_type">
+      <param name="dbsnp_rod_bind_type_selector" type="select" label="Provide a dbSNP Reference-Ordered Data (ROD) file" help="-D,--dbsnp &amp;lt;dbsnp&amp;gt;">
+        <option value="set_dbsnp" selected="True">Set dbSNP</option>
+        <option value="exclude_dbsnp">Don't set dbSNP</option>
+      </param>
+      <when value="exclude_dbsnp" />
+      <when value="set_dbsnp">
+        <param name="dbsnp_input_rod" type="data" format="vcf" label="dbSNP ROD file" />
+        <param name="dbsnp_rod_name" type="text" value="dbsnp" label="dbsnp ROD name">
+          <validator type="regex" message="Value must be a not empty string composed by alphanumeric characters and underscores">^\w+$</validator>
+        </param>
+        <param name="dbsnp_known_names" type="boolean" label="Use dbSNP ROD file as known_names" help="-knownName,--known_names &amp;lt;known_names&amp;gt;" />
+      </when>
+    </conditional>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <expand macro="analysis_type_conditional">
+        <repeat name="stratifications" title="Stratification">
+          <param name="select_exps" value="" type="text" label="Stratification Expression" help="-select,--select_exps &amp;lt;select_exps&amp;gt;">
+            <sanitizer>
+              <valid initial="string.printable">
+               <remove value="&apos;"/>
+             </valid>
+              <mapping initial="none"/>
+            </sanitizer>
+          </param>
+          <param name="select_name" value="" type="text" label="Name" help="-selectName,--select_names &amp;lt;select_names&amp;gt;"/>
+        </repeat>
+
+        <repeat name="samples" title="Sample" help="-sn,--sample &amp;lt;sample&amp;gt;">
+          <param name="sample" value="" type="text" label="Derive eval and comp contexts using only these sample genotypes, when genotypes are available in the original context"/>
+        </repeat>
+
+        <param name="stratification_modules" type="select" multiple="True" display="checkboxes" label="Stratification modules to apply to the eval track(s)" help="-ST,--stratificationModule &amp;lt;stratificationModule&amp;gt;" >
+          <option value="AlleleCount" />
+          <option value="AlleleFrequency" />
+          <option value="CompRod" />
+          <option value="Contig" />
+          <option value="CpG" />
+          <option value="Degeneracy" />
+          <option value="EvalRod" />
+          <option value="Filter" />
+          <option value="FunctionalClass" />
+          <option value="IndelSize" />
+          <option value="IntervalStratification" />
+          <option value="JexlExpression" />
+          <option value="Novelty" />
+          <option value="OneBPIndel" />
+          <option value="Sample" />
+          <option value="SnpEffPositionModifier" />
+          <option value="TandemRepeat" />
+          <option value="VariantType" />
+        </param>
+        <param name="do_not_use_all_standard_stratifications" checked="false" type="boolean" truevalue="--doNotUseAllStandardStratifications" falsevalue="" label="Do not use the standard stratification modules by default" help="-noST,--doNotUseAllStandardStratifications" />
+
+        <repeat name="only_variants_of_type" title="only Variants Of Type" help="--onlyVariantsOfType">
+          <param name="variant_type" type="text" value="" label="only variants of these types will be considered during the evaluation"/>
+        </repeat>
+
+        <param name="eval_modules" type="select" multiple="True" display="checkboxes" label="Eval modules to apply to the eval track(s)" help="-EV,--evalModule &amp;lt;evalModule&amp;gt;" >
+          <option value="CompOverlap" />
+          <option value="CountVariants" />
+          <option value="IndelLengthHistogram" />
+          <option value="IndelSummary" />
+          <option value="MendelianViolationEvaluator" />
+          <option value="MultiallelicSummary" />
+          <option value="PrintMissingComp" />
+          <option value="ThetaVariantEvaluator" />
+          <option value="TiTvVariantEvaluator" />
+          <option value="ValidationReport" />
+          <option value="VariantSummary" />
+        </param>
+        <param name="do_not_use_all_standard_modules" checked="false" type="boolean" truevalue="--doNotUseAllStandardModules" falsevalue="" label="Do not use the standard eval modules by default" help="-noEV,--doNotUseAllStandardModules" />
+
+        <param name="num_samples" type="integer" label="Number of samples (used if no samples are available in the VCF file" value="0" help="-ns,--numSamples &amp;lt;numSamples&amp;gt;"/>
+        <param name="min_phase_quality" type="float" label="Minimum phasing quality " value="10.0" help="-mpq,--minPhaseQuality &amp;lt;minPhaseQuality&amp;gt;"/>
+        <param name="mendelian_violation_qual_threshold" type="integer" label="Minimum genotype QUAL score for each trio member required to accept a site as a violation" value="50" help="-mvq,--mendelianViolationQualThreshold &amp;lt;mendelianViolationQualThreshold&amp;gt;"/>
+        <param name="ancestral_alignments" type="data" format="fasta" optional="True" label="Fasta file with ancestral alleles" help="-aa,--ancestralAlignments &amp;lt;ancestralAlignments&amp;gt;" />
+        <param name="known_cnvs" type="data" format="bed,gatk_interval,picard_interval_list" optional="True" label="File containing tribble-readable features describing a known list of copy number variants" help="-knownCNVs,--knownCNVs &amp;lt;knownCNVs&amp;gt;" />
+        <param name="strat_intervals" type="data" format="bed,gatk_interval,picard_interval_list" optional="True" label="File containing tribble-readable features for the IntervalStratificiation" help="-stratIntervals,--stratIntervals &amp;lt;stratIntervals&amp;gt;" />
+    </expand>
+
+  </inputs>
+  <outputs>
+    <data format="gatk_report" name="output_report" label="${tool.name} on ${on_string} (report)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" />
+          <param name="dbsnp_rod_bind_type_selector" value="set_dbsnp" />
+          <param name="dbsnp_input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" />
+          <param name="dbsnp_rod_name" value="dbsnp" />
+          <param name="dbsnp_known_names" value="True"/>
+          <param name="comp_rod_bind" value="0" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_report" file="gatk/gatk_variant_eval/gatk_variant_eval_out_1.gatk_report" />
+          <output name="output_log" file="gatk/gatk_variant_eval/gatk_variant_eval_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
+
+For more information on using the VariantEval module, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_varianteval_VariantEval.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: VariantEval accepts variant files as input.
+
+
+**Outputs**
+
+The output is a table of variant evaluation.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ out                                   An output file presented to the walker. Will overwrite contents if file exists.
+ list                                  List the available eval modules and exit
+ select_exps                           One or more stratifications to use when evaluating the data
+ select_names                          Names to use for the list of stratifications (must be a 1-to-1 mapping)
+ sample                                Derive eval and comp contexts using only these sample genotypes, when genotypes are available in the original context
+ known_names                           Name of ROD bindings containing variant sites that should be treated as known when splitting eval rods into known and novel subsets
+ stratificationModule                  One or more specific stratification modules to apply to the eval track(s) (in addition to the standard stratifications, unless -noS is specified)
+ doNotUseAllStandardStratifications    Do not use the standard stratification modules by default (instead, only those that are specified with the -S option)
+ onlyVariantsOfType                    If provided, only variants of these types will be considered during the evaluation, in
+ evalModule                            One or more specific eval modules to apply to the eval track(s) (in addition to the standard modules, unless -noE is specified)
+ doNotUseAllStandardModules            Do not use the standard modules by default (instead, only those that are specified with the -E option)
+ numSamples                            Number of samples (used if no samples are available in the VCF file
+ minPhaseQuality                       Minimum phasing quality
+ mendelianViolationQualThreshold       Minimum genotype QUAL score for each trio member required to accept a site as a violation
+ ancestralAlignments                   Fasta file with ancestral alleles
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_filtration.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,178 @@
+<tool id="gatk2_variant_filtration" name="Variant Filtration" version="@VERSION@.0">
+  <description>on VCF files</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    #from binascii import hexlify
+
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    -d "--variant:variant,%(file_type)s" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant"
+    -p '
+    @JAR_PATH@
+    -T "VariantFiltration"
+    \$GATK2_SITE_OPTIONS
+
+    -o "${output_vcf}"
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    '
+    #for $variant_filter in $variant_filters:
+        #set $variant_filter = "--%sExpression '%s' --%sName '%s'" % ( str( $variant_filter.is_genotype_filter ), str( $variant_filter.filter_expression ), str( $variant_filter.is_genotype_filter ), str( $variant_filter.filter_name )  )
+        -o '${ hexlify( $variant_filter ) }'
+    #end for
+
+    #if str( $mask_rod_bind_type.mask_rod_bind_type_selector ) == 'set_mask':
+        -d "--mask:${mask_rod_bind_type.mask_rod_name},%(file_type)s" "${mask_rod_bind_type.input_mask_rod}" "${mask_rod_bind_type.input_mask_rod.ext}" "input_mask_${mask_rod_bind_type.mask_rod_name}"
+        -p '
+        --maskExtension "${mask_rod_bind_type.mask_extension}"
+        --maskName "${mask_rod_bind_type.mask_rod_name}"
+        '
+    #end if
+
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    #if $cluster_snp_type.cluster_snp_type_selector == "cluster_snp":
+        -p '
+        --clusterSize "${cluster_snp_type.cluster_size}"
+        --clusterWindowSize "${cluster_snp_type.cluster_window_size}"
+        '
+    #end if
+    -p '${missing_values_in_expressions_should_evaluate_as_failing}'
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_variant" type="data" format="vcf" label="Variant file to annotate" help="-V,--variant &amp;lt;variant&amp;gt;" />
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <param name="input_variant" type="data" format="vcf" label="Variant file to annotate" help="-V,--variant &amp;lt;variant&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+
+    <repeat name="variant_filters" title="Variant Filters">
+        <param name="filter_expression" value="AB &lt; 0.2 || MQ0 &gt; 50" type="text" label="Filter expression" help="JEXL formatted expressions (-filter,--filterExpression &amp;lt;filterExpression&amp;gt;)">
+            <sanitizer>
+              <valid initial="string.printable">
+               <remove value="&apos;"/>
+             </valid>
+              <mapping initial="none"/>
+            </sanitizer>
+        </param>
+        <param name="filter_name" value="custom_filter" type="text" label="Filter name" help="-filterName,--filterName &amp;lt;filterName&amp;gt;"/>
+        <param name="is_genotype_filter" type="boolean" truevalue="genotypeFilter" falsevalue="filter" label="Use filter at the individual sample level" help="Use -G_filter,--genotypeFilterExpression &amp;lt;genotypeFilterExpression&amp;gt; and -G_filterName,--genotypeFilterName &amp;lt;genotypeFilterName&amp;gt; for filter type" />
+    </repeat>
+
+    <conditional name="mask_rod_bind_type">
+      <param name="mask_rod_bind_type_selector" type="select" label="Provide a Mask reference-ordered data file">
+        <option value="set_mask" selected="True">Set mask</option>
+        <option value="exclude_mask">Don't set mask</option>
+      </param>
+      <when value="exclude_mask">
+        <!-- Do nothing here -->
+      </when>
+      <when value="set_mask">
+        <param name="input_mask_rod" type="data" format="bed,gatk_dbsnp,vcf" label="Mask ROD file" help="--mask &amp;lt;mask&amp;gt;" />
+        <param name="mask_rod_name" type="text" value="Mask" label="Mask Name" help="-maskName,--maskName &amp;lt;maskName&amp;gt;"/>
+        <param name="mask_extension" type="integer" value="0" label="Mask Extension" help="-maskExtend,--maskExtension &amp;lt;maskExtension&amp;gt;"/>
+      </when>
+    </conditional>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <conditional name="cluster_snp_type">
+      <param name="cluster_snp_type_selector" type="select" label="Cluster SNPs">
+        <option value="cluster_snp">Cluster SNPs</option>
+        <option value="do_not_cluster_snp" selected="True">Do not cluster SNPs</option>
+      </param>
+      <when value="do_not_cluster_snp">
+        <!-- Do nothing here -->
+      </when>
+      <when value="cluster_snp">
+        <param name="cluster_size" type="integer" value="3" label="The number of SNPs which make up a cluster" help="-cluster,--clusterSize &amp;lt;clusterSize&amp;gt;"/>
+        <param name="cluster_window_size" type="integer" value="0" label="The window size (in bases) in which to evaluate clustered SNPs" help="-window,--clusterWindowSize &amp;lt;clusterWindowSize&amp;gt;"/>
+      </when>
+    </conditional>
+
+    <param name="missing_values_in_expressions_should_evaluate_as_failing" type="boolean" truevalue="--missingValuesInExpressionsShouldEvaluateAsFailing" falsevalue="" label="Should missing values be considered failing the expression" help="--missingValuesInExpressionsShouldEvaluateAsFailing" />
+
+  </inputs>
+  <outputs>
+    <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (Variant File)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" />
+          <param name="filter_expression" value="MQ &lt; 37.74 || MQ0 &gt; 50" />
+          <param name="filter_name" value="Galaxy_filter" />
+          <param name="is_genotype_filter" />
+          <param name="mask_rod_bind_type_selector" value="set_mask" />
+          <param name="input_mask_rod" value="gatk/fake_phiX_variant_locations.bed" ftype="bed" />
+          <param name="mask_rod_name" value="." />
+          <param name="mask_extension" value="0" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="cluster_snp_type_selector" value="do_not_cluster_snp" />
+          <param name="missing_values_in_expressions_should_evaluate_as_failing" />
+          <output name="output_vcf" file="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" lines_diff="4" />
+          <output name="output_log" file="gatk/gatk_variant_filtration/gatk_variant_filtration_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+Filters variant calls using a number of user-selectable, parameterizable criteria.
+
+For more information on using the VariantFiltration module, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_filters_VariantFiltration.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: VariantFiltration accepts a VCF input file.
+
+
+**Outputs**
+
+The output is in VCF format.
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+
+ filterExpression                                     One or more expression used with INFO fields to filter (see wiki docs for more info)
+ filterName                                           Names to use for the list of filters (must be a 1-to-1 mapping); this name is put in the FILTER field for variants that get filtered
+ genotypeFilterExpression                             One or more expression used with FORMAT (sample/genotype-level) fields to filter (see wiki docs for more info)
+ genotypeFilterName                                   Names to use for the list of sample/genotype filters (must be a 1-to-1 mapping); this name is put in the FILTER field for variants that get filtered
+ clusterSize                                          The number of SNPs which make up a cluster (see also --clusterWindowSize); [default:3]
+ clusterWindowSize                                    The window size (in bases) in which to evaluate clustered SNPs (to disable the clustered SNP filter, set this value to less than 1); [default:0]
+ maskName                                             The text to put in the FILTER field if a 'mask' rod is provided and overlaps with a variant call; [default:'Mask']
+ missingValuesInExpressionsShouldEvaluateAsFailing    When evaluating the JEXL expressions, should missing values be considered failing the expression (by default they are considered passing)?
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_recalibrator.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,411 @@
+<tool id="gatk2_variant_recalibrator" name="Variant Recalibrator" version="@VERSION@.1">
+  <description></description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements">
+    <requirement type="package" version="0.9.3">ggplot2</requirement>
+  </expand>
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+    --stdout "${output_log}"
+    #for $var_count, $variant in enumerate( $reference_source.input_variants ):
+        -d "--input:input_${var_count},%(file_type)s" "${variant}" "${variant.ext}" "input_variants_${var_count}"
+    #end for
+    -p '
+    @JAR_PATH@
+    -T "VariantRecalibrator"
+    \$GATK2_SITE_OPTIONS
+
+    @THREADS@
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    --recal_file "${output_recal}"
+    --tranches_file "${output_tranches}"
+    --rscript_file "${output_rscript}"
+   '
+
+    #set $rod_binding_names = dict()
+    #for $rod_binding in $rod_bind:
+        #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom':
+            #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name
+        #elif str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'comp':
+            #set $rod_bind_name = "comp" + $rod_binding.rod_bind_type.custom_rod_name
+        #else
+            #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector
+        #end if
+        #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1
+        #if $rod_binding.rod_bind_type.rod_training_type.rod_training_type_selector == "not_training_truth_known":
+            -d "--resource:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}"
+        #else:
+            -d "--resource:${rod_bind_name},%(file_type)s,known=${rod_binding.rod_bind_type.rod_training_type.known},training=${rod_binding.rod_bind_type.rod_training_type.training},truth=${rod_binding.rod_bind_type.rod_training_type.truth},bad=${rod_binding.rod_bind_type.rod_training_type.bad},prior=${rod_binding.rod_bind_type.rod_training_type.prior}" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}"
+        #end if
+    #end for
+
+    #include source=$standard_gatk_options#
+
+    ##start analysis specific options
+    -p '
+    #if str( $annotations ) != "None":
+        #for $annotation in str( $annotations.fields.gatk_value ).split( ',' ):
+            --use_annotation "${annotation}"
+        #end for
+    #end if
+    #for $additional_annotation in $additional_annotations:
+        --use_annotation "${additional_annotation.additional_annotation_name}"
+    #end for
+    --mode "${mode}"
+    '
+
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        --maxGaussians "${analysis_param_type.max_gaussians}"
+        --maxIterations "${analysis_param_type.max_iterations}"
+        --numKMeans "${analysis_param_type.num_k_means}"
+        --stdThreshold "${analysis_param_type.std_threshold}"
+        --shrinkage "${analysis_param_type.shrinkage}"
+        --dirichlet "${analysis_param_type.dirichlet}"
+        --priorCounts "${analysis_param_type.prior_counts}"
+
+        --minNumBadVariants "${analysis_param_type.min_num_bad_variants}"
+
+        --target_titv "${analysis_param_type.target_titv}"
+        #for $tranche in [ $tranche.strip() for $tranche in str( $analysis_param_type.ts_tranche ).split( ',' ) if $tranche.strip() ]
+            --TStranche "${tranche}"
+        #end for
+        #for $ignore_filter in $analysis_param_type.ignore_filters:
+            #set $ignore_filter_name = str( $ignore_filter.ignore_filter_type.ignore_filter_type_selector )
+            #if $ignore_filter_name == "custom":
+              #set $ignore_filter_name = str( $ignore_filter.ignore_filter_type.filter_name )
+            #end if
+            --ignore_filter "${ignore_filter_name}"
+        #end for
+        '
+    #end if
+
+    &amp;&amp;
+    mv "${output_rscript}.pdf" "${output_tranches_pdf}"
+
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <expand macro="input_variants" />
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+          <!--  <filter type="data_meta" key="dbkey" ref="variants[0].input_variants" column="dbkey"/> -->
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <expand macro="input_variants" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+
+    <repeat name="rod_bind" title="Binding for reference-ordered data" help="-resource,--resource &amp;lt;resource&amp;gt;" min="2">
+        <conditional name="rod_bind_type">
+          <param name="rod_bind_type_selector" type="select" label="Binding Type">
+            <option value="dbsnp" selected="True">dbSNP</option>
+            <option value="variant">Variants</option>
+            <option value="snps">SNPs</option>
+            <option value="indels">INDELs</option>
+            <option value="hapmap">HapMap</option>
+            <option value="omni">OMNI</option>
+            <option value="mask">Mask</option>
+            <option value="custom">Custom</option>
+            <option value="comp">Comp</option>
+          </param>
+          <when value="variant">
+              <param name="input_rod" type="data" format="vcf" label="Variant ROD file" />
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="comp">
+              <param name="input_rod" type="data" format="vcf" label="ROD file" />
+              <param name="custom_rod_name" type="text" value="Unnamed" label="ROD Name"/>
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="mask">
+              <param name="input_rod" type="data" format="vcf" label="ROD file" />
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="dbsnp">
+              <param name="input_rod" type="data" format="vcf" label="ROD file" />
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="snps">
+              <param name="input_rod" type="data" format="vcf" label="ROD file" />
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="hapmap">
+              <param name="input_rod" type="data" format="vcf" label="ROD file" />
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="omni">
+              <param name="input_rod" type="data" format="vcf" label="ROD file" />
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="indels">
+              <param name="input_rod" type="data" format="vcf" label="ROD file" />
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="custom">
+              <param name="custom_rod_name" type="text" value="Unknown" label="ROD Name"/>
+              <param name="input_rod" type="data" format="vcf" label="ROD file" />
+              <conditional name="rod_training_type">
+                  <param name="rod_training_type_selector" type="select" label="Use as training/truth/known sites">
+                      <option value="is_training_truth_known">Set training/truth/known sites</option>
+                      <option value="not_training_truth_known" selected="True">Don't Set options</option>
+                  </param>
+                  <when value="not_training_truth_known">
+                      <!-- do nothing here -->
+                  </when>
+                  <when value="is_training_truth_known">
+                      <param name="known" type="boolean" label="Is Known Site" truevalue="true" falsevalue="false"/>
+                      <param name="training" type="boolean" label="Is Training Site" truevalue="true" falsevalue="false"/>
+                      <param name="truth" type="boolean" label="Is Truth Site" truevalue="true" falsevalue="false"/>
+                      <param name="bad" type="boolean" label="Is Bad Site" truevalue="true" falsevalue="false"/>
+                      <param name="prior" type="float" label="prior probability of being true" value="12.0"/>
+                  </when>
+              </conditional>
+          </when>
+        </conditional>
+    </repeat>
+
+    <param name="annotations" type="select" multiple="True" display="checkboxes" label="annotations which should used for calculations" help="-an,--use_annotation &amp;lt;use_annotation&amp;gt;">
+      <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs -->
+      <options from_data_table="gatk2_annotations">
+        <filter type="multiple_splitter" column="tools_valid_for" separator=","/>
+        <filter type="static_value" value="VariantRecalibrator" column="tools_valid_for"/>
+      </options>
+    </param>
+
+    <repeat name="additional_annotations" title="Additional annotation" help="-an,--use_annotation &amp;lt;use_annotation&amp;gt;">
+      <param name="additional_annotation_name" type="text" value="" label="Annotation name" />
+    </repeat>
+
+    <param name="mode" type="select" label="Recalibration mode" help="-mode,--mode &amp;lt;mode&amp;gt;">
+        <option value="SNP" selected="True">SNP</option>
+        <option value="INDEL">INDEL</option>
+        <option value="BOTH">BOTH</option>
+    </param>
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <expand macro="analysis_type_conditional">
+        <param name="max_gaussians" type="integer" label="maximum number of Gaussians to try during variational Bayes Algorithm" value="8" help="-mG,--maxGaussians &amp;lt;maxGaussians&amp;gt;"/>
+        <param name="max_iterations" type="integer" label="maximum number of maximum number of VBEM iterations to be performed in variational Bayes Algorithm" value="150" help="-mI,--maxIterations &amp;lt;maxIterations&amp;gt;"/>
+        <param name="num_k_means" type="integer" label="number of k-means iterations to perform in order to initialize the means of the Gaussians in the Gaussian mixture model" value="100" help="-nKM,--numKMeans &amp;lt;numKMeans&amp;gt;"/>
+        <param name="std_threshold" type="float" label="If a variant has annotations more than -std standard deviations away from mean then don't use it for building the Gaussian mixture model." value="10.0" help="-std,--stdThreshold &amp;lt;stdThreshold&amp;gt;"/>
+        <param name="shrinkage" type="float" label="shrinkage parameter in variational Bayes algorithm" value="1.0" help="-shrinkage,--shrinkage &amp;lt;shrinkage&amp;gt;"/>
+        <param name="dirichlet" type="float" label="dirichlet parameter in variational Bayes algorithm" value="0.001" help="-dirichlet,--dirichlet &amp;lt;dirichlet&amp;gt;"/>
+        <param name="prior_counts" type="float" label="number of prior counts to use in variational Bayes algorithm" value="20.0" help="-priorCounts,--priorCounts &amp;lt;priorCounts&amp;gt;"/>
+        <!--<param name="trustAllPolymorphic" type="boolean" label="trustAllPolymorphic" truevalue="-/-trustAllPolymorphic=true" falsevalue="-/-trustAllPolymorphic=false"
+            help="Trust that all the input training sets' unfiltered records contain only polymorphic sites to drastically speed up the computation. -trustAllPolymorphic" />-->
+        <param name="min_num_bad_variants" type="integer" label="Minimum number of worst scoring variants to use when building the Gaussian mixture model of bad variants" value="1000" help="--minNumBadVariants &amp;lt;minNumBadVariants&amp;gt;"/>
+        <param name="target_titv" type="float" label="expected novel Ti/Tv ratio to use when calculating FDR tranches and for display on optimization curve output figures. (approx 2.15 for whole genome experiments). ONLY USED FOR PLOTTING PURPOSES!" value="2.15" help="-titv,--target_titv &amp;lt;target_titv&amp;gt;"/>
+        <param name="ts_tranche" type="text" label="levels of novel false discovery rate (FDR, implied by ti/tv) at which to slice the data. (in percent, that is 1.0 for 1 percent)" value="100.0, 99.9, 99.0, 90.0" help="-tranche,--TStranche &amp;lt;TStranche&amp;gt;"/>
+        <repeat name="ignore_filters" title="Ignore Filter" help="-ignoreFilter,--ignore_filter &amp;lt;ignore_filter&amp;gt;">
+          <conditional name="ignore_filter_type">
+            <param name="ignore_filter_type_selector" type="select" label="Filter Type">
+              <option value="HARD_TO_VALIDATE">HARD_TO_VALIDATE</option>
+              <option value="LowQual" >LowQual</option>
+              <option value="custom" selected="True">Other</option>
+            </param>
+            <when value="custom">
+              <param name="filter_name" type="text" value="" label="Filter name"/>
+            </when>
+            <when value="HARD_TO_VALIDATE" />
+            <when value="LowQual" />
+          </conditional>
+        </repeat>
+    </expand>
+  </inputs>
+  <outputs>
+    <data format="gatk_recal" name="output_recal" label="${tool.name} on ${on_string} (Recalibration File)" />
+    <data format="gatk_tranche" name="output_tranches" label="${tool.name} on ${on_string} (Tranches File)" />
+    <data format="txt" name="output_rscript" label="${tool.name} on ${on_string} (RScript File)" />
+    <data format="pdf" name="output_tranches_pdf" label="${tool.name} on ${on_string} (PDF File)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <!-- ADD TESTS -->
+  </tests>
+  <help>
+**What it does**
+
+Takes variant calls as .vcf files, learns a Gaussian mixture model over the variant annotations and evaluates the variant -- assigning an informative lod score
+
+For more information on using the VariantRecalibrator module, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantrecalibration_VariantRecalibrator.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: VariantRecalibrator accepts a variant input file.
+
+
+**Outputs**
+
+The output is in VCF format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+
+ tranches_file         The output tranches file used by ApplyRecalibration
+ use_annotation        The names of the annotations which should used for calculations
+ mode                  Recalibration mode to employ: 1.) SNP for recalibrating only snps (emitting indels untouched in the output VCF); 2.) INDEL for indels; and 3.) BOTH for recalibrating both snps and indels simultaneously. (SNP|INDEL|BOTH)
+ maxGaussians          The maximum number of Gaussians to try during variational Bayes algorithm
+ maxIterations         The maximum number of VBEM iterations to be performed in variational Bayes algorithm. Procedure will normally end when convergence is detected.
+ numKMeans             The number of k-means iterations to perform in order to initialize the means of the Gaussians in the Gaussian mixture model.
+ stdThreshold          If a variant has annotations more than -std standard deviations away from mean then don't use it for building the Gaussian mixture model.
+ shrinkage             The shrinkage parameter in variational Bayes algorithm.
+ dirichlet             The dirichlet parameter in variational Bayes algorithm.
+ priorCounts           The number of prior counts to use in variational Bayes algorithm.
+ minNumBadVariants     The minimum amount of worst scoring variants to use when building the Gaussian mixture model of bad variants.
+ recal_file            The output recal file used by ApplyRecalibration
+ target_titv           The expected novel Ti/Tv ratio to use when calculating FDR tranches and for display on optimization curve output figures. (approx 2.15 for whole genome experiments). ONLY USED FOR PLOTTING PURPOSES!
+ TStranche             The levels of novel false discovery rate (FDR, implied by ti/tv) at which to slice the data. (in percent, that is 1.0 for 1 percent)
+ ignore_filter         If specified the optimizer will use variants even if the specified filter name is marked in the input VCF file
+ path_to_Rscript       The path to your implementation of Rscript. For Broad users this is maybe /broad/tools/apps/R-2.6.0/bin/Rscript
+ rscript_file          The output rscript file generated by the VQSR to aid in visualization of the input data and learned model
+ path_to_resources     Path to resources folder holding the Sting R scripts.
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_select.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,287 @@
+<tool id="gatk2_variant_select" name="Select Variants" version="@VERSION@.1">
+  <description>from VCF files</description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    #from binascii import hexlify
+
+    gatk2_wrapper.py
+   --stdout "${output_log}"
+   -d "--variant:variant,%(file_type)s" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant"
+   -p '
+   @JAR_PATH@
+    -T "SelectVariants"
+    \$GATK2_SITE_OPTIONS
+
+    @THREADS@
+    -o "${output_vcf}"
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    '
+    -p '
+    #if $input_concordance:
+        --concordance "${input_concordance}"
+    #end if
+    #if $input_discordance:
+        --discordance "${input_discordance}"
+    #end if
+
+    #for $exclude_sample_name in $exclude_sample_name_repeat:
+        --exclude_sample_name "${exclude_sample_name.exclude_sample_name}"
+    #end for
+
+    ${exclude_filtered}
+
+    #for $sample_name in $sample_name_repeat:
+        --sample_name "${sample_name.sample_name}"
+    #end for
+    '
+
+    #for $select_expressions in $select_expressions_repeat:
+        #set $select_expression = "--select_expressions '%s'" % ( str( $select_expressions.select_expressions ) )
+        -o '${ hexlify( $select_expression ) }'
+    #end for
+
+    ##start tool specific options
+    #if str( $analysis_param_type.analysis_param_type_selector ) == 'advanced':
+        -p '
+          #for $esf in $analysis_param_type.exclude_sample_file:
+              --exclude_sample_file "${esf}"
+          #end for
+
+          #for $sf in $analysis_param_type.sample_file:
+              --sample_file "${sf}"
+          #end for
+
+          #for $sample_file in $analysis_param_type.sample_file_repeat:
+              --sample_file "${ample_file.sample_file}"
+          #end for
+
+          #if $analysis_param_type.input_keep_ids:
+              --keepIDs "${analysis_param_type.input_keep_ids}"
+          #end if
+
+          ${analysis_param_type.keep_original_AC}
+
+          ${analysis_param_type.mendelian_violation}
+
+          --mendelianViolationQualThreshold "${analysis_param_type.mendelian_violation_qual_threshold}"
+
+          --remove_fraction_genotypes "${analysis_param_type.remove_fraction_genotypes}"
+
+          --restrictAllelesTo "${analysis_param_type.restrict_alleles_to}"
+
+          #if str( $analysis_param_type.select_random_type.select_random_type_selector ) == 'select_random_fraction':
+              --select_random_fraction "${analysis_param_type.select_random_type.select_random_fraction}"
+          #elif str( $analysis_param_type.select_random_type.select_random_type_selector ) == 'select_random_number':
+              --select_random_number "${analysis_param_type.select_random_type.select_random_number}"
+          #end if
+
+          #if $analysis_param_type.select_type_to_include:
+              #for $type_to_include in str( $analysis_param_type.select_type_to_include ).split( ',' ):
+                  --selectTypeToInclude "${type_to_include}"
+              #end for
+          #end if
+
+          ${analysis_param_type.exclude_non_variants}
+        '
+
+        #for $sample_expressions in $analysis_param_type.sample_expressions_repeat:
+            #set $sample_expression = "--sample_expressions '%s'" % ( str( $sample_expressions.sample_expressions ) )
+            -o '${ hexlify( $sample_expression ) }'
+        #end for
+
+    #end if
+    ##end tool specific options
+
+    #include source=$standard_gatk_options#
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_variant" type="data" format="vcf" label="Variant file to select" help="-V,--variant &amp;lt;variant&amp;gt;" />
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <param name="input_variant" type="data" format="vcf" label="Variant file to select" help="-V,--variant &amp;lt;variant&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+
+    <repeat name="select_expressions_repeat" title="Criteria to use when selecting the data" help="-select,--select_expressions &amp;lt;select_expressions&amp;gt;">
+        <param name="select_expressions" type="text" label="JEXL expression">
+            <sanitizer>
+              <valid initial="string.printable">
+               <remove value="&apos;"/>
+             </valid>
+              <mapping initial="none"/>
+            </sanitizer>
+        </param>
+    </repeat>
+
+    <param name="input_concordance" type="data" format="vcf" label="Output variants that were also called in this comparison track" optional="True" help="-conc,--concordance &amp;lt;concordance&amp;gt;"/>
+    <param name="input_discordance" type="data" format="vcf" label="Output variants that were not called in this comparison track" optional="True" help="-disc,--discordance &amp;lt;discordance&amp;gt;"/>
+
+    <repeat name="sample_name_repeat" title="Include Samples by name" help="-sn,--sample_name &amp;lt;sample_name&amp;gt;">
+        <param name="sample_name" type="text" label="Include genotypes from this sample"/>
+    </repeat>
+
+    <repeat name="exclude_sample_name_repeat" title="Exclude Samples by name" help="-xl_sn,--exclude_sample_name &amp;lt;exclude_sample_name&amp;gt;">
+        <param name="exclude_sample_name" type="text" label="Exclude genotypes from this sample"/>
+    </repeat>
+
+    <param name="exclude_filtered" type="boolean" truevalue="--excludeFiltered" falsevalue="" label="Don't include filtered loci in the analysis" help="-ef,--excludeFiltered" />
+
+    <expand macro="gatk_param_type_conditional" />
+
+    <expand macro="analysis_type_conditional">
+
+        <param name="exclude_sample_file" type="data" format="txt" multiple="True" label="Exclude Samples by file" help="File containing a list of samples (one per line) to exclude (-xl_sf,--exclude_sample_file &amp;lt;exclude_sample_file&amp;gt;)"/>
+
+        <param name="sample_file" type="data" format="txt" multiple="True" label="Samples by file"  help="File containing a list of samples (one per line) to include (-sf,--sample_file &amp;lt;sample_file&amp;gt;)"/>
+
+        <param name="input_keep_ids" type="data" format="txt" label="Only emit sites whose ID is found in this file" optional="True" help="-IDs,--keepIDs &amp;lt;keepIDs&amp;gt;"/>
+
+        <param name="keep_original_AC" type="boolean" truevalue="--keepOriginalAC" falsevalue="" label="Don't update the AC, AF, or AN values in the INFO field after selecting" help="-keepOriginalAC,--keepOriginalAC" />
+
+        <param name="mendelian_violation" type="boolean" truevalue="--mendelianViolation" falsevalue="" label="output mendelian violation sites only" help="-mv,--mendelianViolation" />
+
+        <param name="mendelian_violation_qual_threshold" type="float" label="Minimum genotype QUAL score for each trio member required to accept a site as a mendelian violation" value="0" help="-mvq,--mendelianViolationQualThreshold &amp;lt;mendelianViolationQualThreshold&amp;gt;" />
+
+        <param name="remove_fraction_genotypes" type="float" label="Selects a fraction (a number between 0 and 1) of the total genotypes at random from the variant track and sets them to nocall" value="0" min="0" max="1" help="-fractionGenotypes,--remove_fraction_genotypes &amp;lt;remove_fraction_genotypes&amp;gt;" />
+
+        <param name="restrict_alleles_to" type="select" label="Select only variants of a particular allelicity" help="-restrictAllelesTo,--restrictAllelesTo &amp;lt;restrictAllelesTo&amp;gt;">
+            <option value="ALL" selected="True">ALL</option>
+            <option value="MULTIALLELIC">MULTIALLELIC</option>
+            <option value="BIALLELIC">BIALLELIC</option>
+        </param>
+
+        <repeat name="sample_expressions_repeat" title="Regular expression to select many samples from the ROD tracks provided" help="-se,--sample_expressions &amp;lt;sample_expressions&amp;gt;">
+            <param name="sample_expressions" type="text" label="Regular expression">
+                <sanitizer>
+                  <valid initial="string.printable">
+                   <remove value="&apos;"/>
+                 </valid>
+                  <mapping initial="none"/>
+                </sanitizer>
+            </param>
+        </repeat>
+
+        <conditional name="select_random_type">
+          <param name="select_random_type_selector" type="select" label="Select a random subset of variants">
+            <option value="select_all" selected="True">Use all variants</option>
+            <option value="select_random_fraction">Select random fraction</option>
+            <option value="select_random_number">Select random number</option>
+          </param>
+          <when value="select_all">
+            <!-- Do nothing here -->
+          </when>
+          <when value="select_random_fraction">
+            <param name="select_random_fraction" type="float" value="0" label="Fraction" min="0" max="1" help="-fraction,--select_random_fraction &amp;lt;select_random_fraction&amp;gt;"/>
+          </when>
+          <when value="select_random_number">
+            <param name="select_random_number" type="integer" value="0" label="Count" help="-number,--select_random_number &amp;lt;select_random_number&amp;gt;" />
+          </when>
+        </conditional>
+
+        <param name="exclude_non_variants" type="boolean" truevalue="--excludeNonVariants" falsevalue="" label="Don't include loci found to be non-variant after the subsetting procedure" help="-env,--excludeNonVariants" />
+
+        <param name="select_type_to_include" type="select" label="Select only a certain type of variants from the input file" multiple="True" display="checkboxes" help="-selectType,--selectTypeToInclude &amp;lt;selectTypeToInclude&amp;gt;">
+            <option value="INDEL">INDEL</option>
+            <option value="SNP">SNP</option>
+            <option value="MIXED">MIXED</option>
+            <option value="MNP">MNP</option>
+            <option value="SYMBOLIC">SYMBOLIC</option>
+            <option value="NO_VARIATION">NO_VARIATION</option>
+        </param>
+    </expand>
+
+  </inputs>
+  <outputs>
+    <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (Variant File)" />
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" />
+          <param name="select_expressions_repeat" value="0" />
+          <param name="input_concordance" />
+          <param name="input_discordance" />
+          <param name="exclude_sample_name_repeat" value="0" />
+          <param name="exclude_filtered" />
+          <param name="sample_name_repeat" value="0" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_vcf" file="gatk/gatk_variant_select/gatk_variant_select_out_1.vcf" lines_diff="4" />
+          <output name="output_log" file="gatk/gatk_variant_select/gatk_variant_select_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+Often, a VCF containing many samples and/or variants will need to be subset in order to facilitate certain analyses (e.g. comparing and contrasting cases vs. controls; extracting variant or non-variant loci that meet certain requirements, displaying just a few samples in a browser like IGV, etc.). SelectVariants can be used for this purpose. Given a single VCF file, one or more samples can be extracted from the file (based on a complete sample name or a pattern match). Variants can be further selected by specifying criteria for inclusion, i.e. "DP &gt; 1000" (depth of coverage greater than 1000x), "AF &lt; 0.25" (sites with allele frequency less than 0.25). These JEXL expressions are documented in the `Using JEXL expressions section &lt;http://gatkforums.broadinstitute.org/discussion/1255/what-are-jexl-expressions-and-how-can-i-use-them-with-the-gatk&gt;`_. One can optionally include concordance or discordance tracks for use in selecting overlapping variants.
+
+For more information on using the SelectVariants module, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantutils_SelectVariants.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: SelectVariants accepts a VCF input file.
+
+
+**Outputs**
+
+The output is in VCF format.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+
+ out                         VCFWriter  stdout  File to which variants should be written
+ variant                     RodBinding[VariantContext]  NA  Input VCF file
+ concordance                 RodBinding[VariantContext]  none  Output variants that were also called in this comparison track
+ discordance                 RodBinding[VariantContext]  none  Output variants that were not called in this comparison track
+ exclude_sample_file         Set[File]  []  File containing a list of samples (one per line) to exclude. Can be specified multiple times
+ exclude_sample_name         Set[String]  []  Exclude genotypes from this sample. Can be specified multiple times
+ excludeFiltered             boolean  false  Don't include filtered loci in the analysis
+ excludeNonVariants          boolean  false  Don't include loci found to be non-variant after the subsetting procedure
+ keepIDs                     File  NA  Only emit sites whose ID is found in this file (one ID per line)
+ keepOriginalAC              boolean  false  Don't update the AC, AF, or AN values in the INFO field after selecting
+ mendelianViolation          Boolean  false  output mendelian violation sites only
+ mvq                         double  0.0  Minimum genotype QUAL score for each trio member required to accept a site as a violation
+ remove_fraction_genotypes   double  0.0  Selects a fraction (a number between 0 and 1) of the total genotypes at random from the variant track and sets them to nocall
+ restrictAllelesTo           NumberAlleleRestriction  ALL  Select only variants of a particular allelicity. Valid options are ALL (default), MULTIALLELIC or BIALLELIC
+ sample_expressions          Set[String]  NA  Regular expression to select many samples from the ROD tracks provided. Can be specified multiple times
+ sample_file                 Set[File]  NA  File containing a list of samples (one per line) to include. Can be specified multiple times
+ sample_name                 Set[String]  []  Include genotypes from this sample. Can be specified multiple times
+ select_expressions          ArrayList[String]  []  One or more criteria to use when selecting the data
+ select_random_fraction      double  0.0  Selects a fraction (a number between 0 and 1) of the total variants at random from the variant track
+ select_random_number        int  0  Selects a number of variants at random from the variant track
+ selectTypeToInclude         List[Type]  []  Select only a certain type of variants from the input file. Valid types are INDEL, SNP, MIXED, MNP, SYMBOLIC, NO_VARIATION. Can be specified multiple times
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_validate.xml	Wed Jan 25 08:00:49 2017 -0500
@@ -0,0 +1,106 @@
+<tool id="gatk2_variant_validate" name="Validate Variants" version="@VERSION@.0">
+  <description></description>
+  <macros>
+    <import>gatk2_macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <expand macro="version_command" />
+  <command interpreter="python">
+    gatk2_wrapper.py
+   --stdout "${output_log}"
+   -d "--variant:variant,%(file_type)s" "${reference_source.input_variant}" "${reference_source.input_variant.ext}" "input_variant"
+   -p '
+   @JAR_PATH@
+    -T "ValidateVariants"
+
+    \$GATK2_SITE_OPTIONS
+
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    ${warn_on_errors}
+    ${do_not_validate_filtered_records}
+   '
+    @DBSNP_OPTIONS@
+
+    #include source=$standard_gatk_options#
+  </command>
+  <inputs>
+
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <param name="input_variant" type="data" format="vcf" label="Input variant file" help="-V,--variant &amp;lt;variant&amp;gt;" />
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk2_picard_indexes">
+            <filter type="data_meta" key="dbkey" ref="input_variant" column="dbkey"/>
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <param name="input_variant" type="data" format="vcf" label="Input variant file" help="-V,--variant &amp;lt;variant&amp;gt;" />
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+    <expand macro="dbsnp_param" />
+
+    <param name="warn_on_errors" type="boolean" checked="False" truevalue="-warnOnErrors" falsevalue="" label="instead of terminating the run at the first error, print warning messages for each error seen." help="-warnOnErrors,--warnOnErrors"/>
+    <param name="do_not_validate_filtered_records" type="boolean" checked="False" truevalue="-doNotValidateFilteredRecords" falsevalue="" label="do not try to validate records that are FILTERed." help="-doNotValidateFilteredRecords,--doNotValidateFilteredRecords"/>
+
+    <expand macro="gatk_param_type_conditional" />
+
+  </inputs>
+  <outputs>
+    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_variant" value="gatk/gatk_variant_annotator/gatk_variant_annotator_out_1.vcf" ftype="vcf" />
+          <param name="dbsnp_rod_bind_type_selector" value="set_dbsnp" />
+          <param name="dbsnp_input_rod" value="gatk/fake_phiX_variant_locations.vcf" ftype="vcf" />
+          <param name="dbsnp_rod_name" value="dbsnp" />
+          <param name="warn_on_errors" value="True"/>
+          <param name="do_not_validate_filtered_records" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <output name="output_log" file="gatk/gatk_validate_variants/gatk_validate_variants_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+Validates a variants file.
+
+For more information on using the ValidateVariants module, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_variantutils_ValidateVariants.html&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gatk/guide/topic?name=faqs&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: ValidateVariants accepts variant files as input.
+
+
+**Outputs**
+
+The output is a log of variant validation.
+
+
+Go `here &lt;http://www.broadinstitute.org/gatk/guide/topic?name=intro&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ doNotValidateFilteredRecords    should we skip validation on filtered records?
+ warnOnErrors                    should we just emit warnings on errors instead of terminating the run?
+
+@CITATION_SECTION@
+  </help>
+  <expand macro="citations" />
+</tool>