Mercurial > repos > rnateam > segemehl

changeset 6:c6cef240817e draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/segemehl commit 7956a517bb57425e53822bcf2ea0b2c9a54d06e3
author bgruening
date Wed, 26 Jul 2017 10:14:42 -0400
parents 9ffdddb42700
children be1a3cc2cf45
files segemehl.xml test-data/testmap.sam
diffstat 2 files changed, 46 insertions(+), 36 deletions(-) [+]
line wrap: on
line diff
--- a/segemehl.xml	Tue Jul 25 10:07:39 2017 -0400
+++ b/segemehl.xml	Wed Jul 26 10:14:42 2017 -0400
@@ -1,4 +1,4 @@
-<tool id="segemehl" name="segemehl" version="0.2.0.1">
+<tool id="segemehl" name="segemehl" version="0.2.0.2">
   <description>short read mapping with gaps</description>
   <requirements>
     <requirement type="package" version="0.2.0">segemehl</requirement>
@@ -14,10 +14,10 @@
         ## prepare segemehl index if no reference genome is supplied
         #if $refGenomeSource.genomeSource == "history":
             mkdir ./temp_index/ &&
-        #set $temp_index = './temp_index/temp.idx'
+            #set $temp_index = './temp_index/temp.idx'
             segemehl.x -x $temp_index -d $refGenomeSource.own_reference_genome &&
         #else:
-        #set $temp_index = $refGenomeSource.index.fields.index_path
+            #set $temp_index = $refGenomeSource.index.fields.index_path
         #end if
         
         ## execute segemehl
@@ -32,34 +32,33 @@
             -d ${refGenomeSource.index.fields.db_path}
         #end if
         
-            -i $temp_index
+        -i $temp_index
         
         ## check for single/pair-end
         #if str( $library.type ) == "single":
-        #set $query_list = list()
+            #set $query_list = list()
         ## prepare inputs
         #for $fastq in $library.input_query:
             $query_list.append('%s' % $fastq )
         #end for
-            -q "#echo ' '.join( $query_list )#"
+        -q "#echo ' '.join( $query_list )#"
         #else
-        ## prepare inputs
-        
-        #set $mate1 = list()
-        #set $mate2 = list()
-        #for $mate_pair in $library.mate_list:
-            $mate1.append( str($mate_pair.first_strand_query) )
-            $mate2.append( str($mate_pair.second_strand_query) )
-        #end for
+            ## prepare inputs        
+            #set $mate1 = list()
+            #set $mate2 = list()
+            #for $mate_pair in $library.mate_list:
+                $mate1.append( str($mate_pair.first_strand_query) )
+                $mate2.append( str($mate_pair.second_strand_query) )
+            #end for
         
             -q #echo ','.join($mate1)
             -p #echo ','.join($mate2)
         
             -I $library.maxinsertsize
         #end if
-            -m $minsize
-            -A $accuracy
-            -H $hitstrategy
+        -m $minsize
+        -A $accuracy
+        -H $hitstrategy
         #if str( $prime5 ).strip():
             -P "$prime5"
         #end if
@@ -70,19 +69,21 @@
             $autoclip
             $hardclip
             $order
-            $splits
         #if $maxout:
             --maxout $maxout
         #end if
-            -s
-        
+        #if str( $splitreads.splits ) == "--split":
+            --splits
             --minsplicecover $minsplicecover
             --minfragscore $minfragscore
             --minfraglen $minfraglen
             --splicescorescale $splicescorescale
-            
-            -o '$segemehl_out'
-
+        #end if
+        -M $maxinterval
+        -E $evalue
+        -D $differences
+        -s
+        -o '$segemehl_out'
     ]]>
   </command>
   <inputs>
@@ -127,18 +128,27 @@
       </when>
     </conditional>
 
-    <param name="minsplicecover" type="integer" value="80" label="Min coverage for spliced transcripts" help="(--minsplicecover)" />
-    <param name="minfragscore" type="integer" value="18" label="Min coverage for spliced transcripts" help="(--minfragscore)" />
-    <param name="minfraglen" type="integer" value="20" label="Min length of a spliced fragment" help="(--minfraglen)" />
-    <param name="splicescorescale" type="float" value="1.0" label="Report spliced alignment with score greater than this scale times the score"
-           help="Report only if this value x score is larger than next best spliced alignment (--splicescorescale)" />
-
+    <conditional name="splitreads">
+      <param name="splits" type="select" label="Detect split/spliced reads" help="(--splits)">
+        <option value="nosplit">No splits</option>
+        <option value="--splits">Split reads</option>
+      </param>
+      <when value="--splits">
+        <param name="minsplicecover" type="integer" value="80" label="Min coverage for spliced transcripts" help="(--minsplicecover)" />
+        <param name="minfragscore" type="integer" value="18" label="Min coverage for spliced transcripts" help="(--minfragscore)" />
+        <param name="minfraglen" type="integer" value="20" label="Min length of a spliced fragment" help="(--minfraglen)" />
+        <param name="splicescorescale" type="float" value="1.0" label="Report spliced alignment with score greater than this scale times the score"
+               help="Report only if this value x score is larger than next best spliced alignment (--splicescorescale)" />
+        <param name="sevalue" type="float" min="0" value="50.000000" label="max split evalue" help="(--maxsplitevalue)"/>
+      </when>
+      <when value="nosplit">
+      </when>     
+    </conditional>
+    
     <param name="minsize" type="integer" value="12" min="1" label="Minimum size of queries" help="(-m)" />
-
     <param name="maxout" type="integer" min="0" value="0" optional="True" 
            label="Maximum number of alignments that will be reported" help="(--maxout)" />
     <param name="accuracy" type="integer" value="85" min="1" max="100" label="Min percentage of matches per read in semi-global alignment" help="(-A)" />
-
     <param name="hitstrategy" type="select" label="Hits to report?" help="(-H)">
       <option value="1">report only best scoring hits</option>
       <option value="0">report all scoring hits</option>
@@ -149,7 +159,9 @@
     <param name="autoclip" type="boolean" truevalue="--autoclip" falsevalue="" checked="false" label="Autoclip unknown 3prime adapter" help="(-Y)"/>
     <param name="hardclip" type="boolean" truevalue="--hardclip" falsevalue="" checked="false" label="Enable hard clipping" help="(-C)"/>
     <param name="order" type="boolean" truevalue="--order" falsevalue="" checked="false" label="Sorts the output by chromsome and position" help="(-O)"/>
-    <param name="splits" type="boolean" truevalue="--splits" falsevalue="" checked="false" label="Detect split/spliced reads" help="(--splits)"/>
+    <param name="differences" type="integer" min="0" value="1" label="search seeds initially with n differences" help="(--differences)"/>
+    <param name="evalue" type="float" min="0" value="5.000000" label="max evalue" help="(--evalue)"/>
+    <param name="maxinterval" type="integer" min="1" value="100" label="maximum width of a suffix array interval, i.e. a query seed will be omitted if it matches more than n times" help="(--maxinterval)"/>
   </inputs>
   <outputs>
     <data format="sam" name="segemehl_out" label="Read alignments on ${on_string}"/>
@@ -159,7 +171,7 @@
       <param name="genomeSource" value="history" />
       <param name="own_reference_genome" value="chr1.fa" />
       <param name="library" value="single" />
-      <param name="input_query" value="test.fastq" />
+      <param name="input_query" value="test.fastq" />   
       <param name="splits" value="true" />
       <output name="segemehl_out" file="testmap.sam" lines_diff="2" />
     </test>
--- a/test-data/testmap.sam	Tue Jul 25 10:07:39 2017 -0400
+++ b/test-data/testmap.sam	Wed Jul 26 10:14:42 2017 -0400
@@ -1,9 +1,7 @@
 @HD	VN:1.0
 @SQ	SN:TestChromosomeForGalaxy	LN:3459
-@PG	ID:segemehl	VN:0.2.0-$Rev: 418 $ ($Date: 2015-01-05 05:17:35 -0500 (Mon, 05 Jan 2015) $)	CL:segemehl.x -i chr1.idx -d chr1.fa -q test.fastq -S -m 12 -A 85 -H 1 --minsplicecover 80 --minfragscore 18 --minfraglen 20 --splicescorescale 1.0
+@PG	ID:segemehl	VN:0.2.0-$Rev: 418 $ ($Date: 2015-01-05 05:17:35 -0500 (Mon, 05 Jan 2015) $)	CL:segemehl.x -t 2 -d test-data/chr1.fa -i test-data/chr1.idx -q test-data/test.fastq -m 12 -A 85 -H 1 -M 100 -E 5.0 -D 1 -s -o testout.sam
 10.516 HWI-EAS100R:1:1:550:1622/1	0	TestChromosomeForGalaxy	182	255	70M	*	0	0	CATGTACTGTTAAAGCGTGCGTTTATTTCAAACATTAATGAAATTTGCAGAACCCAAACTAAAGAGAGAG	3MIa!,$)8EA)!1>tMJ{:2WrL`s|`gg{]'0+Op!6RxNw;V)XKV#Go5}b!`_V]A?!F>{LM(z	NM:i:0	MD:Z:70	NH:i:1	XI:i:0	XA:Z:Q
 10.2869 HWI-EAS100R:1:1:1698:585/1	0	TestChromosomeForGalaxy	661	255	70M	*	0	0	AACCATGCATAAAAGGGGTTCGCCGTTCTCGGAGAGCCACAGAGCCCGGGCCACAGGCAGCTCCTTGCCA	Q-a;@)*!F]Za^4!P*B?&!!No!^76b+X[6eOgr1$3:-Ywg;!Vzj!`=+e>YV|ok_z!D<2+jx	NM:i:0	MD:Z:70	NH:i:1	XI:i:0	XA:Z:Q
 10.2085 HWI-EAS100R:1:1:32:109/2	0	TestChromosomeForGalaxy	1021	255	70M	*	0	0	GGGAATTCACCTCAAGAACATCCAAAGTGTGAAGGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAA	V:e@~!I\GQ>>]?)-qpe!nVI4IJ+4!wE{YoSsVrr~P;PnY/.!a;~!S"n+J#St-g!lQdGA9;	NM:i:0	MD:Z:70	NH:i:1	XI:i:0	XA:Z:Q
-10.2869 HWI-EAS100R:1:1:1698:585/2	0	TestChromosomeForGalaxy	1321	255	43M	*	0	0	CGACTGGAGCTGTTGGTCAGAAATACTGGCGTCTGCCCCCTAA	btOb!D1"=hSm"'G_#I{b!!l#6JQ&iq4A`F%Uug!x!'h	NM:i:0	MD:Z:43	NH:i:1	XI:i:0	XL:i:2	XA:Z:Q	XX:i:1	XY:i:43	XQ:i:0	XC:Z:TestChromosomeForGalaxy	XV:i:2123	XT:i:32
-10.2869 HWI-EAS100R:1:1:1698:585/2	0	TestChromosomeForGalaxy	2123	255	27M	*	0	0	TGGCAAATCCAACTGACCAGAAGGAAG	7o<%qCKQEtM)!bP>!."DvsX9T}=	NM:i:0	MD:Z:27	NH:i:1	XI:i:0	XL:i:2	XA:Z:Q	XX:i:44	XY:i:70	XQ:i:1	XP:Z:TestChromosomeForGalaxy	XU:i:1363	XS:i:64
 10.516 HWI-EAS100R:1:1:550:1623/1	0	TestChromosomeForGalaxy	182	255	70M	*	0	0	CATGTACTGTTAAAGCGTGCGTTTATTTCAAACATTAATGAAATTTGCAGAACCCAAACTAAAGAGAGAG	3MIa!,$)8EA)!1>tMJ{:2WrL`s|`gg{]'0+Op!6RxNw;V)XKV#Go5}b!`_V]A?!F>{LM(z	NM:i:0	MD:Z:70	NH:i:1	XI:i:0	XA:Z:Q