Mercurial > repos > lparsons > fastx_barcode_splitter_enhanced
changeset 3:e2a40f9b2fa6 draft
Uploaded
| author | lparsons |
|---|---|
| date | Thu, 07 Nov 2013 17:17:15 -0500 |
| parents | e958c1e00122 |
| children | d1a0e6201854 |
| files | RPKM_count.xml RPKM_saturation.xml bam2wig.xml bam_stat.xml clipping_profile.xml fastx_barcode_splitter.pl fastx_barcode_splitter.xml fastx_barcode_splitter_galaxy_wrapper.sh geneBody_coverage.xml geneBody_coverage2.xml infer_experiment.xml inner_distance.xml junction_annotation.xml junction_saturation.xml read_GC.xml read_NVC.xml read_distribution.xml read_duplication.xml read_quality.xml test-data/fastx_barcode_splitter1.fastq test-data/fastx_barcode_splitter1.out test-data/fastx_barcode_splitter1.txt tool_dependencies.xml |
| diffstat | 23 files changed, 1585 insertions(+), 961 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/RPKM_count.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,132 @@ +<tool id="rseqc_RPKM_count" name="RPKM Count" version="1.1"> + <description>calculates raw count and RPKM values for transcript at exon, intron, and mRNA level</description> + <requirements> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + ln -s "${input}" "local_input.bam" && + ln -s "${input.metadata.bam_index}" "local_input.bam.bai" && + RPKM_count.py -i "local_input.bam" -o output -r $refgene + + #if str($strand_type.strand_specific) == "pair" + -d + #if str($strand_type.pair_type) == "sd" + '1++,1--,2+-,2-+' + #else + '1+-,1-+,2++,2--' + #end if + #end if + + #if str($strand_type.strand_specific) == "single" + -d + #if str($strand_type.single_type) == "s" + '++,--' + #else + '+-,-+' + #end if + #end if + + #if $skiphits + -u + #end if + + #if $onlyexonic + -e + #end if + + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam" label="input bam/sam file" /> + <param name="refgene" type="data" format="bed" label="Reference gene model" /> + <conditional name="strand_type"> + <param name="strand_specific" type="select" label="Strand-specific?" value="None"> + <option value="none">None</option> + <option value="pair">Pair-End RNA-seq</option> + <option value="single">Single-End RNA-seq</option> + </param> + <when value="pair"> + <param name="pair_type" type="select" display="radio" label="Pair-End Read Type (format: mapped --> parent)" value="sd"> + <option value="sd"> read1 (positive --> positive; negative --> negative), read2 (positive --> negative; negative --> positive)</option> + <option value="ds">read1 (positive --> negative; negative --> positive), read2 (positive --> positive; negative --> negative)</option> + </param> + </when> + <when value="single"> + <param name="single_type" type="select" display="radio" label="Single-End Read Type (format: mapped --> parent)" value="s"> + <option value="s">positive --> positive; negative --> negative</option> + <option value="d">positive --> negative; negative --> positive</option> + </param> + </when> + <when value="none"></when> + </conditional> + <param name="skiphits" type="boolean" value="false" label="Skip Multiple Hit Reads" /> + <param name="onlyexonic" type="boolean" value="false" label="Only use exonic (UTR exons and CDS exons) reads, otherwise use all reads" /> + </inputs> + <outputs> + <data format="xls" name="outputxls" from_work_dir="output_read_count.xls"/> + </outputs> + <help> +RPKM_count.py ++++++++++++++ + +Given a BAM file and reference gene model, this program will calculate the raw count and RPKM +values for transcript at exon, intron and mRNA level. For strand specific RNA-seq data, +program will assign read to its parental gene according to strand rule, if you don't know the +strand rule, run infer_experiment.py. Please note that chromosome ID, genome cooridinates +should be concordant between BAM and BED files. + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene model in BED format. + +Strand sequencing type (default=none) + See Infer Experiment tool if uncertain. + +Options +++++++++++++++ + +Skip Multiple Hit Reads + Use Multiple hit reads or use only uniquely mapped reads. + +Only use exonic reads + Renders program only used exonic (UTR exons and CDS exons) reads, otherwise use all reads. + +Sample Output +++++++++++++++ + +===== ======== ======== ===================== ===== =========== ============= ============= ======== ========= +chrom start end accession score gene strand tag count (+) tag count (-) RPKM (+) RPKM (-) +===== ======== ======== ===================== ===== =========== ============= ============= ======== ========= +chr1 29213722 29313959 NM_001166007_intron_1 0 '+' 431 4329 0.086 0.863 +chr1 29314417 29319841 NM_001166007_intron_2 0 '+' 31 1 0.114 0.004 +chr1 29320054 29323726 NM_001166007_intron_3 0 '+' 32 0 0.174 0.000 +chr1 29213602 29213722 NM_001166007_exon_1 0 '+' 164 0 27.321 0.000 +chr1 29313959 29314417 NM_001166007_exon_2 0 '+' 1699 4 74.158 0.175 +chr1 29319841 29320054 NM_001166007_exon_3 0 '+' 528 1 49.554 0.094 +===== ======== ======== ===================== ===== =========== ============= ============= ======== ========= + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/RPKM_saturation.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,160 @@ +<tool id="rseqc_RPKM_saturation" name="RPKM Saturation" version="1.1"> + <description>calculates raw count and RPKM values for transcript at exon, intron, and mRNA level</description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> RPKM_saturation.py -i $input -o output -r $refgene + + #if str($strand_type.strand_specific) == "pair" + -d + #if str($strand_type.pair_type) == "sd" + '1++,1--,2+-,2-+' + #else + '1+-,1-+,2++,2--' + #end if + #end if + + #if str($strand_type.strand_specific) == "single" + -d + #if str($strand_type.single_type) == "s" + '++,--' + #else + '+-,-+' + #end if + #end if + + -l $percentileFloor -u $percentileCeiling -s $percentileStep -c $rpkmCutoff + + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam" label="input bam/sam file" /> + <param name="refgene" type="data" format="bed" label="Reference gene model" /> + <conditional name="strand_type"> + <param name="strand_specific" type="select" label="Strand-specific?" value="None"> + <option value="none">None</option> + <option value="pair">Pair-End RNA-seq</option> + <option value="single">Single-End RNA-seq</option> + </param> + <when value="pair"> + <param name="pair_type" type="select" display="radio" label="Pair-End Read Type (format: mapped --> parent)" value="sd"> + <option value="sd"> read1 (positive --> positive; negative --> negative), read2 (positive --> negative; negative --> positive)</option> + <option value="ds">read1 (positive --> negative; negative --> positive), read2 (positive --> positive; negative --> negative)</option> + </param> + </when> + <when value="single"> + <param name="single_type" type="select" display="radio" label="Single-End Read Type (format: mapped --> parent)" value="s"> + <option value="s">positive --> positive; negative --> negative</option> + <option value="d">positive --> negative; negative --> positive</option> + </param> + </when> + <when value="none"></when> + </conditional> + <param name="percentileFloor" type="integer" value="5" label="Begin sampling from this percentile (default=5)" /> + <param name="percentileCeiling" type="integer" value="100" label="End sampling at this percentile (default=100)" /> + <param name="percentileStep" type="integer" value="5" label="Sampling step size (default=5)" /> + <param name="rpkmCutoff" type="text" value="0.01" label="Ignore transcripts with RPKM smaller than this number (default=0.01)" /> + </inputs> + <outputs> + <data format="xls" name="outputxls" from_work_dir="output.eRPKM.xls" label="${tool.name} on ${on_string} (RPKM XLS)"/> + <data format="xls" name="outputrawxls" from_work_dir="output.rawCount.xls" label="${tool.name} on ${on_string} (Raw Count XLS)"/> + <data format="txt" name="outputr" from_work_dir="output.saturation.r" label="${tool.name} on ${on_string} (R Script)"/> + <data format="pdf" name="outputpdf" from_work_dir="output.saturation.pdf" label="${tool.name} on ${on_string} (PDF)"/> + </outputs> + <help> +RPKM_saturation.py +++++++++++++++++++ + +The precision of any sample statitics (RPKM) is affected by sample size (sequencing depth); +\'resampling\' or \'jackknifing\' is a method to estimate the precision of sample statistics by +using subsets of available data. This module will resample a series of subsets from total RNA +reads and then calculate RPKM value using each subset. By doing this we are able to check if +the current sequencing depth was saturated or not (or if the RPKM values were stable or not) +in terms of genes' expression estimation. If sequencing depth was saturated, the estimated +RPKM value will be stationary or reproducible. By default, this module will calculate 20 +RPKM values (using 5%, 10%, ... , 95%,100% of total reads) for each transcripts. + +In the output figure, Y axis is "Percent Relative Error" or "Percent Error" which is used +to measures how the RPKM estimated from subset of reads (i.e. RPKMobs) deviates from real +expression level (i.e. RPKMreal). However, in practice one cannot know the RPKMreal. As a +proxy, we use the RPKM estimated from total reads to approximate RPKMreal. + +.. image:: http://rseqc.sourceforge.net/_images/RelativeError.png + :height: 80 px + :width: 400 px + :scale: 100 % + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene model in BED format. + +Strand sequencing type (default=none) + See Infer Experiment tool if uncertain. + +Options +++++++++++++++ + +Skip Multiple Hit Reads + Use Multiple hit reads or use only uniquely mapped reads. + +Only use exonic reads + Renders program only used exonic (UTR exons and CDS exons) reads, otherwise use all reads. + +Output +++++++++++++++ + +1. output..eRPKM.xls: RPKM values for each transcript +2. output.rawCount.xls: Raw count for each transcript +3. output.saturation.r: R script to generate plot +4. output.saturation.pdf: + +.. image:: http://rseqc.sourceforge.net/_images/saturation.png + :height: 600 px + :width: 600 px + :scale: 80 % + +- All transcripts were sorted in ascending order according to expression level (RPKM). Then they are divided into 4 groups: + 1. Q1 (0-25%): Transcripts with expression level ranked below 25 percentile. + 2. Q2 (25-50%): Transcripts with expression level ranked between 25 percentile and 50 percentile. + 3. Q3 (50-75%): Transcripts with expression level ranked between 50 percentile and 75 percentile. + 4. Q4 (75-100%): Transcripts with expression level ranked above 75 percentile. +- BAM/SAM file containing more than 100 million alignments will make module very slow. +- Follow example below to visualize a particular transcript (using R console):: + + pdf("xxx.pdf") #starts the graphics device driver for producing PDF graphics + x <- seq(5,100,5) #resampling percentage (5,10,15,...,100) + rpkm <- c(32.95,35.43,35.15,36.04,36.41,37.76,38.96,38.62,37.81,38.14,37.97,38.58,38.59,38.54,38.67, 38.67,38.87,38.68, 38.42, 38.23) #Paste RPKM values calculated from each subsets + scatter.smooth(x,100*abs(rpkm-rpkm[length(rpkm)])/(rpkm[length(rpkm)]),type="p",ylab="Precent Relative Error",xlab="Resampling Percentage") + dev.off() #close graphical device + +.. image:: http://rseqc.sourceforge.net/_images/saturation_eg.png + :height: 600 px + :width: 600 px + :scale: 80 % + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bam2wig.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,153 @@ +<tool id="rseqc_bam2wig" name="BAM to Wiggle" version="1.1"> + <description> + converts all types of RNA-seq data from .bam to .wig + </description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + tmp_input_name=\$(mktemp -u); + bai='.bai'; + + ln -s "${input}" \$tmp_input_name && + ln -s "${input.metadata.bam_index}" \$tmp_input_name\$bai && + bam2wig.py -i \$tmp_input_name -s $chromsize -o outfile + + #if str($strand_type.strand_specific) == "pair" + -d + #if str($strand_type.pair_type) == "sd" + '1++,1--,2+-,2-+' + #else + '1+-,1-+,2++,2--' + #end if + #end if + + #if str($strand_type.strand_specific) == "single" + -d + #if str($strand_type.single_type) == "s" + '++,--' + #else + '+-,-+' + #end if + #end if + + #if $wigsum.wigsum_type + -t $wigsum.totalwig + #end if + + #if $skipmultihits + -u + #end if + ; + rm "\$tmp_input_name\$bai"; + rm \$tmp_input_name + </command> + <inputs> + <param name="input" type="data" label="Input .bam File" format="bam" /> + <param name="chromsize" type="data" label="Chromosome size file (tab or space separated)" format="txt,tabular" /> + <param name="skipmultihits" type="boolean" label="Skip Multiple Hit Reads/Only Use Uniquely Mapped Reads" value="false" /> + <conditional name="wigsum"> + <param name="wigsum_type" type="boolean" label="Specify wigsum?" value="false"> + </param> + <when value="true"> + <param name="totalwig" value="0" type="integer" label="specified wigsum" /> + </when> + <when value="false"/> + </conditional> + <conditional name="strand_type"> + <param name="strand_specific" type="select" label="Strand-specific?" value="none"> + <option value="none">none</option> + <option value="pair">Pair-End RNA-seq</option> + <option value="single">Single-End RNA-seq</option> + </param> + <when value="pair"> + <param name="pair_type" type="select" display="radio" label="Pair-End Read Type (format: mapped --> parent)" value="sd"> + <option value="sd"> read1 (positive --> positive; negative --> negative), read2 (positive --> negative; negative --> positive)</option> + <option value="ds">read1 (positive --> negative; negative --> positive), read2 (positive --> positive; negative --> negative)</option> + </param> + </when> + <when value="single"> + <param name="single_type" type="select" display="radio" label="Single-End Read Type (format: mapped --> parent)" value="s"> + <option value="s">positive --> positive; negative --> negative</option> + <option value="d">positive --> negative; negative --> positive</option> + </param> + </when> + <when value="none"></when> + </conditional> + </inputs> + <outputs> + <data format="wig" name="output" from_work_dir="outfile.wig"> + <filter>strand_type['strand_specific'] == 'none'</filter> + </data> + <data format="wig" name="outputfwd" from_work_dir="outfile_Forward.wig" label="${tool.name} on ${on_string} (Forward Reads)"> + <filter>strand_type['strand_specific'] != 'none'</filter> + </data> + <data format="wig" name="outputrv" from_work_dir="outfile_Reverse.wig" label="${tool.name} on ${on_string} (Reverse Reads)"> + <filter>strand_type['strand_specific'] != 'none'</filter> + </data> + </outputs> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <help> +bam2wig.py +++++++++++ + +Visualization is the most straightforward and effective way to QC your RNA-seq +data. For example, change of expression or new splicing can be easily checked +by visually comparing two RNA-seq tracks using genome browser such as UCSC_, +IGB_ and IGV_. `bam2wig.py` converts all types of RNA-seq data from BAM_ +format into wiggle_ format in one-stop. wiggle_ files can then be easily +converted into bigwig_. Bigwig is indexed, binary format of wiggle file, and +it's particular useful to display large, continuous dataset on genome +browser. + +Inputs +++++++++++++++ + +Input BAM file + Alignment file in BAM format (SAM is not supported). BAM file will be sorted and indexed using samTools. + +Chromosome size file + Tab or space separated text file with 2 columns: first column is chromosome name, second column is size of the chromosome. Chromosome names (such as "chr1") should be consistent between this file and BAM file. + +Specified wigsum (default=none) + Specified wigsum. Wigsum of 100000000 equals to coverage achieved by 1 million 100nt reads. Ignore this option to disable normalization. + +Skip multiple Hit reads + skips multiple hit reads or only use uniquely mapped reads + +Strand-specific (default=none) + How read(s) were stranded during sequencing. If you are not sure about the strand rule, run infer_experiment.py + +Outputs +++++++++++++++ + +If RNA-seq is not strand specific, one wig file will be generated, if RNA-seq +is strand specific, two wig files corresponding to Forward and Reverse will be generated. + +----- + +About RSeQC ++++++++++++ + + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ +.. _UCSC: http://genome.ucsc.edu/index.html +.. _IGB: http://bioviz.org/igb/ +.. _IGV: http://www.broadinstitute.org/igv/home +.. _BAM: http://genome.ucsc.edu/goldenPath/help/bam.html +.. _wiggle: http://genome.ucsc.edu/goldenPath/help/wiggle.html +.. _bigwig: http://genome.ucsc.edu/FAQ/FAQformat.html#format6.1 + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bam_stat.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,65 @@ +<tool id="rseqc_bam_stat" name="BAM/SAM Mapping Stats" version="1.1"> + <description> + reads mapping statistics for a provided BAM or SAM file. + </description> + <requirements> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements>s + <command> + bam_stat.py -i $input -q $mapqual 2> $output + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" label="Input .bam/.sam File" format="bam,sam" /> + <param label="Minimum mapping quality (default=30" type="integer" value="30" name="mapqual" /> + </inputs> + <outputs> + <data format="txt" name="output" /> + </outputs> + <help> +bam_stat.py ++++++++++++ + +This program is used to calculate reads mapping statistics from provided BAM +file. This script determines "uniquely mapped reads" from `mapping quality`_, +which quality the probability that a read is misplaced (Do NOT confused with +sequence quality, sequence quality measures the probability that a base-calling +was wrong) . + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Minimum mapping quality + Minimum mapping quality for an alignment to be called “uniquely mapped” (default=30) + +Output +++++++++++++++ + +- Total Reads (Total records) = {Multiple mapped reads} + {Uniquely mapped} +- Uniquely mapped Reads = {read-1} + {read-2} (if paired end) +- Uniquely mapped Reads = {Reads map to '+'} + {Reads map to '-'} +- Uniquely mapped Reads = {Splice reads} + {Non-splice reads} + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ +.. _`mapping quality`: http://genome.sph.umich.edu/wiki/Mapping_Quality_Scores + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/clipping_profile.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,61 @@ +<tool id="rseqc_clipping_profile" name="Clipping Profile" version="1.1"> + <description> + estimates clipping profile of RNA-seq reads from BAM or SAM file + </description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + clipping_profile.py -i $input -o output + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" label="Input .bam/.sam File" format="bam,sam" /> + </inputs> + <outputs> + <data format="xls" name="outputxls" from_work_dir="output.clipping_profile.xls" /> + <data format="txt" name="outputr" from_work_dir="output.clipping_profile.r" /> + </outputs> + <help> +clipping_profile.py ++++++++++++++++++++ + +This program is used to estimate clipping profile of RNA-seq reads from BAM or SAM file. +Note that to use this funciton, CIGAR strings within SAM/BAM file should have 'S' operation +(This means your reads aligner should support clipped mapping). + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + + +Sample Output +++++++++++++++ + +.. image:: http://rseqc.sourceforge.net/_images/clipping_good.png + :height: 600 px + :width: 600 px + :scale: 80 % + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + </help> +</tool>
--- a/fastx_barcode_splitter.pl Thu Nov 07 16:44:53 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,583 +0,0 @@ -#!/usr/bin/perl - -# FASTX-toolkit - FASTA/FASTQ preprocessing tools. -# Copyright (C) 2009 A. Gordon (gordon@cshl.edu) -# -# Lance Parsons (lparsons@princeton.edu) -# 3/21/2011 - Modified to accept separate index file for barcodes -# 4/6/2011 - Modified to cleanup bad barcode identifiers (esp. useful for Galaxy) -# -# This program is free software: you can redistribute it and/or modify -# it under the terms of the GNU Affero General Public License as -# published by the Free Software Foundation, either version 3 of the -# License, or (at your option) any later version. -# -# This program is distributed in the hope that it will be useful, -# but WITHOUT ANY WARRANTY; without even the implied warranty of -# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the -# GNU Affero General Public License for more details. -# -# You should have received a copy of the GNU Affero General Public License -# along with this program. If not, see <http://www.gnu.org/licenses/>. - -use strict; -use warnings; -use IO::Handle; -use Data::Dumper; -use Getopt::Long; -use Carp; - -## -## This program splits a FASTQ/FASTA file into several smaller files, -## Based on barcode matching. -## -## run with "--help" for usage information -## -## Assaf Gordon <gordon@cshl.edu> , 11sep2008 - -# Forward declarations -sub load_barcode_file ($); -sub parse_command_line ; -sub match_sequences ; -sub mismatch_count($$) ; -sub print_results; -sub open_and_detect_input_format; -sub open_index_and_detect_input_format($); -sub read_index_record; -sub read_record; -sub write_record($); -sub usage(); - -# Global flags and arguments, -# Set by command line argumens -my $barcode_file ; -my $barcodes_at_eol = 0 ; -my $barcodes_at_bol = 0 ; -my $index_read_file ; -my $exact_match = 0 ; -my $allow_partial_overlap = 0; -my $allowed_mismatches = 1; -my $newfile_suffix = ''; -my $newfile_prefix ; -my $quiet = 0 ; -my $debug = 0 ; -my $fastq_format = 1; -my $index_fastq_format = 1; -my $read_id_check_strip_characters = 1; - -# Global variables -# Populated by 'create_output_files' -my %filenames; -my %files; -my %counts = ( 'unmatched' => 0 ); -my $barcodes_length; -my @barcodes; -my $input_file_io; - - -# The Four lines per record in FASTQ format. -# (when using FASTA format, only the first two are used) -my $seq_name; -my $seq_bases; -my $seq_name2; -my $seq_qualities; - -# Values used for index read file -my $index_seq_name; -my $index_seq_bases; -my $index_seq_name2; -my $index_seq_qualities; - - - -# -# Start of Program -# -parse_command_line ; - -load_barcode_file ( $barcode_file ) ; - -open_and_detect_input_format; - -if (defined $index_read_file) {open_index_and_detect_input_format ( $index_read_file );} - -match_sequences ; - -print_results unless $quiet; - -# -# End of program -# - - - - - - - - -sub parse_command_line { - my $help; - - usage() if (scalar @ARGV==0); - - my $result = GetOptions ( "bcfile=s" => \$barcode_file, - "eol" => \$barcodes_at_eol, - "bol" => \$barcodes_at_bol, - "idxfile=s" => \$index_read_file, - "idxidstrip=i" => \$read_id_check_strip_characters, - "exact" => \$exact_match, - "prefix=s" => \$newfile_prefix, - "suffix=s" => \$newfile_suffix, - "quiet" => \$quiet, - "partial=i" => \$allow_partial_overlap, - "debug" => \$debug, - "mismatches=i" => \$allowed_mismatches, - "help" => \$help - ) ; - - usage() if ($help); - - die "Error: barcode file not specified (use '--bcfile [FILENAME]')\n" unless defined $barcode_file; - die "Error: prefix path/filename not specified (use '--prefix [PATH]')\n" unless defined $newfile_prefix; - - if (! defined $index_read_file) { - if ($barcodes_at_bol == $barcodes_at_eol) { - die "Error: can't specify both --eol & --bol\n" if $barcodes_at_eol; - die "Error: must specify either --eol or --bol or --idxfile\n" ; - } - } - elsif ($barcodes_at_bol || $barcodes_at_eol) { - die "Error: Must specify only one of --idxfile, --eol, or --bol"; - } - - die "Error: invalid for value partial matches (valid values are 0 or greater)\n" if $allow_partial_overlap<0; - - $allowed_mismatches = 0 if $exact_match; - - die "Error: invalid value for mismatches (valid values are 0 or more)\n" if ($allowed_mismatches<0); - - die "Error: partial overlap value ($allow_partial_overlap) bigger than " . - "max. allowed mismatches ($allowed_mismatches)\n" if ($allow_partial_overlap > $allowed_mismatches); - - - exit unless $result; -} - - - -# -# Read the barcode file -# -sub load_barcode_file ($) { - my $filename = shift or croak "Missing barcode file name"; - - open BCFILE,"<$filename" or die "Error: failed to open barcode file ($filename)\n"; - while (<BCFILE>) { - next if m/^#/; - chomp; - my ($ident, $barcode) = split('\t') ; - - $barcode = uc($barcode); - - # Sanity checks on the barcodes - die "Error: bad data at barcode file ($filename) line $.\n" unless defined $barcode; - die "Error: bad barcode value ($barcode) at barcode file ($filename) line $.\n" - unless $barcode =~ m/^[AGCT]+$/; - - # Cleanup Identifiers (only allow alphanumeric, replace others with dash '-') - $ident =~ s/[^A-Za-z0-9]/-/g; - die "Error: bad identifier value ($ident) at barcode file ($filename) line $. (must be alphanumeric)\n" - unless $ident =~ m/^[A-Za-z0-9-]+$/; - - die "Error: badcode($ident, $barcode) is shorter or equal to maximum number of " . - "mismatches ($allowed_mismatches). This makes no sense. Specify fewer mismatches.\n" - if length($barcode)<=$allowed_mismatches; - - $barcodes_length = length($barcode) unless defined $barcodes_length; - die "Error: found barcodes in different lengths. this feature is not supported yet.\n" - unless $barcodes_length == length($barcode); - - push @barcodes, [$ident, $barcode]; - - if ($allow_partial_overlap>0) { - foreach my $i (1 .. $allow_partial_overlap) { - substr $barcode, ($barcodes_at_bol)?0:-1, 1, ''; - push @barcodes, [$ident, $barcode]; - } - } - } - close BCFILE; - - if ($debug) { - print STDERR "barcode\tsequence\n"; - foreach my $barcoderef (@barcodes) { - my ($ident, $seq) = @{$barcoderef}; - print STDERR $ident,"\t", $seq ,"\n"; - } - } -} - -# Create one output file for each barcode. -# (Also create a file for the dummy 'unmatched' barcode) -sub create_output_files { - my %barcodes = map { $_->[0] => 1 } @barcodes; #generate a uniq list of barcode identifiers; - $barcodes{'unmatched'} = 1 ; - - foreach my $ident (keys %barcodes) { - my $new_filename = $newfile_prefix . $ident . $newfile_suffix; - $filenames{$ident} = $new_filename; - open my $file, ">$new_filename" or die "Error: failed to create output file ($new_filename)\n"; - $files{$ident} = $file ; - } -} - -sub match_sequences { - - my %barcodes = map { $_->[0] => 1 } @barcodes; #generate a uniq list of barcode identifiers; - $barcodes{'unmatched'} = 1 ; - - #reset counters - foreach my $ident ( keys %barcodes ) { - $counts{$ident} = 0; - } - - create_output_files; - - # Read file FASTQ file - # split accotding to barcodes - while ( read_record ) { - chomp $seq_name; - chomp $seq_bases; - if (defined $index_read_file) { - read_index_record() or die "Error: Unable to read index sequence for sequence name ($seq_name), check to make sure the file lengths match.\n"; - chomp $index_seq_name; - chomp $index_seq_bases; - - # Assert that the read ids match - my $seq_name_match = &strip_read_id($seq_name); - my $index_seq_name_match = &strip_read_id($index_seq_name); - if ($seq_name_match ne $index_seq_name_match) { - die "Error: Index sequence name ($index_seq_name) does not match sequence name ($seq_name)\n"; - } - - } - - print STDERR "sequence $seq_bases: \n" if $debug; - - my $best_barcode_mismatches_count = $barcodes_length; - my $best_barcode_ident = undef; - - #Try all barcodes, find the one with the lowest mismatch count - foreach my $barcoderef (@barcodes) { - my ($ident, $barcode) = @{$barcoderef}; - - # Get DNA fragment (in the length of the barcodes) - # The barcode will be tested only against this fragment - # (no point in testing the barcode against the whole sequence) - my $sequence_fragment; - if ($barcodes_at_bol) { - $sequence_fragment = substr $seq_bases, 0, $barcodes_length; - } elsif ($barcodes_at_eol) { - $sequence_fragment = substr $seq_bases, - $barcodes_length; - } else { - $sequence_fragment = substr $index_seq_bases, 0, $barcodes_length; - } - - my $mm = mismatch_count($sequence_fragment, $barcode) ; - - # if this is a partial match, add the non-overlap as a mismatch - # (partial barcodes are shorter than the length of the original barcodes) - $mm += ($barcodes_length - length($barcode)); - - if ( $mm < $best_barcode_mismatches_count ) { - $best_barcode_mismatches_count = $mm ; - $best_barcode_ident = $ident ; - } - } - - $best_barcode_ident = 'unmatched' - if ( (!defined $best_barcode_ident) || $best_barcode_mismatches_count>$allowed_mismatches) ; - - print STDERR "sequence $seq_bases matched barcode: $best_barcode_ident\n" if $debug; - - $counts{$best_barcode_ident}++; - - #get the file associated with the matched barcode. - #(note: there's also a file associated with 'unmatched' barcode) - my $file = $files{$best_barcode_ident}; - - write_record($file); - } -} - -# Strip end of readids when matching to avoid mismatch between read 1, 2, 3, etc. -sub strip_read_id { - my $read_id = shift; - my $stripped_read_id = $read_id; - if ($read_id_check_strip_characters) { - if ($read_id =~ /@([a-zA-Z0-9_-]+):([0-9]+):([a-zA-Z0-9]+):([0-9]+):([0-9]+):([0-9]+):([0-9]+) ([0-9]+):([YN]):([0-9]+):([ACGT]+){0,1}/) { # CASAVA 1.8+ - my @parts = split(/ /,$read_id); - $stripped_read_id = $parts[0]; - } else { # CASAVA 1.7 and earlier - $stripped_read_id = substr($read_id, 0, length($read_id)-$read_id_check_strip_characters); - } - } - return $stripped_read_id; -} - - -#Quickly calculate hamming distance between two strings -# -#NOTE: Strings must be same length. -# returns number of different characters. -#see http://www.perlmonks.org/?node_id=500235 -sub mismatch_count($$) { length( $_[ 0 ] ) - ( ( $_[ 0 ] ^ $_[ 1 ] ) =~ tr[\0][\0] ) } - - - -sub print_results -{ - print "Barcode\tCount\tLocation\n"; - my $total = 0 ; - foreach my $ident (sort keys %counts) { - print $ident, "\t", $counts{$ident},"\t",$filenames{$ident},"\n"; - $total += $counts{$ident}; - } - print "total\t",$total,"\n"; -} - - -sub read_record -{ - $seq_name = $input_file_io->getline(); - - return undef unless defined $seq_name; # End of file? - - $seq_bases = $input_file_io->getline(); - die "Error: bad input file, expecting line with sequences\n" unless defined $seq_bases; - - # If using FASTQ format, read two more lines - if ($fastq_format) { - $seq_name2 = $input_file_io->getline(); - die "Error: bad input file, expecting line with sequence name2\n" unless defined $seq_name2; - - $seq_qualities = $input_file_io->getline(); - die "Error: bad input file, expecting line with quality scores\n" unless defined $seq_qualities; - } - return 1; -} - -sub write_record($) -{ - my $file = shift; - - croak "Bad file handle" unless defined $file; - - print $file $seq_name,"\n"; - print $file $seq_bases,"\n"; - - #if using FASTQ format, write two more lines - if ($fastq_format) { - print $file $seq_name2; - print $file $seq_qualities; - } -} - -sub open_and_detect_input_format -{ - $input_file_io = new IO::Handle; - die "Failed to open STDIN " unless $input_file_io->fdopen(fileno(STDIN),"r"); - - # Get the first characeter, and push it back - my $first_char = $input_file_io->getc(); - $input_file_io->ungetc(ord $first_char); - - if ($first_char eq '>') { - # FASTA format - $fastq_format = 0 ; - print STDERR "Detected FASTA format\n" if $debug; - } elsif ($first_char eq '@') { - # FASTQ format - $fastq_format = 1; - print STDERR "Detected FASTQ format\n" if $debug; - } else { - die "Error: unknown file format. First character = '$first_char' (expecting > or \@)\n"; - } -} - - -sub open_index_and_detect_input_format($) { - my $filename = shift or croak "Missing index read file name"; - - open IDXFILE,"<$filename" or die "Error: failed to open index read file ($filename)\n"; - - # Get the first line, and reset file pointer - my $first_line = <IDXFILE>; - my $first_char = substr($first_line, 0, 1); - seek(IDXFILE, 0, 0); - - if ($first_char eq '>') { - # FASTA format - $index_fastq_format = 0 ; - print STDERR "Detected FASTA format for index file\n" if $debug; - } elsif ($first_char eq '@') { - # FASTQ format - $index_fastq_format = 1; - print STDERR "Detected FASTQ format for index file\n" if $debug; - } else { - die "Error: unknown index file format. First character = '$first_char' (expecting > or \@)\n"; - } -} - -sub read_index_record -{ - $index_seq_name = <IDXFILE>; - - return undef unless defined $index_seq_name; # End of file? - - $index_seq_bases = <IDXFILE>; - die "Error: bad input file, expecting line with sequences\n" unless defined $index_seq_bases; - - # If using FASTQ format, read two more lines - if ($index_fastq_format) { - $index_seq_name2 = <IDXFILE>; - die "Error: bad input file, expecting line with sequence name2\n" unless defined $index_seq_name2; - - $index_seq_qualities = <IDXFILE>; - die "Error: bad input file, expecting line with quality scores\n" unless defined $index_seq_qualities; - } - return 1; -} - -sub usage() -{ - print<<EOF; -Barcode Splitter, by Assaf Gordon (gordon\@cshl.edu), 11sep2008 - -This program reads FASTA/FASTQ file and splits it into several smaller files, -Based on barcode matching. -FASTA/FASTQ data is read from STDIN (format is auto-detected.) -Output files will be writen to disk. -Summary will be printed to STDOUT. - -usage: $0 --bcfile FILE --prefix PREFIX [--suffix SUFFIX] [--bol|--eol|--idxfile] - [--mismatches N] [--exact] [--partial N] [--idxidstrip N] - [--help] [--quiet] [--debug] - -Arguments: - ---bcfile FILE - Barcodes file name. (see explanation below.) ---prefix PREFIX - File prefix. will be added to the output files. Can be used - to specify output directories. ---suffix SUFFIX - File suffix (optional). Can be used to specify file - extensions. ---bol - Try to match barcodes at the BEGINNING of sequences. - (What biologists would call the 5' end, and programmers - would call index 0.) ---eol - Try to match barcodes at the END of sequences. - (What biologists would call the 3' end, and programmers - would call the end of the string.) ---idxfile FILE - Read barcodes from separate index file (fasta or fastq) - NOTE: one of --bol, --eol, --idxfile must be specified, - but not more than one. ---idxidstrip N - When using index file, strip this number of characters - from the end of the sequence id before matching. - Automatically detects CASAVA 1.8 format and strips at a - space in the id, use 0 to disable this. - (Default is 1). ---mismatches N - Max. number of mismatches allowed. default is 1. ---exact - Same as '--mismatches 0'. If both --exact and --mismatches - are specified, '--exact' takes precedence. ---partial N - Allow partial overlap of barcodes. (see explanation below.) - (Default is not partial matching) ---quiet - Don't print counts and summary at the end of the run. - (Default is to print.) ---debug - Print lots of useless debug information to STDERR. ---help - This helpful help screen. - -Example (Assuming 's_2_100.txt' is a FASTQ file, 'mybarcodes.txt' is -the barcodes file): - - \$ cat s_2_100.txt | $0 --bcfile mybarcodes.txt --bol --mismatches 2 \\ - --prefix /tmp/bla_ --suffix ".txt" - -Barcode file format -------------------- -Barcode files are simple text files. Each line should contain an identifier -(descriptive name for the barcode), and the barcode itself (A/C/G/T), -separated by a TAB character. Example: - - #This line is a comment (starts with a 'number' sign) - BC1 GATCT - BC2 ATCGT - BC3 GTGAT - BC4 TGTCT - -For each barcode, a new FASTQ file will be created (with the barcode's -identifier as part of the file name). Sequences matching the barcode -will be stored in the appropriate file. - -Running the above example (assuming "mybarcodes.txt" contains the above -barcodes), will create the following files: - /tmp/bla_BC1.txt - /tmp/bla_BC2.txt - /tmp/bla_BC3.txt - /tmp/bla_BC4.txt - /tmp/bla_unmatched.txt -The 'unmatched' file will contain all sequences that didn't match any barcode. - -Barcode matching ----------------- - -** Without partial matching: - -Count mismatches between the FASTA/Q sequences and the barcodes. -The barcode which matched with the lowest mismatches count (providing the -count is small or equal to '--mismatches N') 'gets' the sequences. - -Example (using the above barcodes): -Input Sequence: -GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG - -Matching with '--bol --mismatches 1': -GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG -GATCT (1 mismatch, BC1) -ATCGT (4 mismatches, BC2) -GTGAT (3 mismatches, BC3) -TGTCT (3 mismatches, BC4) - -This sequence will be classified as 'BC1' (it has the lowest mismatch count). -If '--exact' or '--mismatches 0' were specified, this sequence would be -classified as 'unmatched' (because, although BC1 had the lowest mismatch count, -it is above the maximum allowed mismatches). - -Matching with '--eol' (end of line) does the same, but from the other side -of the sequence. - -** With partial matching (very similar to indels): - -Same as above, with the following addition: barcodes are also checked for -partial overlap (number of allowed non-overlapping bases is '--partial N'). - -Example: -Input sequence is ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG -(Same as above, but note the missing 'G' at the beginning.) - -Matching (without partial overlapping) against BC1 yields 4 mismatches: -ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG -GATCT (4 mismatches) - -Partial overlapping would also try the following match: --ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG -GATCT (1 mismatch) - -Note: scoring counts a missing base as a mismatch, so the final -mismatch count is 2 (1 'real' mismatch, 1 'missing base' mismatch). -If running with '--mismatches 2' (meaning allowing upto 2 mismatches) - this -seqeunce will be classified as BC1. - -EOF - -exit 1; -}
--- a/fastx_barcode_splitter.xml Thu Nov 07 16:44:53 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,92 +0,0 @@ -<tool id="cshl_princeton_fastx_barcode_splitter" version="1.1" name="Barcode Splitter" force_history_refresh="True"> - <description></description> - <command interpreter="bash"> - fastx_barcode_splitter_galaxy_wrapper.sh $BARCODE $input "primary_$output.id" "$output.files_path" $input.extension --mismatches $mismatches --partial $partial - #if $refBarcodeLocation.barcodeLocation == "idxfile": - --idxfile $refBarcodeLocation.idxfile - #else: - $refBarcodeLocation.EOL - #end if - > $output - </command> - - <inputs> - <param format="txt" version="1.1" name="BARCODE" type="data" label="Barcodes to use" /> - <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" version="1.1" name="input" type="data" label="Library to split" /> - - <conditional name="refBarcodeLocation"> - <param version="1.1" name="barcodeLocation" type="select" label="Barcodes found at"> - <option value="bol">Start of sequence (5' end)</option> - <option value="eol">End of sequence (3' end)</option> - <option value="idxfile">Separate index file</option> - </param> - <when value="bol"> - <param version="1.1" name="EOL" type="hidden" value="--bol" /> - </when> - <when value="eol"> - <param version="1.1" name="EOL" type="hidden" value="--eol" /> - </when> - <when value="idxfile"> - <param version="1.1" name="idxfile" type="data" format="fasta,fastq,fastqsanger" label="Select index read file" /> - </when> - </conditional> - - <param version="1.1" name="mismatches" type="integer" size="3" value="0" label="Number of allowed mismatches" /> - - <param version="1.1" name="partial" type="integer" size="3" value="0" label="Number of allowed barcodes nucleotide deletions" /> - - </inputs> - - <tests> - <test> - <!-- Split a FASTQ file --> - <param version="1.1" name="BARCODE" value="fastx_barcode_splitter1.txt" /> - <param version="1.1" name="input" value="fastx_barcode_splitter1.fastq" ftype="fastqsolexa" /> - <param version="1.1" name="EOL" value="Start of sequence (5' end)" /> - <param version="1.1" name="mismatches" value="2" /> - <param version="1.1" name="partial" value="0" /> - <output version="1.1" name="output" file="fastx_barcode_splitter1.out" /> - </test> - </tests> - - <outputs> - <data version="1.1" format="html" name="output" /> - </outputs> -<help> - -**What it does** - -This tool splits a FASTQ or FASTA file into several files, using barcodes as the split criteria. - --------- - -**Barcode file Format** - -Barcode files are simple text files. -Each line should contain an identifier (descriptive name for the barcode), and the barcode itself (A/C/G/T), separated by a TAB character. -Example:: - - #This line is a comment (starts with a 'number' sign) - BC1 GATCT - BC2 ATCGT - BC3 GTGAT - BC4 TGTCT - -For each barcode, a new FASTQ file will be created (with the barcode's identifier as part of the file name). -Sequences matching the barcode will be stored in the appropriate file. - -One additional FASTQ file will be created (the 'unmatched' file), where sequences not matching any barcode will be stored. - -The output of this tool is an HTML file, displaying the split counts and the file names. -In addition, each fastq file produced will be loaded into the galaxy history automatically. - - ------- - -This tool is based on `FASTX-toolkit`__ by Assaf Gordon. - - .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - -</help> -<!-- FASTX-barcode-splitter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> -</tool>
--- a/fastx_barcode_splitter_galaxy_wrapper.sh Thu Nov 07 16:44:53 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,90 +0,0 @@ -#!/bin/bash - -# FASTX-toolkit - FASTA/FASTQ preprocessing tools. -# Copyright (C) 2009 A. Gordon (gordon@cshl.edu) -# -# This program is free software: you can redistribute it and/or modify -# it under the terms of the GNU Affero General Public License as -# published by the Free Software Foundation, either version 3 of the -# License, or (at your option) any later version. -# -# This program is distributed in the hope that it will be useful, -# but WITHOUT ANY WARRANTY; without even the implied warranty of -# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the -# GNU Affero General Public License for more details. -# -# You should have received a copy of the GNU Affero General Public License -# along with this program. If not, see <http://www.gnu.org/licenses/>. - -# Modified by Lance Parsons (lparsons@princeton.edu) -# 2011-03-15 Adapted to allow galaxy to determine filetype -# -#This is a shell script wrapper for 'fastx_barcode_splitter.pl' -# -# 1. Output files are saved at the dataset's files_path directory. -# -# 2. 'fastx_barcode_splitter.pl' outputs a textual table. -# This script turns it into pretty HTML with working URL -# (so lazy users can just click on the URLs and get their files) - -if [ "$1x" = "x" ]; then - echo "Usage: $0 [BARCODE FILE] [FASTQ FILE] [LIBRARY_NAME] [OUTPUT_PATH] [FILETYPE]" >&2 - exit 1 -fi - -BARCODE_FILE="$1" -FASTQ_FILE="$2" -LIBNAME="$3" -OUTPUT_PATH="$4" -FILETYPE="$5" -shift 5 -# The rest of the parameters are passed to the split program - -if [ "${OUTPUT_PATH}x" = "x" ]; then - echo "Usage: $0 [BARCODE FILE] [FASTQ FILE] [LIBRARY_NAME] [OUTPUT_PATH] [FILETYPE]" >&2 - exit 1 -fi - -#Sanitize library name, make sure we can create a file with this name -LIBNAME=${LIBNAME%.gz} -LIBNAME=${LIBNAME%.txt} -LIBNAME=$(echo "$LIBNAME" | tr -cd '[:alnum:]_') - -if [ ! -r "$FASTQ_FILE" ]; then - echo "Error: Input file ($FASTQ_FILE) not found!" >&2 - exit 1 -fi -if [ ! -r "$BARCODE_FILE" ]; then - echo "Error: barcode file ($BARCODE_FILE) not found!" >&2 - exit 1 -fi -mkdir -p "$OUTPUT_PATH" -if [ ! -d "$OUTPUT_PATH" ]; then - echo "Error: failed to create output path '$OUTPUT_PATH'" >&2 - exit 1 -fi - -PUBLICURL="" -BASEPATH="$OUTPUT_PATH/" -#PREFIX="$BASEPATH"`date "+%Y-%m-%d_%H%M__"`"${LIBNAME}__" -PREFIX="$BASEPATH""${LIBNAME}_" -SUFFIX="_visible_$FILETYPE" -DIRECTORY=$(cd `dirname $0` && pwd) - -RESULTS=`gzip -cdf "$FASTQ_FILE" | $DIRECTORY/fastx_barcode_splitter.pl --bcfile "$BARCODE_FILE" --prefix "$PREFIX" --suffix "$SUFFIX" "$@"` -if [ $? != 0 ]; then - echo "error" -fi - -# -# Convert the textual tab-separated table into simple HTML table, -# with the local path replaces with a valid URL -#HTMLSUMMARY=${PREFIX}stats_visible_html -echo "<html><body><table border=1>" -echo "$RESULTS" | sed -r "s|$BASEPATH(.*)|\\1|" | sed ' -i<tr><td> -s|\t|</td><td>|g -a<\/td><\/tr> -' -echo "<p>" -echo "</table></body></html>"
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/geneBody_coverage.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,76 @@ +<tool id="rseqc_geneBody_coverage" name="Gene Body Converage (BAM)" version="1.1"> + <description> + Read coverage over gene body. + </description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + geneBody_coverage.py -i $input -r $refgene -o output + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" label="Input .bam file" format="bam" /> + <param name="refgene" type="data" label="Reference Genome" format="bed" /> + </inputs> + <outputs> + <data name="outputpdf" format="pdf" from_work_dir="output.geneBodyCoverage.pdf" label="${tool.name} on ${on_string} (PDF)" /> + <data name="outputr" format="txt" from_work_dir="output.geneBodyCoverage_plot.r" label="${tool.name} on ${on_string} (R Script)" /> + <data name="outputtxt" format="txt" from_work_dir="output.geneBodyCoverage.txt" label="${tool.name} on ${on_string} (Text)" /> + </outputs> + <help> +geneBody_coverage.py +++++++++++++++++++++ + +Read coverage over gene body. This module is used to check if reads coverage is uniform and +if there is any 5\'/3\' bias. This module scales all transcripts to 100 nt and calculates the +number of reads covering each nucleotide position. Finally, it generates a plot illustrating +the coverage profile along the gene body. NOTE: this module requires lots of memory for large +BAM files, because it load the entire BAM file into memory. We add another script +"geneBody_coverage2.py" into v2.3.1 which takes bigwig (instead of BAM) as input. +It only use 200M RAM, but users need to convert BAM into WIG, and then WIG into BigWig. + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene Model in BED format. + + +Outputs +++++++++++++++ + +Read coverage over gene body. This module is used to check if reads coverage is uniform and if there is any 5’/3’ bias. This module scales all transcripts to 100 nt and calculates the number of reads covering each nucleotide position. Finally, it generates a plot illustrating the coverage profile along the gene body. NOTE: this module requires lots of memory for large BAM files, because it load the entire BAM file into memory. We add another script "geneBody_coverage2.py" into v2.3.1 which takes bigwig (instead of BAM) as input. It only use 200M RAM, but users need to convert BAM into WIG, and then WIG into BigWig. + +Example output: + .. image:: http://rseqc.sourceforge.net/_images/geneBody_coverage.png + :height: 600 px + :width: 600 px + :scale: 80 % + + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/geneBody_coverage2.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,71 @@ +<tool id="rseqc_geneBody_coverage2" name="Gene Body Converage (Bigwig)" version="1.1"> + <description> + Read coverage over gene body + </description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + geneBody_coverage2.py -i $input -r $refgene -o output + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" label="Input bigwig file" format="bigwig" /> + <param name="refgene" type="data" label="Reference Genome" format="bed" /> + </inputs> + <outputs> + <data name="outputpdf" format="pdf" from_work_dir="output.geneBodyCoverage.pdf" label="${tool.name} on ${on_string} (PDF)" /> + <data name="outputr" format="txt" from_work_dir="output.geneBodyCoverage_plot.r" label="${tool.name} on ${on_string} (R Script)" /> + <data name="outputtxt" format="txt" from_work_dir="output.geneBodyCoverage.txt" label="${tool.name} on ${on_string} (Text)" /> + </outputs> + <help> +geneBody_coverage2.py ++++++++++++++++++++++ + +Similar to geneBody_coverage.py. This module takes bigwig instead of BAM as input, and thus +requires much less memory. The BigWig file could be arbitrarily large. + + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene Model in BED format. + + +Outputs +++++++++++++++ + +Read coverage over gene body. This module is used to check if reads coverage is uniform and if there is any 5’/3’ bias. This module scales all transcripts to 100 nt and calculates the number of reads covering each nucleotide position. Finally, it generates a plot illustrating the coverage profile along the gene body. NOTE: this module requires lots of memory for large BAM files, because it load the entire BAM file into memory. We add another script "geneBody_coverage2.py" into v2.3.1 which takes bigwig (instead of BAM) as input. It only use 200M RAM, but users need to convert BAM into WIG, and then WIG into BigWig. + +Example output: + .. image:: http://dldcc-web.brc.bcm.edu/lilab/liguow/RSeQC/figure/geneBody_coverage.png + :height: 600 px + :width: 600 px + :scale: 80 % + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/infer_experiment.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,141 @@ +<tool id="rseqc_infer_experiment" name="Infer Experiment" version="1.1"> + <description>speculates how RNA-seq were configured</description> + <requirements> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + infer_experiment.py -i $input -r $refgene + #if $sample_size.boolean + -s $sample_size.size + #end if + + > $output + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="Input BAM/SAM file" /> + <param name="refgene" type="data" format="bed" label="Reference gene model in bed format" /> + <conditional name="sample_size"> + <param name="boolean" type="boolean" label="Modify usable sampled reads" value="false" /> + <when value="true"> + <param name="size" type="integer" label="Number of usable sampled reads (default = 200000)" value="200000" /> + </when> + </conditional> + </inputs> + <outputs> + <data format="txt" name="output" /> + </outputs> + <help> +infer_experiment.py ++++++++++++++++++++ + +This program is used to speculate how RNA-seq sequencing were configured, especially how +reads were stranded for strand-specific RNA-seq data, through comparing reads' mapping +information to the underneath gene model. + + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene model in BED format. + +Number of usable sampled reads (default=200000) + Number of usable reads sampled from SAM/BAM file. More reads will give more accurate estimation, but make program little slower. + +Outputs ++++++++ + +For pair-end RNA-seq, there are two different +ways to strand reads (such as Illumina ScriptSeq protocol): + +1. 1++,1--,2+-,2-+ + +* read1 mapped to '+' strand indicates parental gene on '+' strand +* read1 mapped to '-' strand indicates parental gene on '-' strand +* read2 mapped to '+' strand indicates parental gene on '-' strand +* read2 mapped to '-' strand indicates parental gene on '+' strand + +2. 1+-,1-+,2++,2-- + +* read1 mapped to '+' strand indicates parental gene on '-' strand +* read1 mapped to '-' strand indicates parental gene on '+' strand +* read2 mapped to '+' strand indicates parental gene on '+' strand +* read2 mapped to '-' strand indicates parental gene on '-' strand + +For single-end RNA-seq, there are also two different ways to strand reads: + +1. ++,-- + +* read mapped to '+' strand indicates parental gene on '+' strand +* read mapped to '-' strand indicates parental gene on '-' strand + +2. +-,-+ + +* read mapped to '+' strand indicates parental gene on '-' strand +* read mapped to '-' strand indicates parental gene on '+' strand + + +Example Output +++++++++++++++ + +**Example1** :: + + ========================================================= + This is PairEnd Data :: + + Fraction of reads explained by "1++,1--,2+-,2-+": 0.4992 + Fraction of reads explained by "1+-,1-+,2++,2--": 0.5008 + Fraction of reads explained by other combinations: 0.0000 + ========================================================= + +*Conclusion*: We can infer that this is NOT a strand specific because 50% of reads can be explained by "1++,1--,2+-,2-+", while the other 50% can be explained by "1+-,1-+,2++,2--". + +**Example2** :: + + ============================================================ + This is PairEnd Data + + Fraction of reads explained by "1++,1--,2+-,2-+": 0.9644 :: + Fraction of reads explained by "1+-,1-+,2++,2--": 0.0356 + Fraction of reads explained by other combinations: 0.0000 + ============================================================ + +*Conclusion*: We can infer that this is a strand-specific RNA-seq data. strandness of read1 is consistent with that of gene model, while strandness of read2 is opposite to the strand of reference gene model. + +**Example3** :: + + ========================================================= + This is SingleEnd Data :: + + Fraction of reads explained by "++,--": 0.9840 :: + Fraction of reads explained by "+-,-+": 0.0160 + Fraction of reads explained by other combinations: 0.0000 + ========================================================= + +*Conclusion*: This is single-end, strand specific RNA-seq data. Strandness of reads are concordant with strandness of reference gene. + + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/inner_distance.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,123 @@ +<tool id="rseqc_inner_distance" name="Inner Distance" version="1.1"> + <description>calculate the inner distance (or insert size) between two paired RNA reads</description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + inner_distance.py -i $input -o output -r $refgene + + #if $bounds.hasLowerBound + -l $bounds.lowerBound + #end if + + #if $bounds2.hasUpperBound + -u $bounds2.upperBound + #end if + + #if $steps.step + -s $steps.stepSize + #end if + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="input bam/sam file" /> + <param name="refgene" type="data" format="bed" label="reference gene model" /> + <conditional name="bounds"> + <param name="hasLowerBound" type="boolean" label="Specify lower bound" value="false"/> + <when value="true"> + <param name="lowerBound" type="integer" value="-250" label="Estimated Lower Bound (bp, default=-250)" /> + </when> + </conditional> + <conditional name="bounds2"> + <param name="hasUpperBound" type="boolean" label="Specify upper bound" value="false" /> + <when value="true"> + <param name="upperBound" type="integer" value="250" label="Estimated Upper Bound (bp, default=250)" /> + </when> + </conditional> + <conditional name="steps"> + <param name="step" type="boolean" label="Specify step size" value="false" /> + <when value="true"> + <param name="stepSize" type="integer" value="5" label="Step size (bp, default=5)" /> + </when> + </conditional> + </inputs> + <outputs> + <data format="txt" name="outputtxt" from_work_dir="output.inner_distance.txt" label="${tool.name} on ${on_string} (Text)"/> + <data format="txt" name="outputfreqtxt" from_work_dir="output.inner_distance_freq.txt" label="${tool.name} on ${on_string} (Freq Text)" /> + <data format="pdf" name="outputpdf" from_work_dir="output.inner_distance_plot.pdf" label="${tool.name} on ${on_string} (PDF)" /> + <data format="txt" name="outputr" from_work_dir="output.inner_distance_plot.r" label="${tool.name} on ${on_string} (R Script)" /> + </outputs> + <help> +inner_distance.py ++++++++++++++++++ + +This module is used to calculate the inner distance (or insert size) between two paired RNA +reads. The distance is the mRNA length between two paired fragments. We first determine the +genomic (DNA) size between two paired reads: D_size = read2_start - read1_end, then + +* if two paired reads map to the same exon: inner distance = D_size +* if two paired reads map to different exons:inner distance = D_size - intron_size +* if two paired reads map non-exonic region (such as intron and intergenic region): inner distance = D_size +* The inner_distance might be a negative value if two fragments were overlapped. + +NOTE: Not all read pairs were used to estimate the inner distance distribution. Those low +quality, PCR duplication, multiple mapped reads were skipped. + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene model in BED format. + +Estimated Upper/Lower Bounds (defaults=250 and -250) + Estimated upper/lower bounds of inner distance (bp). + +Step size (default=5) + Step size of histogram + + +Output +++++++++++++++ + +1. output.inner_distance.txt: + - first column is read ID + -second column is inner distance. Could be negative value if PE reads were overlapped or mapping error (e.g. Read1_start < Read2_start, while Read1_end >> Read2_end due to spliced mapping of read1) + - third column indicates how paired reads were mapped: PE_within_same_exon, PE_within_diff_exon,PE_reads_overlap +2. output..inner_distance_freq.txt: + - inner distance starts + - inner distance ends + - number of read pairs + - note the first 2 columns are left side half open interval +3. output.inner_distance_plot.r: R script to generate histogram +4. output.inner_distance_plot.pdf: histogram plot + +.. image:: http://rseqc.sourceforge.net/_images/inner_distance.png + :height: 600 px + :width: 600 px + :scale: 80 % + + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/junction_annotation.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,101 @@ +<tool id="rseqc_junction_annotation" name="Junction Annotation" version="1.1"> + <description>compares detected splice junctions to reference gene model</description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + junction_annotation.py + -i $input -o output -r $refgene + #if $intron.hasIntron + -m $intron.min_Intron + #end if + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="input bam/sam file" /> + <param name="refgene" type="data" format="bed" label="reference gene model" /> + <conditional name="intron"> + <param name="hasIntron" type="boolean" label="Specify minimum intron length" value="false"/> + <when value="true"> + <param name="min_Intron" type="integer" value="50" label="Minimum intron length (bp, default=50)" /> + </when> + </conditional> + </inputs> + <outputs> + <data format="xls" name="outputxls" from_work_dir="output.junction.xls" label="${tool.name} on ${on_string} (XLS)"/> + <data format="txt" name="outputr" from_work_dir="output.junction_plot.r" label="${tool.name} on ${on_string} (R Script)" /> + <data format="pdf" name="outputpdf" from_work_dir="output.splice_events.pdf" label="${tool.name} on ${on_string} (Splice Events PDF)"/> + <data format="pdf" name="outputjpdf" from_work_dir="output.splice_junction.pdf" label="${tool.name} on ${on_string} (Splice Junction PDF)" /> + </outputs> + <help> +junction_annotation.py +++++++++++++++++++++++ + +For a given alignment file (-i) in BAM or SAM format and a reference gene model (-r) in BED +format, this program will compare detected splice junctions to reference gene model. splicing +annotation is performed in two levels: splice event level and splice junction level. + +* splice event: An RNA read, especially long read, can be spliced 2 or more times, each time is called a splicing event; In this sense, 100 spliced reads can produce >= 100 splicing events. +* splice junction: multiple splicing events spanning the same intron can be consolidated into one splicing junction. + +All detected junctions can be grouped to 3 exclusive categories: + +1. Annotated: The junction is part of the gene model. Both splice sites, 5' splice site + (5'SS) and 3'splice site (3'SS) can be annotated by reference gene model. +2. complete_novel: Complete new junction. Neither of the two splice sites cannot be annotated by gene model +3. partial_novel: One of the splice site (5'SS or 3'SS) is new, while the other splice site is annotated (known) + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene model in BED format. + +Minimum intron length (default=50) + Minimum intron length (bp). + + +Output +++++++++++++++ + +1. output.junc.anno.junction.xls: + - chrom ID + - start position of junction (coordinate is 0 based) + - end position of junction (coordinate is 1 based) + - number of splice events supporting this junction + - 'annotated', 'complete_novel' or 'partial_novel'. +2. output.anno.junction_plot.r: R script to generate pie chart +3. output.splice_junction.pdf: plot of splice junctions +4. output.splice_events.pdf: plot of splice events + +.. image:: http://rseqc.sourceforge.net/_images/junction.png + :height: 400 px + :width: 850 px + :scale: 80 % + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/junction_saturation.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,99 @@ +<tool id="rseqc_junction_saturation" name="Junction Saturation" version="1.1"> + <description>detects splice junctions from each subset and compares them to reference gene model</description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> junction_saturation.py -i $input -o output -r $refgene -m $intronSize -v $minSplice + + #if $percentiles.specifyPercentiles + -l $percentiles.lowBound -u $percentiles.upBound -s $percentiles.percentileStep + #end if + + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="input bam/sam file" /> + <param name="refgene" type="data" format="bed" label="reference gene model" /> + <param name="intronSize" type="integer" label="Minimum intron size (bp, default=50)" value="50"/> + <param name="minSplice" type="integer" label="Minimum coverage (default=1)" value="1" /> + <conditional name="percentiles"> + <param name="specifyPercentiles" type="boolean" label="Specify sampling bounds and frequency" value="false"/> + <when value="true"> + <param name="lowBound" type="integer" value="5" label="Lower Bound Sampling Frequency (bp, default=5)" /> + <param name="upBound" type="integer" value="100" label="Upper Bound Sampling Frequency (bp, default=100)" /> + <param name="percentileStep" type="integer" value="5" label="Sampling increment (default=5)" /> + </when> + </conditional> + </inputs> + <outputs> + <data format="txt" name="outputr" from_work_dir="output.junctionSaturation_plot.r" label="${tool.name} on ${on_string} (R Script)"/> + <data format="pdf" name="outputpdf" from_work_dir="output.junctionSaturation_plot.pdf" label="${tool.name} on ${on_string} (PDF)"/> + </outputs> + <help> +junction_saturation.py +++++++++++++++++++++++ + +It's very important to check if current sequencing depth is deep enough to perform +alternative splicing analyses. For a well annotated organism, the number of expressed genes +in particular tissue is almost fixed so the number of splice junctions is also fixed. The fixed +splice junctions can be predetermined from reference gene model. All (annotated) splice +junctions should be rediscovered from a saturated RNA-seq data, otherwise, downstream +alternative splicing analysis is problematic because low abundance splice junctions are +missing. This module checks for saturation by resampling 5%, 10%, 15%, ..., 95% of total +alignments from BAM or SAM file, and then detects splice junctions from each subset and +compares them to reference gene model. + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene model in BED format. + +Sampling Percentiles - Upper Bound, Lower Bound, Sampling Increment (defaults= 100, 5, and 5) + Sampling starts from the Lower Bound and increments to the Upper Bound at the rate of the Sampling Increment. + +Minimum intron length (default=50) + Minimum intron length (bp). + +Minimum coverage (default=1) + Minimum number of supportting reads to call a junction. + +Output +++++++++++++++ + +1. output.junctionSaturation_plot.r: R script to generate plot +2. output.junctionSaturation_plot.pdf + +.. image:: http://rseqc.sourceforge.net/_images/junction_saturation.png + :height: 600 px + :width: 600 px + :scale: 80 % + +In this example, current sequencing depth is almost saturated for "known junction" (red line) detection because the number of "known junction" reaches a plateau. In other words, nearly all "known junctions" (expressed in this particular tissue) have already been detected, and continue sequencing will not detect additional "known junction" and will only increase junction coverage (i.e. junction covered by more reads). While current sequencing depth is not saturated for novel junctions (green). + + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/read_GC.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,61 @@ +<tool id="rseqc_read_GC" name="Read GC" version="1.1"> + <description>determines GC% and read count</description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + read_GC.py -i $input -o output + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="input bam/sam file" /> + </inputs> + <outputs> + <data format="xls" name="outputxls" from_work_dir="output.GC.xls" label="${tool.name} on ${on_string} (XLS)"/> + <data format="txt" name="outputr" from_work_dir="output.GC_plot.r" label="${tool.name} on ${on_string} (R Script)" /> + <data format="pdf" name="outputpdf" from_work_dir="output.GC_plot.pdf" label="${tool.name} on ${on_string} (PDF)" /> + </outputs> + <help> +read_GC.py +++++++++++ + + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Output +++++++++++++++ + +1. output.GC.xls: Two column, plain text file, first column is GC%, second column is read count +2. output.GC_plot.r: R script to generate pdf file. +3. output.GC_plot.pdf: graphical output generated from R script. + +.. image:: http://rseqc.sourceforge.net/_images/read_gc.png + :height: 600 px + :width: 600 px + :scale: 80 % + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/read_NVC.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,77 @@ +<tool id="rseqc_read_NVC" name="Read NVC" version="1.1"> + <description>to check the nucleotide composition bias</description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + read_NVC.py -i $input -o output $nx + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="input bam/sam file" /> + <param name="nx" type="boolean" value="false" truevalue="-x" falsevalue="" label="Include N,X in NVC plot"/> + </inputs> + <outputs> + <data format="xls" name="outputxls" from_work_dir="output.NVC.xls" label="${tool.name} on ${on_string} (XLS)" /> + <data format="txt" name="outputr" from_work_dir="output.NVC_plot.r" label="${tool.name} on ${on_string} (R Script)" /> + <data format="pdf" name="outputpdf" from_work_dir="output.NVC_plot.pdf" label="${tool.name} on ${on_string} (PDF)" /> + </outputs> + <help> +read_NVC.py ++++++++++++ + +This module is used to check the nucleotide composition bias. Due to random priming, certain +patterns are over represented at the beginning (5'end) of reads. This bias could be easily +examined by NVC (Nucleotide versus cycle) plot. NVC plot is generated by overlaying all +reads together, then calculating nucleotide composition for each position of read +(or each sequencing cycle). In ideal condition (genome is random and RNA-seq reads is +randomly sampled from genome), we expect A%=C%=G%=T%=25% at each position of reads. + +NOTE: this program expect a fixed read length + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Include N,X in NVC plot + Plots N and X alongside A, T, C, and G in plot. + +Output +++++++++++++++ + +This module is used to check the nucleotide composition bias. Due to random priming, certain patterns are over represented at the beginning (5'end) of reads. This bias could be easily examined by NVC (Nucleotide versus cycle) plot. NVC plot is generated by overlaying all reads together, then calculating nucleotide composition for each position of read (or each sequencing cycle). In ideal condition (genome is random and RNA-seq reads is randomly sampled from genome), we expect A%=C%=G%=T%=25% at each position of reads. + + +1. output.NVC.xls: plain text file, each row is position of read (or sequencing cycle), each column is nucleotide (A,C,G,T,N,X) +2. output.NVC_plot.r: R script to generate NVC plot. +3. output.NVC_plot.pdf: NVC plot. + + +.. image:: http://rseqc.sourceforge.net/_images/NVC_plot.png + :height: 600 px + :width: 600 px + :scale: 80 % + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/read_distribution.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,90 @@ +<tool id="rseqc_read_distribution" name="Read Distribution" version="1.1"> + <description>calculates how mapped reads were distributed over genome feature</description> + <requirements> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + read_distribution.py -i $input -r $refgene > $output + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="input bam/sam file" /> + <param name="refgene" type="data" format="bed" label="reference gene model" /> + </inputs> + <outputs> + <data format="txt" name="output" /> + </outputs> + <help> +read_distribution.py +++++++++++++++++++++ + +Provided a BAM/SAM file and reference gene model, this module will calculate how mapped +reads were distributed over genome feature (like CDS exon, 5'UTR exon, 3' UTR exon, Intron, +Intergenic regions). When genome features are overlapped (e.g. a region could be annotated +as both exon and intron by two different transcripts) , they are prioritize as: +CDS exons > UTR exons > Introns > Intergenic regions, for example, if a read was mapped to +both CDS exon and intron, it will be assigned to CDS exons. + +* "Total Reads": This does NOT include those QC fail,duplicate and non-primary hit reads +* "Total Tags": reads spliced once will be counted as 2 tags, reads spliced twice will be counted as 3 tags, etc. And because of this, "Total Tags" >= "Total Reads" +* "Total Assigned Tags": number of tags that can be unambiguously assigned the 10 groups (see below table). +* Tags assigned to "TSS_up_1kb" were also assigned to "TSS_up_5kb" and "TSS_up_10kb", tags assigned to "TSS_up_5kb" were also assigned to "TSS_up_10kb". Therefore, "Total Assigned Tags" = CDS_Exons + 5'UTR_Exons + 3'UTR_Exons + Introns + TSS_up_10kb + TES_down_10kb. +* When assign tags to genome features, each tag is represented by its middle point. + +RSeQC cannot assign those reads that: + +* hit to intergenic regions that beyond region starting from TSS upstream 10Kb to TES downstream 10Kb. +* hit to regions covered by both 5'UTR and 3' UTR. This is possible when two head-to-tail transcripts are overlapped in UTR regions. +* hit to regions covered by both TSS upstream 10Kb and TES downstream 10Kb. + + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Reference gene model + Gene model in BED format. + +Sample Output +++++++++++++++ + +Output: + +=============== ============ =========== =========== +Group Total_bases Tag_count Tags/Kb +=============== ============ =========== =========== +CDS_Exons 33302033 20002271 600.63 +5'UTR_Exons 21717577 4408991 203.01 +3'UTR_Exons 15347845 3643326 237.38 +Introns 1132597354 6325392 5.58 +TSS_up_1kb 17957047 215331 11.99 +TSS_up_5kb 81621382 392296 4.81 +TSS_up_10kb 149730983 769231 5.14 +TES_down_1kb 18298543 266161 14.55 +TES_down_5kb 78900674 729997 9.25 +TES_down_10kb 140361190 896882 6.39 +=============== ============ =========== =========== + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/read_duplication.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,71 @@ +<tool id="rseqc_read_duplication" name="Read Duplication" version="1.1"> + <description>determines reads duplication rate with sequence-based and mapping-based strategies</description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + read_duplication.py -i $input -o output -u $upLimit + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="input bam/sam file" /> + <param name="upLimit" type="integer" label="Upper Limit of Plotted Duplicated Times (default=500)" value="500" /> + </inputs> + <outputs> + <data format="xls" name="outputxls" from_work_dir="output.dup.pos.DupRate.xls" label="${tool.name} on ${on_string} (Position XLS)"/> + <data format="xls" name="outputseqxls" from_work_dir="output.dup.seq.DupRate.xls" label="${tool.name} on ${on_string} (Sequence XLS)"/> + <data format="txt" name="outputr" from_work_dir="output.DupRate_plot.r" label="${tool.name} on ${on_string} (R Script)" /> + <data format="pdf" name="outputpdf" from_work_dir="output.DupRate_plot.pdf" label="${tool.name} on ${on_string} (PDF)" /> + </outputs> + <help> +read_duplication.py ++++++++++++++++++++ + +Two strategies were used to determine reads duplication rate: + +* Sequence based: reads with exactly the same sequence content are regarded as duplicated reads. +* Mapping based: reads mapped to the same genomic location are regarded as duplicated reads. For splice reads, reads mapped to the same starting position and splice the same way are regarded as duplicated reads. + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Upper Limit of Plotted Duplicated Times (default=500) + Only used for plotting. + +Output +++++++++++++++ + +1. output.dup.pos.DupRate.xls: Read duplication rate determined from mapping position of read. First column is "occurrence" or duplication times, second column is number of uniquely mapped reads. +2. output.dup.seq.DupRate.xls: Read duplication rate determined from sequence of read. First column is "occurrence" or duplication times, second column is number of uniquely mapped reads. +3. output.DupRate_plot.r: R script to generate pdf file +4. output.DupRate_plot.pdf: graphical output generated from R script + +.. image:: http://rseqc.sourceforge.net/_images/duplicate.png + :height: 600 px + :width: 600 px + :scale: 80 % + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/read_quality.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,78 @@ +<tool id="rseqc_read_quality" name="Read Quality" version="1.1"> + <description>determines Phred quality score</description> + <requirements> + <requirement type="package" version="3.0.1">R</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + <requirement type="package" version="2.3.7">rseqc</requirement> + </requirements> + <command> + read_quality.py -i $input -o output -r $reduce + </command> + <stdio> + <exit_code range="1:" level="fatal" description="An error occured during execution, see stderr and stdout for more information" /> + <regex match="[Ee]rror" source="both" description="An error occured during execution, see stderr and stdout for more information" /> + </stdio> + <inputs> + <param name="input" type="data" format="bam,sam" label="input bam/sam file" /> + <param name="reduce" type="integer" label="Ignore Phred scores less than this amount (only applies to 'boxplot', default=1000)" value="1000" /> + </inputs> + <outputs> + <data format="txt" name="outputr" from_work_dir="output.qual.r" label="${tool.name} on ${on_string} (R Script)" /> + <data format="pdf" name="outputpdf" from_work_dir="output.qual.heatmap.pdf" label="${tool.name} on ${on_string} (Heatmap PDF)" /> + <data format="pdf" name="outputpdf" from_work_dir="output.qual.boxplot.pdf" label="${tool.name} on ${on_string} (Boxplot PDF)" /> + </outputs> + <help> +read_quality.py ++++++++++++++++ + +According to SAM specification, if Q is the character to represent "base calling quality" +in SAM file, then Phred Quality Score = ord(Q) - 33. Here ord() is python function that +returns an integer representing the Unicode code point of the character when the argument +is a unicode object, for example, ord('a') returns 97. Phred quality score is widely used +to measure "reliability" of base-calling, for example, phred quality score of 20 means +there is 1/100 chance that the base-calling is wrong, phred quality score of 30 means there +is 1/1000 chance that the base-calling is wrong. In general: Phred quality score = -10xlog(10)P, +here P is probability that base-calling is wrong. + +Inputs +++++++++++++++ + +Input BAM/SAM file + Alignment file in BAM/SAM format. + +Ignore phred scores less than this number (default=1000) + To avoid making huge vector in R, nucleotide with certain phred score represented less than this number will be ignored. Increase this number save more memory while reduce precision. This option only applies to the 'boxplot'. + +Output +++++++++++++++ + +1. output.qual.r +2. output.qual.boxplot.pdf + .. image:: http://rseqc.sourceforge.net/_images/36mer.qual.plot.png + :height: 600 px + :width: 600 px + :scale: 80 % +3. output.qual.heatmap.pdf + .. image:: http://rseqc.sourceforge.net/_images/36mer.qual.heatmap.png + :height: 600 px + :width: 600 px + :scale: 80 % + +Heatmap: use different color to represent nucleotide density ("blue"=low density,"orange"=median density,"red"=high density") + +----- + +About RSeQC ++++++++++++ + +The RSeQC_ package provides a number of useful modules that can comprehensively evaluate high throughput sequence data especially RNA-seq data. "Basic modules" quickly inspect sequence quality, nucleotide composition bias, PCR bias and GC bias, while "RNA-seq specific modules" investigate sequencing saturation status of both splicing junction detection and expression estimation, mapped reads clipping profile, mapped reads distribution, coverage uniformity over gene body, reproducibility, strand specificity and splice junction annotation. + +The RSeQC package is licensed under the GNU GPL v3 license. + +.. image:: http://rseqc.sourceforge.net/_static/logo.png + +.. _RSeQC: http://rseqc.sourceforge.net/ + + + </help> +</tool>
--- a/test-data/fastx_barcode_splitter1.fastq Thu Nov 07 16:44:53 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,168 +0,0 @@ -@CSHL_3_FC042AGLLWW:1:2:7:203 -GATCTAGTAGTAGTAGA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GATCTAGTAGTAGTAGA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GATCTAGTAGTAGTAGA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GATCTAGTAGTAGTAGA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GATCTAGTAGTAGTAGA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTCTAGTAGTAGTAGA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTCTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTCTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTATTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTATTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTATTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTACGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTACTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGTACGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCGTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCGTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCGTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCGTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCTTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCTTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCTTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCTTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCTCGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCTCGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCTCTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -ATCTCGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -GGAATGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -TAGTTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -TAGTTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -TAGTTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -TAGTTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -TAGTTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -TAGTTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 -TGTCTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa \ No newline at end of file
--- a/test-data/fastx_barcode_splitter1.out Thu Nov 07 16:44:53 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,24 +0,0 @@ -<html><body><table border=1> -<tr><td> -Barcode</td><td>Count</td><td>Location -</td></tr> -<tr><td> -BC1</td><td>11</td><td><a href="fastx_barcode_splitter1_fastq__BC1.txt">fastx_barcode_splitter1_fastq__BC1.txt</a> -</td></tr> -<tr><td> -BC2</td><td>12</td><td><a href="fastx_barcode_splitter1_fastq__BC2.txt">fastx_barcode_splitter1_fastq__BC2.txt</a> -</td></tr> -<tr><td> -BC3</td><td>9</td><td><a href="fastx_barcode_splitter1_fastq__BC3.txt">fastx_barcode_splitter1_fastq__BC3.txt</a> -</td></tr> -<tr><td> -BC4</td><td>1</td><td><a href="fastx_barcode_splitter1_fastq__BC4.txt">fastx_barcode_splitter1_fastq__BC4.txt</a> -</td></tr> -<tr><td> -unmatched</td><td>9</td><td><a href="fastx_barcode_splitter1_fastq__unmatched.txt">fastx_barcode_splitter1_fastq__unmatched.txt</a> -</td></tr> -<tr><td> -total</td><td>42 -</td></tr> -<p> -</table></body></html>
--- a/test-data/fastx_barcode_splitter1.txt Thu Nov 07 16:44:53 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -BC1 GATCT -BC2 ATCGT -BC3 GTGAT -BC4 TGTCT \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Thu Nov 07 17:17:15 2013 -0500 @@ -0,0 +1,26 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="R" version="3.0.1"> + <repository changeset_revision="0a395bcd7efd" name="package_r_3_0_1" owner="iuc" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + </package> + <package name="numpy" version="1.7.1"> + <repository changeset_revision="84125ffacb90" name="package_numpy_1_7" owner="iuc" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + </package> + <package name="rseqc" version="2.3.7"> + <install version="1.0"> + <actions> + <action type="download_by_url">http://sourceforge.net/projects/rseqc/files/RSeQC-2.3.7.tar.gz</action> + <action type="shell_command">export PYTHONPATH=$PYTHONPATH:$INSTALL_DIR/lib/python && python setup.py install --install-lib $INSTALL_DIR/lib/python --install-scripts $INSTALL_DIR/bin</action> + <action type="set_environment"> + <environment_variable action="prepend_to" name="PYTHONPATH">$INSTALL_DIR/lib/python</environment_variable> + <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR/bin</environment_variable> + </action> + </actions> + </install> + <readme> + RSeQC version 2.3.7, documentation available at http://dldcc-web.brc.bcm.edu/lilab/liguow/CGI/rseqc/_build/html/index.html. + Requires gcc and python 2.7. + </readme> + </package> + +</tool_dependency>
