Mercurial > repos > jorrit > obotest
changeset 3:0c42bebab126 draft default tip
Uploaded
| author | jorrit |
|---|---|
| date | Thu, 07 Feb 2013 16:58:40 -0500 |
| parents | e71204d5e03c |
| children | |
| files | README fetch_ontology.xml obo_scripts.xml sam_fa_indices.loc.sample src test-data/fake_phiX_reads_1.bam test-data/fetch_GO_ontology.test test-data/freebayes_out_1.output_trace test-data/freebayes_out_1.vcf.contains test-data/phiX.fasta tool_data_table_conf.xml.sample tool_dependencies.xml |
| diffstat | 11 files changed, 55 insertions(+), 1620 deletions(-) [+] |
line wrap: on
line diff
--- a/README Thu Feb 07 16:57:42 2013 -0500 +++ b/README Thu Feb 07 16:58:40 2013 -0500 @@ -1,4 +1,11 @@ +The following libraries need to be installed to use the obo tools: -oather This is a tools that says hello. +# termfinder needs g++ and other build tools +sudo apt-get $APT_OPTS install build-essential -And an update. +# perl dbi / perl DBD::mysql +sudo apt-get $APT_OPTS install libdbi-perl libdbd-mysql-perl + +# GO:TermFinder needs dependencies GraphViz and GD graphics libraries +sudo apt-get $APT_OPTS install libgraphviz-perl +sudo apt-get $APT_OPTS install libgd-gd2-perl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fetch_ontology.xml Thu Feb 07 16:58:40 2013 -0500 @@ -0,0 +1,41 @@ +<tool id="fetch_ontology" name="fetch ontology"> + <description>from OBO repository</description> + <requirements> + <requirement type="package" version="1.0.1">obo_scripts</requirement> + </requirements> + <command>obo-fetch-remote-ontology.pl $ont > $output</command> + <inputs> + <param name="ont" type="text" size="50" value="" label="Ontology ID Space" /> + </inputs> + <outputs> + <data format="obo" name="output" /> + </outputs> + <tests> + <test> + <param name="ont" value="GO" /> + <output name="output" file="fetch_GO_ontology.test" compare="contains"/> + </test> + </tests> + + + <help> +.. class:: infomark + +Fetch entire ontology in OBO format + +**Example** + +Here are some common ID spaces:: + + GO gene ontology + CL cell ontology + +**More information** + +http://github.com/cmungall/obo-scripts + + </help> + +</tool> + +
--- a/obo_scripts.xml Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,676 +0,0 @@ -<?xml version="1.0"?> -<tool id="fetch_obo_ontology2" name="FetchOboOntology2" version="0.0.8"> - <requirements> - <requirement type="package" version="0.9.6_9608597d12e127c847ae03aa03440ab63992fedf">freebayes</requirement> - <requirement type="package" version="0.1.18">samtools</requirement> - </requirements> - <description> - obo scripts</description> - <command> - ##set up input files - #set $reference_fasta_filename = "localref.fa" - #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && - samtools faidx "${reference_fasta_filename}" 2>&1 || echo "Error running samtools faidx for FreeBayes" >&2 && - #else: - #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) - #end if - #for $bam_count, $input_bam in enumerate( $reference_source.input_bams ): - ln -s "${input_bam.input_bam}" "localbam_${bam_count}.bam" && - ln -s "${input_bam.input_bam.metadata.bam_index}" "localbam_${bam_count}.bam.bai" && - #end for - ##finished setting up inputs - - ##start FreeBayes commandline - freebayes - #for $bam_count, $input_bam in enumerate( $reference_source.input_bams ): - --bam "localbam_${bam_count}.bam" - #end for - --fasta-reference "${reference_fasta_filename}" - - ##outputs - --vcf "${output_vcf}" - - ##advanced options - #if str( $options_type.options_type_selector ) == "advanced": - ##additional outputs - #if $options_type.output_trace_option: - --trace "${output_trace}" - #end if - #if $options_type.output_failed_alleles_option: - --failed-alleles "${output_failed_alleles_bed}" - #end if - - ##additional inputs - #if str( $options_type.target_limit_type.target_limit_type_selector ) == "limit_by_target_file": - --targets "${options_type.target_limit_type.input_target_bed}" - #elif str( $options_type.target_limit_type.target_limit_type_selector ) == "limit_by_region": - --region "${options_type.target_limit_type.region_chromosome}:${options_type.target_limit_type.region_start}..${options_type.target_limit_type.region_end}" - #end if - #if $options_type.input_sample_file: - --samples "${options_type.input_sample_file}" - #end if - #if $options_type.input_populations_file: - --populations "${options_type.input_populations_file}" - #end if - #if $options_type.input_cnv_map_bed: - --cnv-map "${options_type.input_cnv_map_bed}" - #end if - #if str( $options_type.input_variant_type.input_variant_type_selector ) == "provide_vcf": - --variant-input "${options_type.input_variant_type.input_variant_vcf}" - ${options_type.input_variant_type.only_use_input_alleles} - #end if - #if $options_type.haplotype_basis_alleles: - --haplotype-basis-alleles "${options_type.haplotype_basis_alleles}" - #end if - - - ##reporting - #if str( $options_type.section_reporting_type.section_reporting_type_selector ) == "set": - --pvar "${options_type.section_reporting_type.pvar}" - ${options_type.section_reporting_type.show_reference_repeats} - #end if - - ##population model - #if str( $options_type.section_population_model_type.section_population_model_type_selector ) == "set": - --theta "${options_type.section_population_model_type.theta}" - --ploidy "${options_type.section_population_model_type.ploidy}" - ${options_type.section_population_model_type.pooled} - #end if - - ##reference allele - #if str( $options_type.use_reference_allele_type.use_reference_allele_type_selector ) == "include_reference_allele": - --use-reference-allele - ${options_type.use_reference_allele_type.diploid_reference} - --reference-quality "${options_type.use_reference_allele_type.reference_quality_mq},${options_type.use_reference_allele_type.reference_quality_bq}" - #end if - - ##allele scope - #if str( $options_type.section_allele_scope_type.section_allele_scope_type_selector ) == "set": - ${options_type.section_allele_scope_type.no_snps} - ${options_type.section_allele_scope_type.no_indels} - ${options_type.section_allele_scope_type.no_mnps} - ${options_type.section_allele_scope_type.no_complex} - --use-best-n-alleles "${options_type.section_allele_scope_type.use_best_n_alleles}" - #if $options_type.section_allele_scope_type.max_complex_gap: - --max-complex-gap "${options_type.section_allele_scope_type.max_complex_gap}" - #end if - #end if - - ##indel realignment - ${options_type.left_align_indels} - - ##input filters - #if str( $options_type.section_input_filters_type.section_input_filters_type_selector ) == "set": - ${options_type.section_input_filters_type.use_duplicate_reads} - #if str( $options_type.section_input_filters_type.quality_filter_type.quality_filter_type_selector ) == "apply_filters": - --min-mapping-quality "${options_type.section_input_filters_type.quality_filter_type.min_mapping_quality}" - --min-base-quality "${options_type.section_input_filters_type.quality_filter_type.min_base_quality}" - --min-supporting-quality "${options_type.section_input_filters_type.quality_filter_type.min_supporting_quality_mq},${options_type.section_input_filters_type.quality_filter_type.min_supporting_quality_bq}" - #elif str( $options_type.section_input_filters_type.quality_filter_type.quality_filter_type_selector ) == "standard_filters": - --standard-filters - #end if - --mismatch-base-quality-threshold "${options_type.section_input_filters_type.mismatch_base_quality_threshold}" - #if $options_type.section_input_filters_type.read_mismatch_limit: - --read-mismatch-limit "${options_type.section_input_filters_type.read_mismatch_limit}" - #end if - --read-max-mismatch-fraction "${options_type.section_input_filters_type.read_max_mismatch_fraction}" - #if $options_type.section_input_filters_type.read_snp_limit: - --read-snp-limit "${options_type.section_input_filters_type.read_snp_limit}" - #end if - #if $options_type.section_input_filters_type.read_indel_limit: - --read-indel-limit "${options_type.section_input_filters_type.read_indel_limit}" - #end if - --indel-exclusion-window "${options_type.section_input_filters_type.indel_exclusion_window}" - --min-alternate-fraction "${options_type.section_input_filters_type.min_alternate_fraction}" - --min-alternate-count "${options_type.section_input_filters_type.min_alternate_count}" - --min-alternate-qsum "${options_type.section_input_filters_type.min_alternate_qsum}" - --min-alternate-total "${options_type.section_input_filters_type.min_alternate_total}" - --min-coverage "${options_type.section_input_filters_type.min_coverage}" - #end if - - ##bayesian priors - #if str( $options_type.section_bayesian_priors_type.section_bayesian_priors_type_selector ) == "set": - ${options_type.section_bayesian_priors_type.no_ewens_priors} - ${options_type.section_bayesian_priors_type.no_population_priors} - ${options_type.section_bayesian_priors_type.hwe_priors} - #end if - - ##observation prior expectations - #if str( $options_type.section_observation_prior_expectations_type.section_observation_prior_expectations_type_selector ) == "set": - ${options_type.section_observation_prior_expectations_type.binomial_obs_priors} - ${options_type.section_observation_prior_expectations_type.allele_balance_priors} - #end if - - ##algorithmic features - #if str( $options_type.section_algorithmic_features_type.section_algorithmic_features_type_selector ) == "set": - --site-selection-max-iterations "${options_type.section_algorithmic_features_type.site_selection_max_iterations}" - --genotyping-max-iterations "${options_type.section_algorithmic_features_type.genotyping_max_iterations}" - --genotyping-max-banddepth "${options_type.section_algorithmic_features_type.genotyping_max_banddepth}" - --posterior-integration-limits "${options_type.section_algorithmic_features_type.posterior_integration_limits_n},${options_type.section_algorithmic_features_type.posterior_integration_limits_m}" - ${options_type.section_algorithmic_features_type.no_permute} - ${options_type.section_algorithmic_features_type.exclude_unobserved_genotypes} - #if $options_type.section_algorithmic_features_type.genotype_variant_threshold: - --genotype-variant-threshold "${options_type.section_algorithmic_features_type.genotype_variant_threshold}" - #end if - ${options_type.section_algorithmic_features_type.use_mapping_quality} - --read-dependence-factor "${options_type.section_algorithmic_features_type.read_dependence_factor}" - ${options_type.section_algorithmic_features_type.no_marginals} - #end if - - #end if - </command> - <inputs> - <conditional name="reference_source"> - <param name="reference_source_selector" type="select" label="Choose the source for the reference list"> - <option value="cached">Locally cached</option> - <option value="history">History</option> - </param> - <when value="cached"> - <repeat name="input_bams" title="Sample BAM file" min="1"> - <param name="input_bam" type="data" format="bam" label="BAM file"> - <validator type="unspecified_build" /> - <validator type="dataset_metadata_in_data_table" table_name="sam_fa_indexes" metadata_name="dbkey" metadata_column="value" message="Sequences are not currently available for the specified build." /> - </param> - </repeat> - <param name="ref_file" type="select" label="Using reference genome"> - <options from_data_table="sam_fa_indexes"> - <!-- <filter type="sam_fa_indexes" key="dbkey" ref="input_bam" column="value"/> does not yet work in a repeat...--> - </options> - <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> - </param> - </when> - <when value="history"> <!-- FIX ME!!!! --> - <repeat name="input_bams" title="Sample BAM file" min="1"> - <param name="input_bam" type="data" format="bam" label="BAM file" /> - </repeat> - <param name="ref_file" type="data" format="fasta" label="Using reference file" /> - </when> - </conditional> - - <conditional name="options_type"> - <param name="options_type_selector" type="select" label="Basic or Advanced options"> - <option value="basic" selected="True">Basic</option> - <option value="advanced">Advanced</option> - </param> - <when value="basic"> - <!-- Do nothing here --> - </when> - <when value="advanced"> - - <!-- output --> - <param name="output_failed_alleles_option" type="boolean" truevalue="--failed-alleles" falsevalue="" checked="False" label="Write out failed alleles file" /> - <param name="output_trace_option" type="boolean" truevalue="--trace" falsevalue="" checked="False" label="Write out algorithm trace file" /> - - - <!-- input --> - <conditional name="target_limit_type"> - <param name="target_limit_type_selector" type="select" label="Limit analysis to listed targets"> - <option value="do_not_limit" selected="True">Do not limit</option> - <option value="limit_by_target_file">Limit by target file</option> - <option value="limit_by_region">Limit to region</option> - </param> - <when value="do_not_limit"> - <!-- Do nothing here --> - </when> - <when value="limit_by_target_file"> - <param name="input_target_bed" type="data" format="bed" label="Limit analysis to targets listed in the BED-format FILE." /> - </when> - <when value="limit_by_region"> - <param name="region_chromosome" type="text" label="Region Chromosome" value="" /> <!--only once? --> - <param name="region_start" type="integer" label="Region Start" value="" /> - <param name="region_end" type="integer" label="Region End" value="" /> - </when> - </conditional> - <param name="input_sample_file" type="data" format="txt" label="Limit analysis to samples listed (one per line) in the FILE" optional="True" /> - <param name="input_populations_file" type="data" format="txt" label="Populations File" optional="True" /> - <param name="input_cnv_map_bed" type="data" format="bed" label="Read a copy number map from the BED file FILE" optional="True" /> - <conditional name="input_variant_type"> - <param name="input_variant_type_selector" type="select" label="Provide variants file"> - <option value="do_not_provide" selected="True">Do not provide</option> - <option value="provide_vcf">Provide VCF file</option> - </param> - <when value="do_not_provide"> - <!-- Do nothing here --> - </when> - <when value="provide_vcf"> - <param name="input_variant_vcf" type="data" format="vcf" label="Use variants reported in VCF file as input to the algorithm" /> - <param name="only_use_input_alleles" type="boolean" truevalue="--only-use-input-alleles" falsevalue="" checked="False" label="Only provide variant calls and genotype likelihoods for sites in VCF" /> - </when> - </conditional> - <param name="haplotype_basis_alleles" type="data" format="vcf" label="Only use variant alleles provided in this input VCF for the construction of complex or haplotype alleles" optional="True" /> - - <!-- reporting --> - <conditional name="section_reporting_type"> - <param name="section_reporting_type_selector" type="select" label="Set Reporting options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="pvar" type="float" label="Report sites if the probability that there is a polymorphism at the site is greater" value="0.0001" /> - <param name="show_reference_repeats" type="boolean" truevalue="--show-reference-repeats" falsevalue="" checked="False" label="Calculate and show information about reference repeats" /> - </when> - </conditional> - - - <!-- population model --> - <conditional name="section_population_model_type"> - <param name="section_population_model_type_selector" type="select" label="Set population model options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="theta" type="float" label="expected mutation rate or pairwise nucleotide diversity among the population" value="0.001" help="This serves as the single parameter to the Ewens Sampling Formula prior model"/> - <param name="ploidy" type="integer" label="default ploidy for the analysis" value="2" /> - <param name="pooled" type="boolean" truevalue="--pooled" falsevalue="" checked="False" label="Assume that samples result from pooled sequencing" help="When using this flag, set --ploidy to the number of alleles in each sample." /> - </when> - </conditional> - - <!-- reference allele --> - <conditional name="use_reference_allele_type"> - <param name="use_reference_allele_type_selector" type="select" label="Include the reference allele in the analysis"> - <option value="do_not_include_reference_allele" selected="True">Do not include</option> - <option value="include_reference_allele">Include</option> - </param> - <when value="do_not_include_reference_allele"> - <!-- Do nothing here --> - </when> - <when value="include_reference_allele"> - <param name="diploid_reference" type="boolean" truevalue="--diploid-reference" falsevalue="" checked="False" label="Treat reference as diploid" /> - <param name="reference_quality_mq" type="integer" label="Assign mapping quality" value="100" /> - <param name="reference_quality_bq" type="integer" label="Assign base quality" value="60" /> - </when> - </conditional> - - <!-- allele scope --> - <conditional name="section_allele_scope_type"> - <param name="section_allele_scope_type_selector" type="select" label="Set allele scope options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="no_snps" type="boolean" truevalue="--no-snps" falsevalue="" checked="False" label="Ignore SNP alleles" /> - <param name="no_indels" type="boolean" truevalue="--no-indels" falsevalue="" checked="False" label="Ignore insertion and deletion alleles" /> - <param name="no_mnps" type="boolean" truevalue="--no-mnps" falsevalue="" checked="False" label="Ignore multi-nuceotide polymorphisms, MNPs" /> - <param name="no_complex" type="boolean" truevalue="--no-complex" falsevalue="" checked="False" label="Ignore complex events (composites of other classes)" /> - <param name="use_best_n_alleles" type="integer" label="Evaluate only the best N SNP alleles" value="0" min="0" help="Ranked by sum of supporting quality scores; Set to 0 to use all" /> - <param name="max_complex_gap" type="integer" label="Allow complex alleles with contiguous embedded matches of up to this length" value="" optional="True"/> - </when> - </conditional> - - <!-- indel realignment --> - <param name="left_align_indels" type="boolean" truevalue="--left-align-indels" falsevalue="" checked="False" label="Left-realign and merge gaps embedded in reads" /> - - <!-- input filters --> - <conditional name="section_input_filters_type"> - <param name="section_input_filters_type_selector" type="select" label="Set input filters options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="use_duplicate_reads" type="boolean" truevalue="--use-duplicate-reads" falsevalue="" checked="False" label="Include duplicate-marked alignments in the analysis" /> - <conditional name="quality_filter_type"> - <param name="quality_filter_type_selector" type="select" label="Apply Quality filters"> - <option value="standard_filters" selected="True">Apply standard</option> - <option value="apply_filters">Apply specified</option> - </param> - <when value="standard_filters"> - <!-- Do nothing here --> <!-- standard-filters --> - </when> - <when value="apply_filters"> - <param name="min_mapping_quality" type="integer" label="Exclude alignments from analysis if they have a mapping quality less than" value="0" /> - <param name="min_base_quality" type="integer" label="Exclude alleles from analysis if their supporting base quality less than" value="0" /> - <param name="min_supporting_quality_mq" type="integer" label="In order to consider an alternate allele, at least one supporting alignment must have mapping quality" value="0" /> - <param name="min_supporting_quality_bq" type="integer" label="In order to consider an alternate allele, at least one supporting alignment must have base quality" value="0" /> - </when> - </conditional> - <param name="mismatch_base_quality_threshold" type="integer" label="Count mismatches toward read-mismatch-limit if the base quality of the mismatch is >=" value="10" /> - <param name="read_mismatch_limit" type="integer" label="Exclude reads with more than N mismatches where each mismatch has base quality >= mismatch-base-quality-threshold" value="" optional="True" /> - <param name="read_max_mismatch_fraction" type="float" label="Exclude reads with more than N [0,1] fraction of mismatches where each mismatch has base quality >= mismatch-base-quality-threshold" value="1.0" /> - <param name="read_snp_limit" type="integer" label="Exclude reads with more than N base mismatches, ignoring gaps with quality >= mismatch-base-quality-threshold" value="" optional="True" /> - <param name="read_indel_limit" type="integer" label="Exclude reads with more than N separate gaps" value="" optional="True" /> - <param name="indel_exclusion_window" type="integer" label="Ignore portions of alignments this many bases from a putative insertion or deletion allele" value="0" /> - <param name="min_alternate_fraction" type="float" label="Require at least this fraction of observations supporting an alternate allele within a single individual in the in order to evaluate the position" value="0" /> - <param name="min_alternate_count" type="integer" label="Require at least this count of observations supporting an alternate allele within a single individual in order to evaluate the position" value="1" /> - <param name="min_alternate_qsum" type="integer" label="Require at least this sum of quality of observations supporting an alternate allele within a single individual in order to evaluate the position" value="0" /> - <param name="min_alternate_total" type="integer" label="Require at least this count of observations supporting an alternate allele within the total population in order to use the allele in analysis" value="1" /> - <param name="min_coverage" type="integer" label="Require at least this coverage to process a site" value="0" /> - </when> - </conditional> - - - <!-- bayesian priors --> - <conditional name="section_bayesian_priors_type"> - <param name="section_bayesian_priors_type_selector" type="select" label="Set bayesian priors options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="no_ewens_priors" type="boolean" truevalue="--no-ewens-priors" falsevalue="" checked="False" label="Turns off the Ewens' Sampling Formula component of the priors" /> - <param name="no_population_priors" type="boolean" truevalue="--no-population-priors" falsevalue="" checked="False" label="No population priors" help="Equivalent to --pooled --no-ewens-priors" /> - <param name="hwe_priors" type="boolean" truevalue="--hwe-priors" falsevalue="" checked="False" label="Use the probability of the combination arising under HWE given the allele frequency as estimated by observation frequency" /> - </when> - </conditional> - - <!-- observation prior expectations --> - <conditional name="section_observation_prior_expectations_type"> - <param name="section_observation_prior_expectations_type_selector" type="select" label="Set observation prior expectations options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="binomial_obs_priors" type="boolean" truevalue="--binomial-obs-priors" falsevalue="" checked="False" label="Incorporate expectations about osbervations into the priors, Uses read placement probability, strand balance probability, and read position (5'-3') probability" /> - <param name="allele_balance_priors" type="boolean" truevalue="--allele-balance-priors" falsevalue="" checked="False" label="Use aggregate probability of observation balance between alleles as a component of the priors. Best for observations with minimal inherent reference bias" /> - </when> - </conditional> - - - <!-- algorithmic features --> - <conditional name="section_algorithmic_features_type"> - <param name="section_algorithmic_features_type_selector" type="select" label="Set algorithmic features options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="site_selection_max_iterations" type="integer" label="Uses hill-climbing algorithm to search posterior space for N iterations to determine if the site should be evaluated." value="5" help="Set to 0 to prevent use of this algorithm for site selection, and to a low integer for improvide site selection at a slight performance penalty" /> - <param name="genotyping_max_iterations" type="integer" label="Iterate no more than N times during genotyping step" value="25" /> - <param name="genotyping_max_banddepth" type="integer" label="Integrate no deeper than the Nth best genotype by likelihood when genotyping" value="6" /> - <param name="posterior_integration_limits_n" type="integer" label="Posteriror integration limit N" help="Integrate all genotype combinations in our posterior space which include no more than N samples with their Mth best data likelihood." value="1" /> - <param name="posterior_integration_limits_m" type="integer" label="Posteriror integration limit M" help="Integrate all genotype combinations in our posterior space which include no more than N samples with their Mth best data likelihood." value="3" /> - <param name="no_permute" type="boolean" truevalue="--no-permute" falsevalue="" checked="False" label="Do not scale prior probability of genotype combination given allele frequency by the number of permutations of included genotypes" /> - <param name="exclude_unobserved_genotypes" type="boolean" truevalue="--exclude-unobserved-genotypes" falsevalue="" checked="False" label="Skip sample genotypings for which the sample has no supporting reads" /> - <param name="genotype_variant_threshold" type="integer" label="Limit posterior integration to samples where the second-best genotype likelihood is no more than log(N) from the highest genotype likelihood for the sample" value="" optional="True" /> - <param name="use_mapping_quality" type="boolean" truevalue="--use-mapping-quality" falsevalue="" checked="False" label="Use mapping quality of alleles when calculating data likelihoods" /> - <param name="read_dependence_factor" type="float" label="Incorporate non-independence of reads by scaling successive observations by this factor during data likelihood calculations" value="0.9" /> - <param name="no_marginals" type="boolean" truevalue="--no-marginals" falsevalue="" checked="False" label="Do not calculate the marginal probability of genotypes. Saves time and improves scaling performance in large populations" /> - </when> - </conditional> - - - </when> - </conditional> - - </inputs> - <outputs> - <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (variants)" /> - <data format="bed" name="output_failed_alleles_bed" label="${tool.name} on ${on_string} (failed alleles)"> - <filter>options_type['options_type_selector'] == "advanced" and options_type['output_failed_alleles_option'] is True</filter> - </data> - <data format="txt" name="output_trace" label="${tool.name} on ${on_string} (trace)"> - <filter>options_type['options_type_selector'] == "advanced" and options_type['output_trace_option'] is True</filter> - </data> - </outputs> - <tests> - <test> - <param name="reference_source_selector" value="history" /> - <param name="ref_file" ftype="fasta" value="phiX.fasta"/> - <param name="input_bam" ftype="bam" value="fake_phiX_reads_1.bam"/> - <param name="options_type_selector" value="basic"/> - <output name="output_vcf" file="freebayes_out_1.vcf.contains" compare="contains"/> - </test> - </tests> - <help> -**What it does** - -This tool uses FreeBayes to call SNPS given a reference sequence and a BAM alignment file. - -FreeBayes is a high-performance, flexible, and open-source Bayesian genetic variant detector. It operates on BAM alignment files, which are produced by most contemporary short-read aligners. - -In addition to substantial performance improvements over its predecessors (PolyBayes, GigaBayes, and BamBayes), it expands the scope of SNP and small-indel variant calling to populations of individuals with heterogeneous copy number. FreeBayes is currently under active development. - -Go `here <http://bioinformatics.bc.edu/marthlab/FreeBayes>`_ for details on FreeBayes. - ------- - -**Inputs** - -FreeBayes accepts an input aligned BAM file. - - -**Outputs** - -The output is in the VCF format. - -------- - -**Settings**:: - - input and output: - - -b --bam FILE Add FILE to the set of BAM files to be analyzed. - -c --stdin Read BAM input on stdin. - -v --vcf FILE Output VCF-format results to FILE. - -f --fasta-reference FILE - Use FILE as the reference sequence for analysis. - An index file (FILE.fai) will be created if none exists. - If neither --targets nor --region are specified, FreeBayes - will analyze every position in this reference. - -t --targets FILE - Limit analysis to targets listed in the BED-format FILE. - -r --region <chrom>:<start_position>..<end_position> - Limit analysis to the specified region, 0-base coordinates, - end_position not included (same as BED format). - -s --samples FILE - Limit analysis to samples listed (one per line) in the FILE. - By default FreeBayes will analyze all samples in its input - BAM files. - --populations FILE - Each line of FILE should list a sample and a population which - it is part of. The population-based bayesian inference model - will then be partitioned on the basis of the populations. - -A --cnv-map FILE - Read a copy number map from the BED file FILE, which has - the format: - reference sequence, start, end, sample name, copy number - ... for each region in each sample which does not have the - default copy number as set by --ploidy. - -L --trace FILE Output an algorithmic trace to FILE. - --failed-alleles FILE - Write a BED file of the analyzed positions which do not - pass --pvar to FILE. - -@ --variant-input VCF - Use variants reported in VCF file as input to the algorithm. - A report will be generated for every record in the VCF file. - -l --only-use-input-alleles - Only provide variant calls and genotype likelihoods for sites - and alleles which are provided in the VCF input, and provide - output in the VCF for all input alleles, not just those which - have support in the data. - --haplotype-basis-alleles VCF - When specified, only variant alleles provided in this input - VCF will be used for the construction of complex or haplotype - alleles. - - reporting: - - -P --pvar N Report sites if the probability that there is a polymorphism - at the site is greater than N. default: 0.0001 - -_ --show-reference-repeats - Calculate and show information about reference repeats in - the VCF output. - - population model: - - -T --theta N The expected mutation rate or pairwise nucleotide diversity - among the population under analysis. This serves as the - single parameter to the Ewens Sampling Formula prior model - default: 0.001 - -p --ploidy N Sets the default ploidy for the analysis to N. default: 2 - -J --pooled Assume that samples result from pooled sequencing. - When using this flag, set --ploidy to the number of - alleles in each sample. - - reference allele: - - -Z --use-reference-allele - This flag includes the reference allele in the analysis as - if it is another sample from the same population. - -H --diploid-reference - If using the reference sequence as a sample (-Z), - treat it as diploid. default: false (reference is haploid) - --reference-quality MQ,BQ - Assign mapping quality of MQ to the reference allele at each - site and base quality of BQ. default: 100,60 - - allele scope: - - -I --no-snps Ignore SNP alleles. - -i --no-indels Ignore insertion and deletion alleles. - -X --no-mnps Ignore multi-nuceotide polymorphisms, MNPs. - -u --no-complex Ignore complex events (composites of other classes). - -n --use-best-n-alleles N - Evaluate only the best N SNP alleles, ranked by sum of - supporting quality scores. (Set to 0 to use all; default: all) - -E --max-complex-gap N - Allow complex alleles with contiguous embedded matches of up - to this length. - - indel realignment: - - -O --left-align-indels - Left-realign and merge gaps embedded in reads. default: false - - input filters: - - -4 --use-duplicate-reads - Include duplicate-marked alignments in the analysis. - default: exclude duplicates - -m --min-mapping-quality Q - Exclude alignments from analysis if they have a mapping - quality less than Q. default: 30 - -q --min-base-quality Q - Exclude alleles from analysis if their supporting base - quality is less than Q. default: 20 - -R --min-supporting-quality MQ,BQ - In order to consider an alternate allele, at least one supporting - alignment must have mapping quality MQ, and one supporting - allele must have base quality BQ. default: 0,0, unset - -Q --mismatch-base-quality-threshold Q - Count mismatches toward --read-mismatch-limit if the base - quality of the mismatch is >= Q. default: 10 - -U --read-mismatch-limit N - Exclude reads with more than N mismatches where each mismatch - has base quality >= mismatch-base-quality-threshold. - default: ~unbounded - -z --read-max-mismatch-fraction N - Exclude reads with more than N [0,1] fraction of mismatches where - each mismatch has base quality >= mismatch-base-quality-threshold - default: 1.0 - -$ --read-snp-limit N - Exclude reads with more than N base mismatches, ignoring gaps - with quality >= mismatch-base-quality-threshold. - default: ~unbounded - -e --read-indel-limit N - Exclude reads with more than N separate gaps. - default: ~unbounded - -0 --standard-filters Use stringent input base and mapping quality filters - Equivalent to -m 30 -q 20 -R 0 -S 0 - -x --indel-exclusion-window - Ignore portions of alignments this many bases from a - putative insertion or deletion allele. default: 0 - -F --min-alternate-fraction N - Require at least this fraction of observations supporting - an alternate allele within a single individual in the - in order to evaluate the position. default: 0.0 - -C --min-alternate-count N - Require at least this count of observations supporting - an alternate allele within a single individual in order - to evaluate the position. default: 1 - -3 --min-alternate-qsum N - Require at least this sum of quality of observations supporting - an alternate allele within a single individual in order - to evaluate the position. default: 0 - -G --min-alternate-total N - Require at least this count of observations supporting - an alternate allele within the total population in order - to use the allele in analysis. default: 1 - -! --min-coverage N - Require at least this coverage to process a site. default: 0 - - bayesian priors: - - -Y --no-ewens-priors - Turns off the Ewens' Sampling Formula component of the priors. - -k --no-population-priors - Equivalent to --pooled --no-ewens-priors - -w --hwe-priors Use the probability of the combination arising under HWE given - the allele frequency as estimated by observation frequency. - - observation prior expectations: - - -V --binomial-obs-priors - Incorporate expectations about osbervations into the priors, - Uses read placement probability, strand balance probability, - and read position (5'-3') probability. - -a --allele-balance-priors - Use aggregate probability of observation balance between alleles - as a component of the priors. Best for observations with minimal - inherent reference bias. - - algorithmic features: - - -M --site-selection-max-iterations N - Uses hill-climbing algorithm to search posterior space for N - iterations to determine if the site should be evaluated. Set to 0 - to prevent use of this algorithm for site selection, and - to a low integer for improvide site selection at a slight - performance penalty. default: 5. - -B --genotyping-max-iterations N - Iterate no more than N times during genotyping step. default: 25. - --genotyping-max-banddepth N - Integrate no deeper than the Nth best genotype by likelihood when - genotyping. default: 6. - -W --posterior-integration-limits N,M - Integrate all genotype combinations in our posterior space - which include no more than N samples with their Mth best - data likelihood. default: 1,3. - -K --no-permute - Do not scale prior probability of genotype combination given allele - frequency by the number of permutations of included genotypes. - -N --exclude-unobserved-genotypes - Skip sample genotypings for which the sample has no supporting reads. - -S --genotype-variant-threshold N - Limit posterior integration to samples where the second-best - genotype likelihood is no more than log(N) from the highest - genotype likelihood for the sample. default: ~unbounded - -j --use-mapping-quality - Use mapping quality of alleles when calculating data likelihoods. - -D --read-dependence-factor N - Incorporate non-independence of reads by scaling successive - observations by this factor during data likelihood - calculations. default: 0.9 - -= --no-marginals - Do not calculate the marginal probability of genotypes. Saves - time and improves scaling performance in large populations. - - ------- - -**Citation** - -For the underlying tool, please cite `Erik Garrison and Gabor Marth. Haplotype-based variant detection from short-read sequencing <http://arxiv.org/abs/1207.3907>`_. - -If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.* - - </help> -</tool>
--- a/sam_fa_indices.loc.sample Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,28 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of Samtools indexed sequences data files. You will need -#to create these data files and then create a sam_fa_indices.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The sam_fa_indices.loc -#file has this format (white space characters are TAB characters): -# -#index <seq> <location> -# -#So, for example, if you had hg18 indexed stored in -#/depot/data2/galaxy/sam/, -#then the sam_fa_indices.loc entry would look like this: -# -#index hg18 /depot/data2/galaxy/sam/hg18.fa -# -#and your /depot/data2/galaxy/sam/ directory -#would contain hg18.fa and hg18.fa.fai files: -# -#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa -#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai -# -#Your sam_fa_indices.loc file should include an entry per line for -#each index set you have stored. The file in the path does actually -#exist, but it should never be directly used. Instead, the name serves -#as a prefix for the index file. For example: -# -#index hg18 /depot/data2/galaxy/sam/hg18.fa -#index hg19 /depot/data2/galaxy/sam/hg19.fa
--- a/src Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,785 +0,0 @@ -<!DOCTYPE html> -<html lang="en"> -<head> - <meta http-equiv="X-UA-Compatible" content="IE=edge" /> - <meta charset="utf-8"> - <title> - jhpoelen / obo - / source / - — Bitbucket -</title> - <link rel="icon" type="image/png" href="https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/img/favicon.png"> - <meta id="bb-canon-url" name="bb-canon-url" content="https://bitbucket.org"> - - -<link rel="stylesheet" href="https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/compressed/css/0905f4428f6e.css" type="text/css" /> - - <!--[if lt IE 9]><link rel="stylesheet" href="https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/css/aui/aui-ie.css" media="all"><![endif]--> - <!--[if IE 9]><link rel="stylesheet" href="https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/css/aui/aui-ie9.css" media="all"><![endif]--> - <!--[if IE]><link rel="stylesheet" href="https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/css/aui-overrides-ie.css" media="all"><![endif]--> - <meta name="description" content=""/> - <link rel="search" type="application/opensearchdescription+xml" href="/opensearch.xml" title="Bitbucket" /> - - <link href="/jhpoelen/obo/rss" rel="alternate nofollow" type="application/rss+xml" title="RSS feed for obo" /> - -</head> -<body class="aui-layout production " - > -<script type="text/javascript" src="https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/compressed/js/e98deabf8a2e.js"></script> -<div id="page"> - <div id="wrapper"> - - <header id="header" role="banner"> - <nav class="aui-header aui-dropdown2-trigger-group" role="navigation"> - <div class="aui-header-inner"> - <div class="aui-header-primary"> - <h1 class="aui-header-logo aui-header-logo-bitbucket"> - <a href="/" class="aui-nav-imagelink"> - <span class="aui-header-logo-device">Bitbucket</span> - </a> - </h1> - <script id="repo-dropdown-template" type="text/html"> - - -[[#hasViewed]] - <div class="aui-dropdown2-section"> - <strong class="viewed">Recently viewed</strong> - <ul class="aui-list-truncate"> - [[#viewed]] - <li class="[[#is_private]]private[[/is_private]][[^is_private]]public[[/is_private]] repository"> - <a href="[[url]]" title="[[owner]]/[[name]]" class=" aui-icon-container"> - <img class="repo-avatar size16" src="[[{avatar}]]" alt="[[owner]]/[[name]] avatar"/> - [[owner]] / [[name]] - </a> - </li> - [[/viewed]] - </ul> - </div> -[[/hasViewed]] -[[#hasUpdated]] -<div class="aui-dropdown2-section"> - <strong class="updated">Recently updated</strong> - <ul class="aui-list-truncate"> - [[#updated]] - <li class="[[#is_private]]private[[/is_private]][[^is_private]]public[[/is_private]] repository"> - <a href="[[url]]" title="[[owner]]/[[name]]" class=" aui-icon-container"> - <img class="repo-avatar size16" src="[[{avatar}]]" alt="[[owner]]/[[name]] avatar"/> - [[owner]] / [[name]] - </a> - </li> - [[/updated]] - </ul> -</div> -[[/hasUpdated]] - -</script> - <ul role="menu" class="aui-nav"> - - <li> - <a href="/plans"> - Pricing & Signup - </a> - </li> - <li> - <a href="/whats-new"> - What's new - </a> - </li> - - </ul> - </div> - <div class="aui-header-secondary"> - <ul role="menu" class="aui-nav"> - <li> - <form action="/repo/all" method="get" class="aui-quicksearch"> - <label for="search-query" class="assistive">owner/repository</label> - <input id="search-query" class="search" type="text" placeholder="owner/repository" name="name"> - </form> - </li> - <li> - <a class="aui-dropdown2-trigger"aria-controls="header-help-dropdown" aria-owns="header-help-dropdown" - aria-haspopup="true" data-container="#header .aui-header-inner" href="#header-help-dropdown"> - <span class="aui-icon aui-icon-small aui-iconfont-help">Help</span><span class="aui-icon-dropdown"></span> - </a> - <nav id="header-help-dropdown" class="aui-dropdown2 aui-style-default aui-dropdown2-in-header" aria-hidden="true"> - <div class="aui-dropdown2-section"> - <ul> - <li> - <a href="/whats-new" id="features-link"> - What's new - </a> - </li> - </ul> - </div> - <div class="aui-dropdown2-section"> - <ul> - <li><a href="https://confluence.atlassian.com/display/BITBUCKET/bitbucket+Documentation+Home" target="_blank">Documentation</a></li> - <li><a href="https://confluence.atlassian.com/display/BITBUCKET/bitbucket+101" target="_blank">Bitbucket 101</a></li> - <li><a href="https://confluence.atlassian.com/display/BBKB/Bitbucket+Knowledge+Base+Home" target="_blank">Knowledge base</a></li> - </ul> - </div> - <div class="aui-dropdown2-section"> - <ul> - <li><a href="https://answers.atlassian.com/tags/bitbucket/" target="_blank">Bitbucket on Atlassian Answers</a></li> - <li><a href="/support">Support</a></li> - </ul> - </div> - </nav> - </li> - - <li id="user-options"> - <a href="/account/signin/?next=/jhpoelen/obo/src" class="aui-nav-link login-link">Log in</a> - </li> - - </ul> - </div> - </div> - </nav> - </header> - <header id="account-warning" role="banner" - class="aui-message-banner warning "> - <div class="center-content"> - <span class="aui-icon aui-icon-warning"></span> - <span class="message"> - - </span> - </div> - </header> - - <header id="aui-message-bar"> - - </header> - - - <header id="repo-warning" role="banner" class="aui-message-banner warning"> - <div class="center-content"> - <span class="aui-icon aui-icon-warning"></span> - <span class="message"> - </span> - </div> - </header> - <script id="repo-warning-template" type="text/html"> - - - - - - This repository's ownership is pending transfer to <a href="/[[username]]">[[username]]</a>. - Visit the <a href="/jhpoelen/obo/admin/transfer">transfer repository page</a> to view more details. - - -</script> - <header id="repo-header" class="subhead row"> - <div class="center-content"> - <div class="repo-summary"> - <a class="repo-avatar-link" href="/jhpoelen/obo"> - <span class="repo-avatar-container size64" title="jhpoelen/obo"> - <img alt="jhpoelen/obo" src="https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/img/language-avatars/default_64.png"/> -</span> - - - </a> - <h1><a class="repo-link" href="/jhpoelen/obo">obo</a></h1> - <ul class="repo-metadata clearfix"> - <li> - <a class="user" href="/jhpoelen"> - <span class="icon user">User icon</span> - <span>jhpoelen</span> - </a> - </li> - - - <li class="social"> - <a class="follow" id="repo-follow" - rel="nofollow" - href="/jhpoelen/obo/follow"> - <span class="icon follow">Follow icon</span> - <span class="text">Follow</span> - </a> - </li> - - </ul> - </div> - <div id="repo-toolbar" class="bb-toolbar"> - - <div class="aui-buttons"> - <a id="repo-clone-button" class="aui-button aui-style" href="https://bitbucket.org/jhpoelen/obo"> - <span class="icon clone">Clone icon</span> - <span>Clone</span> - <span class="aui-icon-dropdown"></span> - </a> - <a id="fork-button" class="aui-button aui-style" - href="/jhpoelen/obo/fork"> - <span class="icon fork">Fork icon</span> - <span>Fork</span> - </a> - </div> - <div class="aui-buttons"> - <a id="compare-button" class="aui-button aui-style" - href="/jhpoelen/obo/compare"> - <span class="icon compare">Compare icon</span> - <span>Compare</span> - </a> - <a id="pull-request-button" class="aui-button aui-style" - href="/jhpoelen/obo/pull-request/new"> - <span class="icon pull-request">Pull request icon</span> - <span>Pull request</span> - </a> - </div> - - - -<div id="repo-clone-dialog" class="clone-dialog hidden"> - -<div class="clone-url"> - <div class="aui-buttons"> - <a href="https://bitbucket.org/jhpoelen/obo" - class="aui-button aui-style aui-dropdown2-trigger" aria-haspopup="true" - aria-owns="clone-url-dropdown-header"> - <span class="dropdown-text">HTTPS</span> - </a> - <div id="clone-url-dropdown-header" class="aui-dropdown2 aui-style-default"> - <ul class="aui-list-truncate"> - <li> - <a href="https://bitbucket.org/jhpoelen/obo" - - data-command="hg clone https://bitbucket.org/jhpoelen/obo" - - class="item-link https">HTTPS - </a> - </li> - <li> - <a href="ssh://hg@bitbucket.org/jhpoelen/obo" - - data-command="hg clone ssh://hg@bitbucket.org/jhpoelen/obo" - - class="item-link ssh">SSH - </a> - </li> - </ul> - </div> - <input type="text" readonly="readonly" value="hg clone https://bitbucket.org/jhpoelen/obo"> - </div> - - <p>Need help cloning? Visit - <a href="https://confluence.atlassian.com/x/cgozDQ" target="_blank">Bitbucket 101</a>.</p> - -</div> - - - - - - -<div class="clone-in-sourcetree" - data-https-url="https://bitbucket.org/jhpoelen/obo" - data-ssh-url="ssh://hg@bitbucket.org/jhpoelen/obo"> - <p><button class="aui-button aui-style aui-button-primary">Clone in SourceTree</button></p> - - <p><a href="http://www.sourcetreeapp.com" target="_blank">SourceTree</a> - is a free Mac client by Atlassian for Git, Mercurial and Subversion.</p> -</div> - - -</div> - - </div> - </div> - <div class="clearfix"></div> - </header> - <nav id="repo-tabs" class="aui-navgroup aui-navgroup-horizontal aui-navgroup-horizontal-roomy"> - <div class="aui-navgroup-inner"> - <div class="aui-navgroup-primary"> - <ul class="aui-nav"> - - <li> - <a href="/jhpoelen/obo/overview" id="repo-overview-link">Overview</a> - </li> - - - <li class="aui-nav-selected"> - <a href="/jhpoelen/obo/src" id="repo-source-link">Source</a> - </li> - - - <li> - <a href="/jhpoelen/obo/commits" id="repo-commits-link"> - Commits - </a> - </li> - - - <li> - <a href="/jhpoelen/obo/pull-requests" id="repo-pullrequests-link"> - Pull requests - - - - </a> - </li> - - - - - <li id="issues-tab" class=" - - hidden - - "> - <a href="/jhpoelen/obo/issues?status=new&status=open" id="repo-issues-link"> - Issues - - - - </a> - </li> - <li id="wiki-tab" class=" - - hidden - - "> - <a href="/jhpoelen/obo/wiki" id="repo-wiki-link">Wiki</a> - </li> - - <li> - <a href="/jhpoelen/obo/downloads" id="repo-downloads-link"> - Downloads - - - - </a> - </li> - - </ul> - </div> - <div class="aui-navgroup-secondary"> - <ul class="aui-nav"> - - </ul> - </div> - </div> - </nav> - - <div id="content" role="main"> - - <div id="repo-content"> - - - <div id="source-container"> - - - - -<header id="source-path"> - - <div class="labels labels-csv"> - - <div class="aui-buttons"> - <button data-branches-tags-url="/api/1.0/repositories/jhpoelen/obo/branches-tags" - class="aui-button aui-style branch-dialog-trigger" title="default"> - - - <span class="branch icon">Branch</span> - - <span class="name">default</span> - - <span class="aui-icon-dropdown"></span> - </button> - </div> - - </div> - - - <h1> - <a href="/jhpoelen/obo/src/aa5dc8850678?at=default" - class="pjax-trigger" title="">obo</a> / - - - - - - - - </h1> - - - - - <div class="clearfix"></div> -</header> - - - <table id="source-list" class="aui bb-list"> - <thead> - <tr> - <th class="name">Filename</th> - <th class="size">Size</th> - <th class="date">Date modified</th> - <th class="text">Message</th> - - </tr> - </thead> - <tbody> - - - <tr class="iterable-item"> - - <td class="name dirname" colspan="4"> - <a href="/jhpoelen/obo/src/aa5dc88506780fecccd36ac8f7a5fd6759ad8cab/test-data?at=default" title="" - class="pjax-trigger execute">test-data</a> - </td> - - - </tr> - - - <tr class="iterable-item"> - <td class="name filename"> - <div> - <a href="/jhpoelen/obo/src/aa5dc88506780fecccd36ac8f7a5fd6759ad8cab/README?at=default" - title="README" - class="pjax-trigger execute">README</a> - </div> - </td> - - - <td class="size"> - <div> - 418 B - </div> - </td> - - - <td class="date"> - <div> - <time datetime="2013-02-07T00:52:02+00:00" data-title="true">21 hours ago</time> - </div> - </td> - <td class="text"> - <div> - - First commit. - - </div> - </td> - - - - </tr> - - <tr class="iterable-item"> - <td class="name filename"> - <div> - <a href="/jhpoelen/obo/src/aa5dc88506780fecccd36ac8f7a5fd6759ad8cab/fetch_ontology.xml?at=default" - title="fetch_ontology.xml" - class="pjax-trigger execute">fetch_ontology.xml</a> - </div> - </td> - - - <td class="size"> - <div> - 846 B - </div> - </td> - - - <td class="date"> - <div> - <time datetime="2013-02-07T00:52:02+00:00" data-title="true">21 hours ago</time> - </div> - </td> - <td class="text"> - <div> - - First commit. - - </div> - </td> - - - - </tr> - - <tr class="iterable-item"> - <td class="name filename"> - <div> - <a href="/jhpoelen/obo/src/aa5dc88506780fecccd36ac8f7a5fd6759ad8cab/tool_dependencies.xml?at=default" - title="tool_dependencies.xml" - class="pjax-trigger execute">tool_dependencies.xml</a> - </div> - </td> - - - <td class="size"> - <div> - 858 B - </div> - </td> - - - <td class="date"> - <div> - <time datetime="2013-02-07T00:52:02+00:00" data-title="true">21 hours ago</time> - </div> - </td> - <td class="text"> - <div> - - First commit. - - </div> - </td> - - - - </tr> - - - </tbody> - </table> - - <section id="readme"> - <article class="readme file"> - <pre class="plaintext">The following libraries need to be installed to use the obo tools: - -# termfinder needs g++ and other build tools -sudo apt-get $APT_OPTS install build-essential - -# perl dbi / perl DBD::mysql -sudo apt-get $APT_OPTS install libdbi-perl libdbd-mysql-perl - -# GO:TermFinder needs dependencies GraphViz and GD graphics libraries -sudo apt-get $APT_OPTS install libgraphviz-perl -sudo apt-get $APT_OPTS install libgd-gd2-perl -</pre> - </article> - </section> - - - - -<div class="mask"></div> - - - - <script id="branch-dialog-template" type="text/html"> - - -<div class="tabbed-filter-widget branch-dialog"> - <div class="tabbed-filter"> - <input placeholder="Filter branches" class="filter-box" autosave="branch-dropdown-2118082" type="text"> - [[^ignoreTags]] - <div class="aui-tabs horizontal-tabs aui-tabs-disabled filter-tabs"> - <ul class="tabs-menu"> - <li class="menu-item active-tab"><a href="#branches">Branches</a></li> - <li class="menu-item"><a href="#tags">Tags</a></li> - </ul> - </div> - [[/ignoreTags]] - </div> - - <div class="tab-pane active-pane" id="branches" data-filter-placeholder="Filter branches"> - <ol class="filter-list"> - <li class="empty-msg">No matching branches</li> - [[#branches]] - [[#hasMultipleHeads]] - [[#heads]] - <li class="comprev filter-item"> - <a href="/jhpoelen/obo/src/[[changeset]]/?at=[[safeName]]" - title="[[name]]"> - [[name]] ([[shortChangeset]]) - </a> - </li> - [[/heads]] - [[/hasMultipleHeads]] - [[^hasMultipleHeads]] - <li class="comprev filter-item"> - <a href="/jhpoelen/obo/src/[[changeset]]/?at=[[safeName]]" title="[[name]]"> - [[name]] - </a> - </li> - [[/hasMultipleHeads]] - [[/branches]] - </ol> - </div> - <div class="tab-pane" id="tags" data-filter-placeholder="Filter tags"> - <ol class="filter-list"> - <li class="empty-msg">No matching tags</li> - [[#tags]] - <li class="comprev filter-item"> - <a href="/jhpoelen/obo/src/[[changeset]]/?at=[[safeName]]" title="[[name]]"> - [[name]] - </a> - </li> - [[/tags]] - </ol> - </div> - -</div> - -</script> - - - - </div> - - - </div> - - - -<form id="file-search-form" action="#" - data-revision="aa5dc88506780fecccd36ac8f7a5fd6759ad8cab" - data-branch="default"> - <input type="text" id="file-search-query" class="loading"> - <div id="filtered-files"></div> - <div class="tip"><em>Tip:</em> Filter by directory path e.g. <strong>/media app.js</strong> to search for public<strong>/media/app.js</strong>.</div> - <div class="tip"><em>Tip:</em> Use camelCasing e.g. <strong>ProjME</strong> to search for <strong>ProjectModifiedE</strong>vent.java.</div> - <div class="tip"><em>Tip:</em> Filter by extension type e.g. <strong>/repo .js</strong> to search for all <strong>.js</strong> files in the <strong>/repo</strong> directory.</div> - <div class="tip"><em>Tip:</em> Separate your search with spaces e.g. <strong>/ssh pom.xml</strong> to search for src<strong>/ssh/pom.xml</strong>.</div> - <div class="tip"><em>Tip:</em> Use ↑ and ↓ arrow keys to navigate and <strong>return</strong> to view the file.</div> - <div class="tip"><em>Tip:</em> You can also navigate files with <strong>Ctrl+j</strong> <em>(next)</em> and <strong>Ctrl+k</strong> <em>(previous)</em> and view the file with <strong>Ctrl+o</strong>.</div> - <script id="filtered-files-template" type="text/html"> - - -<table class="aui bb-list"> - <thead> - <tr class="assistive"> - <th class="name">Filename</th> - </tr> - </thead> - <tbody> - [[#files]] - <tr class="iterable-item"> - <td class="name [[#isDirectory]]directory[[/isDirectory]]"> - <a href="/jhpoelen/obo/src/[[node]]/[[name]][[#branch]]?at=[[branch]][[/branch]]" - title="[[name]]" class="execute" tabindex="-1"> - [[&highlightedName]] - </a> - </td> - </tr> - [[/files]] - </tbody> -</table> - -</script> -</form> - - - - </div> - </div> - <footer id="footer" role="contentinfo"> - <section class="footer-body"> - <ul> - <li><a href="http://blog.bitbucket.org">Blog</a></li> - <li><a href="//bitbucket.org/site/master/issues/new">Report a bug</a></li> - <li><a href="/support">Support</a></li> - <li><a href="http://confluence.atlassian.com/display/BITBUCKET">Documentation</a></li> - <li><a href="http://confluence.atlassian.com/x/IYBGDQ">API</a></li> - <li><a href="http://groups.google.com/group/bitbucket-users">Forum</a></li> - <li><a href="http://status.bitbucket.org/">Server status</a></li> - <li><a href="http://www.atlassian.com/hosted/terms.jsp">Terms of service</a></li> - <li><a href="http://www.atlassian.com/about/privacy.jsp">Privacy policy</a></li> - </ul> - <ul> - <li><a href="http://git-scm.com/">Git 1.7.10.3</a></li> - <li><a href="http://mercurial.selenic.com/">Mercurial 2.2.2</a></li> - <li><a href="https://www.djangoproject.com/">Django 1.3.1</a></li> - <li><a href="http://www.python.org/">Python 2.7.3</a></li> - <li><a href="#">86405223cfc3 / 86405223cfc3 @ bitbucket20</a></li> - </ul> - </section> - </footer> -</div> - -<script type="text/javascript" src="https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/compressed/js/30dafea7d607.js"></script> - -<!-- This script exists purely for the benefit of our selenium tests --> -<script> - setTimeout(function () { - BB.JsLoaded = true; - }, 3000); -</script> - - - -<script> - (function (window) { - // Base URL to use for non-CNAME URLs. - BB.baseUrl = 'https://bitbucket.org'; - - BB.images = { - invitation: 'https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/img/icons/fugue/card_address.png', - noAvatar: 'https://d3oaxc4q5k2d6q.cloudfront.net/m/86405223cfc3/img/default_avatar/16/user_blue.png' - }; - BB.user = {"isKbdShortcutsEnabled": true, "isSshEnabled": false, "isAuthenticated": false}; - BB.repo || (BB.repo = {}); - - BB.repo.id = 2118082; - BB.repo.scm = 'hg'; - - - BB.repo.language = null; - BB.repo.pygmentsLanguage = null; - - - BB.repo.slug = 'obo'; - - - BB.repo.owner = {}; - BB.repo.owner.username = 'jhpoelen'; - BB.repo.owner.is_team = false; - - - BB.repo.creator = {}; - BB.repo.creator.username = 'jhpoelen'; - - // Coerce `BB.repo` to a string to get - // "davidchambers/mango" or whatever. - BB.repo.toString = function () { - return BB.cname ? this.slug : '{owner.username}/{slug}'.format(this); - } - - BB.changeset = 'aa5dc88506780fecccd36ac8f7a5fd6759ad8cab' - - - - window.setInterval(BB.localize, 60 * 1000); - BB.localize(); - - })(window); -</script> - - -<script> - // Bitbucket Google Analytics - // NOTE: these will not fire in development. In debug mode it just logs them to console. - (function (window) { - // Track the main pageview to the Bitbucket GA account. - BB.gaqPush(['_trackPageview']); - // Track the main pageview to the Atlassian GA account. - BB.gaqPush(['atl._trackPageview']); - - - - - - - // Include GA commands from sub-templates - - - (function () { - var ga = document.createElement('script'); - ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; - ga.setAttribute('async', 'true'); - document.documentElement.firstChild.appendChild(ga); - }()); - })(window); -</script> - - - -</body> -</html>
--- a/test-data/freebayes_out_1.output_trace Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -phiX174,1411,allele,phiX174,phiX174,A,60,100 -phiX174,1412,allele,phiX174,phiX174,G,60,100 -phiX174,1413,allele,phiX174,phiX174,C,60,100 -phiX174,1414,allele,phiX174,phiX174,G,60,100 -phiX174,1415,allele,phiX174,phiX174,C,60,100 -phiX174,1416,allele,phiX174,phiX174,C,60,100 -phiX174,1417,allele,phiX174,phiX174,G,60,100 -phiX174,1418,allele,phiX174,phiX174,T,60,100
--- a/test-data/freebayes_out_1.vcf.contains Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A -
--- a/test-data/phiX.fasta Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,79 +0,0 @@ ->phiX174 -GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT -GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA -ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG -TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA -GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC -TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT -TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT -CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT -TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG -TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC -GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA -CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG -TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT -AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC -CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA -TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC -TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA -CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA -GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT -GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA -ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC -TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT -TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC -ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC -CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT -GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC -CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC -TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG -TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT -TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA -AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT -TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT -ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC -GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC -TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT -TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA -TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG -TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC -CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG -AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC -CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT -TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG -CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA -AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT -GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG -GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA -TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT -CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG -TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA -GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC -CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA -TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA -AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC -TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT -CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA -TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG -TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT -CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT -TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC -ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG -TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA -ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG -GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC -CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT -GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG -GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT -ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG -CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC -CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC -GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT -CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG -CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA -TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT -TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG -TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC -AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC -TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA -
--- a/tool_data_table_conf.xml.sample Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> -<tables> - <!-- Location of SAMTools indexes and other files --> - <table name="sam_fa_indexes" comment_char="#"> - <columns>line_type, value, path</columns> - <file path="tool-data/sam_fa_indices.loc" /> - </table> -</tables>
--- a/tool_dependencies.xml Thu Feb 07 16:57:42 2013 -0500 +++ b/tool_dependencies.xml Thu Feb 07 16:58:40 2013 -0500 @@ -1,47 +1,20 @@ <?xml version="1.0"?> <tool_dependency> - <package name="freebayes" version="0.9.6_9608597d12e127c847ae03aa03440ab63992fedf"> + <package name="obo_scripts" version="1.0.1"> <install version="1.0"> <actions> - <action type="shell_command">git clone --recursive git://github.com/ekg/freebayes.git</action> - <action type="shell_command">git checkout 9608597d12e127c847ae03aa03440ab63992fedf</action> - <action type="shell_command">git submodule update --recursive</action> - <action type="shell_command">make</action> + <action type="shell_command">git clone http://github.com/cmungall/obo-scripts</action> <action type="move_directory_files"> - <source_directory>bin</source_directory> - <destination_directory>$INSTALL_DIR/bin</destination_directory> + <destination_directory>$INSTALL_DIR</destination_directory> </action> <action type="set_environment"> + <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR</environment_variable> <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR/bin</environment_variable> </action> </actions> </install> <readme> -FreeBayes requires g++ and the standard C and C++ development libraries. -Additionally, cmake is required for building the BamTools API. - </readme> - </package> - <package name="samtools" version="0.1.18"> - <install version="1.0"> - <actions> - <action type="download_by_url">http://sourceforge.net/projects/samtools/files/samtools/0.1.18/samtools-0.1.18.tar.bz2</action> - <action type="shell_command">sed -i.bak -e 's/-lcurses/-lncurses/g' Makefile</action> - <action type="shell_command">make</action> - <action type="move_file"> - <source>samtools</source> - <destination>$INSTALL_DIR/bin</destination> - </action> - <action type="move_file"> - <source>misc/maq2sam-long</source> - <destination>$INSTALL_DIR/bin</destination> - </action> - <action type="set_environment"> - <environment_variable name="PATH" action="prepend_to">$INSTALL_DIR/bin</environment_variable> - </action> - </actions> - </install> - <readme> -Compiling SAMtools requires the ncurses and zlib development libraries. + obo_scripts require perl to be installed. </readme> </package> </tool_dependency>