Mercurial > repos > matthias > data_manager_dada2

changeset 3:3a4ee8bf012a draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/data_managers/data_manager_dada2 commit 5b1603bbcd3f139cad5c876be83fcb39697b5613-dirty
author matthias
date Tue, 09 Apr 2019 07:18:57 -0400
parents b4c303665291
children 51b90d282704
files data_manager/.megan_tools_fetcher.xml.swp data_manager/dada2_fetcher.xml data_manager/data_manager.py data_manager/test-data/PR24.11.1_json data_manager/test-data/RefSeq_RDP2018_json data_manager/test-data/greengenes13.84_json data_manager/test-data/gtdb2018_json data_manager/test-data/hitdb1_json data_manager/test-data/rdp16_json data_manager/test-data/silva132_json data_manager/test-data/silvaeuk132_json data_manager/test-data/unite8fungi_json test-data/SSURef_Nr99_132_tax_silva_to_NCBI_synonyms_json
diffstat 12 files changed, 193 insertions(+), 113 deletions(-) [+]
line wrap: on
line diff
Binary file data_manager/.megan_tools_fetcher.xml.swp has changed
--- a/data_manager/dada2_fetcher.xml	Fri Mar 08 05:38:44 2019 -0500
+++ b/data_manager/dada2_fetcher.xml	Tue Apr 09 07:18:57 2019 -0400
@@ -1,90 +1,174 @@
 <?xml version="1.0"?>
-<tool id="dada_fetcher" name="dada2 dada manager" tool_type="manage_data" version="0.0.5">
-    <description>Download reference data sets</description>
-    <command detect_errors="exit_code">
-    <![CDATA[
-    python '$__tool_directory__/data_manager.py' 
+<tool id="dada_fetcher" name="dada2 data manager" version="0.0.5">
+    <description>Download reference databases</description>
+    <command detect_errors="exit_code"><![CDATA[
+    python '$__tool_directory__/data_manager.py'
     --out '${out_file}'
-    --dataset '$database_name'
+    --dataset '$db_cond.db_select'_'$db_cond.version_select'
     ]]>
     </command>
     <inputs>
-        <param name="database_name" type="select" label="mapping data">
-            <option value="silva132">Silva version 132</option>
-            <option value="silva128">Silva version 128</option>
-            <option value="rdp16">RDP trainset 16</option>
-            <option value="rdp14">RDP trainset 14</option>
-            <option value="gg13.84">GreenGenes version 13.84</option>
-            <option value="unite8.0_fungi">UNITE: General Fasta release 8.0 for Fungi</option>
-            <option value="unite8.0_fungi_singletons">UNITE: General Fasta release 8.0 for Fungi including global and 97% singletons</option>
-            <option value="unite8.0_euka">UNITE: General Fasta release 8.0 for all Eukaryotes</option>
-            <option value="unite8.0_euka_singletons">UNITE: General Fasta release 8.0 for all Eukaryotes including global and 97% singletons</option>
-            <option value="RefSeq_RDP_2018_05">NCBI RefSeq 16S rRNA database supplemented by RDP (05/2018)</option>
-            <option value="gtdb_2018_11_20">GTDB: Genome Taxonomy Database (Bacteria &amp; Archaea) (11/2018)</option>
-            <option value="hitdb1">HitDB version 1 (Human InTestinal 16S)</option>
-            <option value="silva132_euk_18S">Silva version 132 Eukaryotic 18S</option>
-            <option value="PR2v4.11.1">Protist Ribosomal Reference database (PR2) 4.11.1</option>
-        </param>
+        <conditional name="db_cond">
+            <param name="db_select" type="select" label="Taxonomic database">
+                <option value="silva">Silva</option>
+                <option value="rdp">RDP</option>
+                <option value="greengenes">GreenGenes</option>
+                <option value="unite">UNITE: General Fasta</option>
+                <option value="RefSeq_RDP">NCBI RefSeq 16S rRNA database supplemented by RDP</option>
+                <option value="gtdb">GTDB: Genome Taxonomy Database (Bacteria &amp; Archaea)</option>
+                <option value="hitdb">HitDB (Human InTestinal 16S)</option>
+                <option value="silva_euk_18S">Silva Eukaryotic 18S</option>
+                <option value="PR2">Protist Ribosomal Reference database (PR2)</option>
+            </param>
+            <when value="silva">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="132">132</option>
+                    <option value="128">128</option>
+                </param>
+            </when>
+            <when value="rdp">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="16">16</option>
+                    <option value="14">14</option>
+                </param>
+            </when>
+            <when value="greengenes">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="13.84">13.84</option>
+                </param>
+            </when>
+            <when value="unite">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="8.0_fungi">release 8.0 for Fungi</option>
+                    <option value="8.0_fungi_singleton">release 8.0 for Fungi including global and 97% singletons</option>
+                </param>
+            </when>
+            <when value="RefSeq_RDP">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="2018_05">05/2018</option>
+                </param>
+            </when>
+            <when value="gtdb">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="2018_11">11/2018</option>
+                </param>
+            </when>
+            <when value="hitdb">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="1">1</option>
+                </param>
+            </when>
+            <when value="silva_euk_18S">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="132">132</option>
+                </param>
+            </when>
+            <when value="PR2">
+                <param name="version_select" type="select" label="Database version">
+                    <option value="4.11.1">4.11.1</option>
+                </param>
+            </when>
+        </conditional>
     </inputs>
     <outputs>
         <data name="out_file" format="data_manager_json" />
     </outputs>
     <tests>
         <test>
-            <param name="database_name" value="silva132"/>
+            <param name="db_cond|db_select" value="silva"/>
+            <param name="db_cond|db_version" value="132"/>
             <output name="out_file" file="silva132_json"/>
         </test>
+        <test>
+            <param name="db_cond|db_select" value="rdp"/>
+            <param name="db_cond|db_version" value="16"/>
+            <output name="out_file" file="rdp16_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="greengenes"/>
+            <param name="db_cond|db_version" value="13.84"/>
+            <output name="out_file" file="greengenes13.84_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="unite"/>
+            <param name="db_cond|db_version" value="8.0_fungi"/>
+            <output name="out_file" file="unite8fungi_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="RefSeq_RDP"/>
+            <param name="db_cond|db_version" value="2018_05"/>
+            <output name="out_file" file="RefSeq_RDP2018_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="gtdb"/>
+            <param name="db_cond|db_version" value="2018_11"/>
+            <output name="out_file" file="gtdb2018_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="hitdb"/>
+            <param name="db_cond|db_version" value="1"/>
+            <output name="out_file" file="hitdb1_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="silva_euk_18S"/>
+            <param name="db_cond|db_version" value="132"/>
+            <output name="out_file" file="silvaeuk132_json"/>
+        </test>
+        <test>
+            <param name="db_cond|db_select" value="PR2"/>
+            <param name="db_cond|db_version" value="4.11.1"/>
+            <output name="out_file" file="PR24.11.1_json"/>
+        </test>
     </tests>
     <help><![CDATA[
-Public Reference data sets
---------------------------
+Public Reference databases maintained by the DADA2 project
+..........................................................
 
-The following 16S data sets are taken from the list of data sets maintained by the DADA2 project (https://benjjneb.github.io/dada2/training.html)
+The following refrence databases which are describes as maintained by the DADA2 project (https://benjjneb.github.io/dada2/training.html) are available
 
-- Silva version 132
-- Silva version 128
-- RDP trainset 16 + RDP database release 11.5</option>
-- RDP trainset 14
-- GreenGenes version 13.8
+- Silva (https://www.arb-silva.de/)
+- RDP (http://rdp.cme.msu.edu/)
+- GreenGenes (http://greengenes.secondgenome.com/)
+- UNITE general FASTA (https://unite.ut.ee/repository.php)
 
-While the Silva and RDP data sets contain reference data bases for taxonomy and species assignment, the greengenes data set only contains a reference data base for taxonomy assignment.
+While Silva and RDP contain reference databases for taxonomy and species assignment, the greengenes and UNITE databases only contains a reference database for taxonomy assignment.
 
-For the Silva data sets consider to check the license information: http://www.arb-silva.de/silva-license-information.
+For the Silva databases check the license information: http://www.arb-silva.de/silva-license-information.
 
-
+Except for UNITE all reference databases are downloaded from the corresponding zenodo links that are listed on the DADA2 website. The UNITE databases are taken from the links provided on the UNITE website
 
-(More info: http://gtdb.ecogenomic.org/)
-
-https://github.com/pr2database/pr2database
+More detailed informations in the reference data bases can be found on the DADA2 website and contained links: https://benjjneb.github.io/dada2/training.html.
 
+Further public Reference databases listed by the DADA2 project
+..............................................................
 
-Custom Reference data sets
---------------------------
+Several contributed reference databases are listed of the DADA2 project website (https://benjjneb.github.io/dada2/training.html):
 
-For ** taxonomy assignment ** the following is needed: 
+- RefSeq + RDP (NCBI RefSeq 16S rRNA database supplemented by RDP)
+- GTDB: Genome Taxonomy Database (More info: http://gtdb.ecogenomic.org/)
+- HitDB version 1 (Human InTestinal 16S rRNA) (https://github.com/microbiome/HITdb)
+- RDP fungi LSU
+- Silva Eukaryotic 18S
+- PR2 (https://github.com/pr2database/pr2database)
 
-- a reference fasta data base 
-- a comma separated list of taxonomic ranks present in the reference data base 
-
-The reference fasta data base for taxonomic assignment (fasta or compressed fasta) needs to encode the taxonomy corresponding to each sequence in the fasta header lines in the following fashion (note, the second sequence is not assigned down to level 6):
-
-::
+Except for PR2, all reference databases are downloaded from the corresponding zenodo links that are listed on the DADA2 website. The PR2 database is taken from their github page.
 
->Level1;Level2;Level3;Level4;Level5;Level6;
-ACCTAGAAAGTCGTAGATCGAAGTTGAAGCATCGCCCGATGATCGTCTGAAGCTGTAGCATGAGTCGATTTTCACATTCAGGGATACCATAGGATAC
->Level1;Level2;Level3;Level4;Level5;
-CGCTAGAAAGTCGTAGAAGGCTCGGAGGTTTGAAGCATCGCCCGATGGGATCTCGTTGCTGTAGCATGAGTACGGACATTCAGGGATCATAGGATAC
-
-The list of required taxonomic ranks could be for instance: "Kingdom,Phylum,Class,Order,Family,Genus"
-
-The reference data base for ** species assignment ** is a fasta file (or compressed fasta file), with the id line formatted as follows:
-
-::
-
->ID Genus species
-ACCTAGAAAGTCGTAGATCGAAGTTGAAGCATCGCCCGATGATCGTCTGAAGCTGTAGCATGAGTCGATTTTCACATTCAGGGATACCATAGGATAC
->ID Genus species
-CGCTAGAAAGTCGTAGAAGGCTCGGAGGTTTGAAGCATCGCCCGATGGGATCTCGTTGCTGTAGCATGAGTACGGACATTCAGGGATCATAGGATAC
+More detailed informations in the reference data bases can be found on the DADA2 website and contained links: https://benjjneb.github.io/dada2/training.html.
     ]]></help>
+    <citations>
+        <!-- silva -->
+         <citation type="doi">10.1093/nar/gks1219</citation>
+        <!-- rdp -->>
+        <citation type="doi">10.1093/nar/gkt1244</citation>
+        <!-- greengenes -->
+        <citation type="doi">10.1128/AEM.03006-05</citation>
+        <!-- unite -->
+        <citation type="doi">10.15156/BIO/786343</citation>
+        <!-- TODO gtdb ??? -->
+        <!-- hitdb -->
+        <citation type="doi">10.1186/s12864-015-2265-y</citation>
+        <!-- PR2 -->
+        <citation type="doi">10.1093/nar/gks1160</citation>
+    </citations>
 </tool>
 
--- a/data_manager/data_manager.py	Fri Mar 08 05:38:44 2019 -0500
+++ b/data_manager/data_manager.py	Tue Apr 09 07:18:57 2019 -0400
@@ -14,55 +14,49 @@
 DEFAULT_TAXLEVELS="Kingdom,Phylum,Class,Order,Family,Genus,Species"
 
 FILE2NAME = {
-    "silva132":"Silva version 132",
-    "silva128":"Silva version 128",
-    "rdp16":"RDP trainset 16",
-    "rdp14":"RDP trainset 14",
-    "gg13.84":"GreenGenes version 13.8",
-    "unite8.0_fungi": "UNITE: General Fasta release 8.0 for Fungi",
-    "unite8.0_fungi_singletons": "UNITE: General Fasta release 8.0 for Fungi including global and 97% singletons",
-    "unite8.0_euka": "UNITE: General Fasta release 8.0 for all Eukaryotes",
-    "unite8.0_euka_singletons": "UNITE: General Fasta release 8.0 for all Eukaryotes including global and 97% singletons",
+    "silva_132":"Silva version 132",
+    "silva_128":"Silva version 128",
+    "rdp_16":"RDP trainset 16",
+    "rdp_14":"RDP trainset 14",
+    "greengenes_13.84":"GreenGenes version 13.84",
+    "unite_8.0_fungi": "UNITE: General Fasta release 8.0 for Fungi",
+    "unite_8.0_fungi_singletons": "UNITE: General Fasta release 8.0 for Fungi including global and 97% singletons",
     "RefSeq_RDP_2018_05": "NCBI RefSeq 16S rRNA database supplemented by RDP (05/2018)",
-    "gtdb_2018_11_20": "GTDB: Genome Taxonomy Database (Bacteria &amp; Archaea) (11/2018)",
-    "hitdb1": "HitDB version 1 (Human InTestinal 16S rRNA)",
-    "silva132_euk_18S": "Silva version 132 Eukaryotic 18S",
-    "PR2v4.11.1": "Protist Ribosomal Reference database (PR2) 4.11.1"
+    "gtdb_2018_11": "GTDB: Genome Taxonomy Database (Bacteria &amp; Archaea) (11/2018)",
+    "hitdb_1": "HitDB version 1 (Human InTestinal 16S rRNA)",
+    "silva_euk_18S_132": "Silva version 132 Eukaryotic 18S",
+    "PR2_4.11.1": "Protist Ribosomal Reference database (PR2) 4.11.1"
 }
 
 FILE2TAXURL = {
-    "silva132":"https://zenodo.org/record/1172783/files/silva_nr_v132_train_set.fa.gz?download=1",
-    "silva128":"https://zenodo.org/record/824551/files/silva_nr_v128_train_set.fa.gz?download=1",
-    "rdp16":"https://zenodo.org/record/801828/files/rdp_train_set_16.fa.gz?download=1",
-    "rdp14":"https://zenodo.org/record/158955/files/rdp_train_set_14.fa.gz?download=1",
-    "unite8.0_fungi": "https://files.plutof.ut.ee/public/orig/EB/0C/EB0CCB3A871B77EA75E472D13926271076904A588D2E1C1EA5AFCF7397D48378.zip",
-    "unite8.0_fungi_singletons": "https://files.plutof.ut.ee/doi/06/A2/06A2C86256EED64085670EB0C54B7115F6DAC8F311C656A9CB33E386CFABA0D0.zip",
-    "unite8.0_euka": "https://files.plutof.ut.ee/public/orig/D6/96/D69658E99589D888A207805A744019DBA4EC0F603E67E53732767B3E03A5AA86.zip",
-    "unite8.0_euka_singletons": "https://files.plutof.ut.ee/doi/C2/20/C22034350E32D6AD7E5D1AF3F8BC487E34DA0BE25602B0E748906005CE6ADA97.zip",
-    "gg13.84":"https://zenodo.org/record/158955/files/gg_13_8_train_set_97.fa.gz?download=1",
+    "silva_132":"https://zenodo.org/record/1172783/files/silva_nr_v132_train_set.fa.gz?download=1",
+    "silva_128":"https://zenodo.org/record/824551/files/silva_nr_v128_train_set.fa.gz?download=1",
+    "rdp_16":"https://zenodo.org/record/801828/files/rdp_train_set_16.fa.gz?download=1",
+    "rdp_14":"https://zenodo.org/record/158955/files/rdp_train_set_14.fa.gz?download=1",
+    "unite_8.0_fungi": "https://files.plutof.ut.ee/public/orig/EB/0C/EB0CCB3A871B77EA75E472D13926271076904A588D2E1C1EA5AFCF7397D48378.zip",
+    "unite_8.0_fungi_singletons": "https://files.plutof.ut.ee/doi/06/A2/06A2C86256EED64085670EB0C54B7115F6DAC8F311C656A9CB33E386CFABA0D0.zip",
+    "greengenes_13.84":"https://zenodo.org/record/158955/files/gg_13_8_train_set_97.fa.gz?download=1",
     "RefSeq_RDP_2018_05": "https://zenodo.org/record/2541239/files/RefSeq-RDP16S_v2_May2018.fa.gz?download=1",
-    "gtdb_2018_11_20": "https://zenodo.org/record/2541239/files/GTDB_bac-arc_ssu_r86.fa.gz?download=1",
-    "hitdb1": "https://zenodo.org/record/159205/files/hitdb_v1.00.fa.gz?download=1",
-    "silva132_euk_18S": "https://zenodo.org/record/1447330/files/silva_132.18s.99_rep_set.dada2.fa.gz?download=1",
-    "PR2v4.11.1": "https://github.com/pr2database/pr2database/releases/download/4.11.1/pr2_version_4.11.1_dada2.fasta.gz"
+    "gtdb_2018_11": "https://zenodo.org/record/2541239/files/GTDB_bac-arc_ssu_r86.fa.gz?download=1",
+    "hitdb_1": "https://zenodo.org/record/159205/files/hitdb_v1.00.fa.gz?download=1",
+    "silva_euk_18S_132": "https://zenodo.org/record/1447330/files/silva_132.18s.99_rep_set.dada2.fa.gz?download=1",
+    "PR2_4.11.1": "https://github.com/pr2database/pr2database/releases/download/4.11.1/pr2_version_4.11.1_dada2.fasta.gz"
 }
 
 FILE2SPECIESURL = {
-    "silva132":"https://zenodo.org/record/1172783/files/silva_species_assignment_v132.fa.gz?download=1",
-    "silva128":"https://zenodo.org/record/824551/files/silva_species_assignment_v128.fa.gz?download=1",
-    "rdp16":"https://zenodo.org/record/801828/files/rdp_species_assignment_16.fa.gz?download=1",
-    "rdp14":"https://zenodo.org/record/158955/files/rdp_species_assignment_14.fa.gz?download=1"
+    "silva_132":"https://zenodo.org/record/1172783/files/silva_species_assignment_v132.fa.gz?download=1",
+    "silva_128":"https://zenodo.org/record/824551/files/silva_species_assignment_v128.fa.gz?download=1",
+    "rdp_16":"https://zenodo.org/record/801828/files/rdp_species_assignment_16.fa.gz?download=1",
+    "rdp_14":"https://zenodo.org/record/158955/files/rdp_species_assignment_14.fa.gz?download=1"
 }
 
 FILE2TAXLEVELS = {
-    "PR2v4.11.1": "Kingdom,Supergroup,Division,Class,Order,Family,Genus,Species"
+    "PR2_4.11.1": "Kingdom,Supergroup,Division,Class,Order,Family,Genus,Species"
 }
 
 def url_download(url, fname, workdir):
     """
     download url to workdir/fname
-    
-    return the path to the resulting file 
     """
     file_path = os.path.join(workdir, fname)
     if not os.path.exists(workdir):
@@ -94,25 +88,23 @@
         zip_ref.extractall(workdir)
         zip_ref.close()
         # gzip top level fasta file
-        fastas = glob.glob("*fasta")
+        fastas = glob.glob("%s/*fasta"%workdir)
         if len(fastas) != 1:
-            msg = "UNITE download %s contained more than one or no fasta file"
+            msg = "UNITE download %s contained %d fasta file(s): %s"%(url, len(fastas), " ".join(fastas))
             raise Exception(msg)
         with open(fastas[0], 'rb') as f_in:
             with gzip.open(file_path, 'wb') as f_out:
                 shutil.copyfileobj(f_in, f_out)
 
-    return fname
 
-def main(dataset, outjson):
+def remote_dataset(dataset, outjson):
 
-    params = json.loads(open(outjson).read())
-    target_directory = params['output_data'][0]['extra_files_path']
-    os.mkdir(target_directory)
-    output_path = os.path.abspath(os.path.join(os.getcwd(), 'dada2'))
+    with open(outjson) as jf:
+        params = json.loads(jf.read())
 
-    workdir = os.path.join(os.getcwd(), 'dada2') 
-    path = url_download( FILE2TAXURL[dataset], dataset+".taxonomy", workdir)
+    workdir = params['output_data'][0]['extra_files_path']
+    os.mkdir(workdir)
+    url_download( FILE2TAXURL[dataset], dataset+".taxonomy", workdir)
 
     data_manager_json = {"data_tables":{}}
     data_manager_entry = {}
@@ -122,21 +114,16 @@
     data_manager_entry['taxlevels'] = FILE2TAXLEVELS.get(dataset, DEFAULT_TAXLEVELS)
     data_manager_json["data_tables"]["dada2_taxonomy"] = data_manager_entry
 
-
     if FILE2SPECIESURL.get(dataset, False ):
-        path = url_download( FILE2SPECIESURL[dataset], dataset+".species", workdir)
-    
+        url_download( FILE2SPECIESURL[dataset], dataset+".species", workdir)
         data_manager_entry = {}
         data_manager_entry['value'] = dataset
         data_manager_entry['name'] = FILE2NAME[dataset]
         data_manager_entry['path'] = dataset+".species"
         data_manager_json["data_tables"]["dada2_species"] = data_manager_entry
-    
-    for filename in os.listdir(workdir):
-        shutil.move(os.path.join(output_path, filename), target_directory)
 
-    sys.stderr.write("JSON %s" %json.dumps(data_manager_json))
-    file(outjson, 'w').write(json.dumps(data_manager_json))
+    with file(outjson, 'w') as jf:
+        jf.write(json.dumps(data_manager_json))
 
 if __name__ == '__main__':
     parser = argparse.ArgumentParser(description='Create data manager json.')
@@ -144,4 +131,4 @@
     parser.add_argument('--dataset', action='store', help='Download data set name')
     args = parser.parse_args()
 
-    main(args.dataset, args.out)
+    remote_dataset(args.dataset, args.out)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/PR24.11.1_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_taxonomy": {"path": "PR2_4.11.1.taxonomy", "name": "Protist Ribosomal Reference database (PR2) 4.11.1", "value": "PR2_4.11.1", "taxlevels": "Kingdom,Supergroup,Division,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/RefSeq_RDP2018_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_taxonomy": {"path": "RefSeq_RDP_2018_05.taxonomy", "name": "NCBI RefSeq 16S rRNA database supplemented by RDP (05/2018)", "value": "RefSeq_RDP_2018_05", "taxlevels": "Kingdom,Phylum,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/greengenes13.84_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_taxonomy": {"path": "greengenes_13.84.taxonomy", "name": "GreenGenes version 13.84", "value": "greengenes_13.84", "taxlevels": "Kingdom,Phylum,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/gtdb2018_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_taxonomy": {"path": "gtdb_2018_11.taxonomy", "name": "GTDB: Genome Taxonomy Database (Bacteria &amp; Archaea) (11/2018)", "value": "gtdb_2018_11", "taxlevels": "Kingdom,Phylum,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/hitdb1_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_taxonomy": {"path": "hitdb_1.taxonomy", "name": "HitDB version 1 (Human InTestinal 16S rRNA)", "value": "hitdb_1", "taxlevels": "Kingdom,Phylum,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/rdp16_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_species": {"path": "rdp_16.species", "name": "RDP trainset 16", "value": "rdp_16"}, "dada2_taxonomy": {"path": "rdp_16.taxonomy", "name": "RDP trainset 16", "value": "rdp_16", "taxlevels": "Kingdom,Phylum,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/silva132_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_species": {"path": "silva_132.species", "name": "Silva version 132", "value": "silva_132"}, "dada2_taxonomy": {"path": "silva_132.taxonomy", "name": "Silva version 132", "value": "silva_132", "taxlevels": "Kingdom,Phylum,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/silvaeuk132_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_taxonomy": {"path": "silva_euk_18S_132.taxonomy", "name": "Silva version 132 Eukaryotic 18S", "value": "silva_euk_18S_132", "taxlevels": "Kingdom,Phylum,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/data_manager/test-data/unite8fungi_json	Tue Apr 09 07:18:57 2019 -0400
@@ -0,0 +1,1 @@
+{"data_tables": {"dada2_taxonomy": {"path": "unite_8.0_fungi.taxonomy", "name": "UNITE: General Fasta release 8.0 for Fungi", "value": "unite_8.0_fungi", "taxlevels": "Kingdom,Phylum,Class,Order,Family,Genus,Species"}}}
\ No newline at end of file