Mercurial > repos > jjohnson > gmap
diff gsnap.xml @ 0:10e3476429b5 draft
Uploaded
| author | jjohnson |
|---|---|
| date | Fri, 05 Oct 2012 13:51:49 -0400 |
| parents | |
| children | 74391fc6e3f2 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gsnap.xml Fri Oct 05 13:51:49 2012 -0400 @@ -0,0 +1,864 @@ +<tool id="gsnap" name="GSNAP" version="2.0.1"> + <description>Genomic Short-read Nucleotide Alignment Program</description> + <requirements> + <requirement type="binary">gsnap</requirement> + </requirements> + <version_string>gsnap --version</version_string> + <command> + #import os.path, re + gsnap + --nthreads="4" --ordered + #if $refGenomeSource.genomeSource == "gmapdb": + #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0] + --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name + #else: + --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value) + #end if + #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2: + --kmer=$refGenomeSource.kmer + #end if + #if $refGenomeSource.use_splicing.src == 'gmapdb': + #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0: + -s $refGenomeSource.use_splicing.splicemap.value + #if $computation.trim_mismatch_score.__str__ == '0': + $ambig_splice_noclip + #end if + #end if + #elif $refGenomeSource.use_splicing.src == 'history': + #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0: + -S $os.path.dirname($refGenomeSource.use_splicing.splicemap) -s $os.path.basename($refGenomeSource.use_splicing.splicemap) + #if $computation.trim_mismatch_score.__str__ == '0': + $ambig_splice_noclip + #end if + #end if + #end if + #if $refGenomeSource.use_snps.src == 'gmapdb': + #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0: + -v $refGenomeSource.use_snps.snpindex.value + #end if + #elif $refGenomeSource.use_snps.src == 'history': + #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0: + -V $refGenomeSource.use_snps.snpindex.extra_files_path -v $refGenomeSource.use_snps.snpindex.metadata.snps_name + #end if + #end if + #if $refGenomeSource.mode.__str__ != '': + --mode=$refGenomeSource.mode + #end if + #* ## No longer in options as of version 2011-11-30 + #if $mapq_unique_score.__str__ != '': + --mapq-unique-score=$mapq_unique_score + #end if + *# + #if $computation.options == "advanced": + #if $computation.max_mismatches.__str__ != '': + --max-mismatches=$computation.max_mismatches + #end if + $computation.query_unk_mismatch + $computation.genome_unk_mismatch + #if $computation.terminal_threshold.__str__ != '': + --terminal-threshold=$computation.terminal_threshold + #end if + #if $computation.indel_penalty.__str__ != '': + --indel-penalty=$computation.indel_penalty + #end if + #if $computation.indel_endlength.__str__ != '': + --indel-endlength=$computation.indel_endlength + #end if + #if $computation.max_middle_insertions.__str__ != '': + --max-middle-insertions=$computation.max_middle_insertions + #end if + #if $computation.max_middle_deletions.__str__ != '': + --max-middle-deletions=$computation.max_middle_deletions + #end if + #if $computation.max_end_insertions.__str__ != '': + --max-end-insertions=$computation.max_end_insertions + #end if + #if $computation.max_end_deletions.__str__ != '': + --max-end-deletions=$computation.max_end_deletions + #end if + #if $computation.suboptimal_levels.__str__ != '': + --suboptimal-levels=$computation.suboptimal_levels + #end if + #if $computation.adapter_strip.__str__ != '': + --adapter-strip=$computation.adapter_strip + #end if + #if $computation.trim_mismatch_score.__str__ != '': + --trim-mismatch-score=$computation.trim_mismatch_score + #end if + #if $computation.trim_indel_score.__str__ != '': + --trim-indel-score=$computation.trim_indel_score + #end if + ## TODO - do we need these options (Is it tally XOR runlength?): + ## --tallydir= --use-tally=tally + ## --runlengthdir --use-runlength=runlength + #if $computation.use_tally != None and len($computation.use_tally.__str__) > 0: + ##--tallydir $os.path.dirname($computation.use_tally) --use-tally $os.path.basename($computation.use_tally) + --use-tally=$computation.use_tally + #end if + ## gmap options + #if $computation.gmap_mode.__str__ != '' and $computation.gmap_mode.__str__ != 'None': + --gmap-mode='$computation.gmap_mode' + #end if + #if $computation.trigger_score_for_gmap.__str__ != '': + --trigger-score-for-gmap=$computation.trigger_score_for_gmap + #end if + #if $computation.max_gmap_pairsearch.__str__ != '' and $re.search("pairsearch",$computation.gmap_mode): + --max-gmap-pairsearch=$computation.max_gmap_pairsearch + #end if + #if $computation.max_gmap_terminal.__str__ != '' and $re.search("terminal",$computation.gmap_mode): + --max-gmap-terminal=$computation.max_gmap_terminal + #end if + #if $computation.max_gmap_improvement.__str__ != '' and $re.search("improv",$computation.gmap_mode): + --max-gmap-improvement=$computation.max_gmap_improvement + #end if + #if $computation.microexon_spliceprob.__str__ != '': + --microexon-spliceprob=$computation.microexon_spliceprob + #end if + #end if + #if $splicing.options == "advanced": + $splicing.novelsplicing + #if $splicing.localsplicedist.__str__ != '': + --localsplicedist=$splicing.localsplicedist + #end if + #if $splicing.local_splice_penalty.__str__ != '': + --local-splice-penalty=$splicing.local_splice_penalty + #end if + #if $splicing.distant_splice_penalty.__str__ != '': + --distant-splice-penalty=$splicing.distant_splice_penalty + #end if + #if $splicing.local_splice_endlength.__str__ != '': + --local-splice-endlength=$splicing.local_splice_endlength + #end if + #if $splicing.distant_splice_endlength.__str__ != '': + --distant-splice-endlength=$splicing.distant_splice_endlength + #end if + #if $splicing.distant_splice_identity.__str__ != '': + --distant-splice-identity=$splicing.distant_splice_identity + #end if + #end if + #if $output.options == "advanced": + #if $output.npath.__str__ != '': + --npath=$output.npath + #end if + $output.quiet_if_excessive + $output.show_refdiff + $output.clip_overlap + #end if + #if $result.format == "sam": + --format=sam + $result.no_sam_headers + #if $result.read_group_id.__str__.strip != '': + --read-group-id='$result.read_group_id' + #end if + #if $result.read_group_name.__str__ != '': + --read-group-name='$result.read_group_name' + #end if + #if $result.read_group_library.__str__ != '': + --read-group-library='$result.read_group_library' + #end if + #if $result.read_group_platform.__str__ != '': + --read-group-platform='$result.read_group_platform' + #end if + #if $result.quality_shift.__str__ != '': + --quality-shift=$result.quality_shift + #end if + #elif $result.format == "goby": + #if $result.goby_output.__str__ != '': + --goby-output='$result.goby_output' + #end if + #if $result.creads_window_start.__str__ != '': + --creads-window-start=$result.creads_window_start + #end if + #if $result.creads_window_end.__str__ != '': + --creads-window-end=$result.creads_window_end + #end if + $result.creads_complement + #end if + #if $results.split_output == 'yes': + --split-output=gsnap_out + #if $results.fails.choice == 'nofails': + --nofails + #elif $results.fails.choice == 'failsonly': + --failsonly + #end if + $results.fails_as_input + #else + #if $results.fails.choice == 'nofails': + --nofails + #elif $results.fails.choice == 'failsonly': + --failsonly + $results.fails.fails_as_input + #end if + #end if + #if $seq.format == "gsnap_fasta": + $seq.circularinput $seq.gsnap + #else if $seq.format == "fastq": + #if $seq.barcode_length.__str__ != '': + --barcode-length=$seq.barcode_length + #end if + #if $seq.fastq_id_start.__str__ != '': + --fastq-id-start=$seq.fastq_id_start + #end if + #if $seq.fastq_id_end.__str__ != '': + --fastq-id-end=$seq.fastq_id_end + #end if + #if $seq.filter_chastity.__str__ != 'off': + --filter-chastity=$seq.filter_chastity + #end if + #if $seq.paired.ispaired.__str__ == 'yes': + #if $seq.paired.pairmax_dna.__str__ != '': + --pairmax-dna=$seq.paired.pairmax_dna + #end if + #if $seq.paired.pairmax_rna.__str__ != '': + --pairmax-rna=$seq.paired.pairmax_rna + #end if + #if $seq.paired.pairexpect.__str__ != '': + --pairexpect=$seq.paired.pairexpect + #end if + #if $seq.paired.pairdev.__str__ != '': + --pairdev=$seq.paired.pairdev + #end if + $seq.fastq $seq.paired.fastq + #else + $seq.fastq + #end if + #end if + #if $results.split_output == 'yes': + 2> $gsnap_stderr + #else: + #if $results.fails.choice.__str__ == 'failsonly' and $results.fails.fails_as_input.__str__ != '': + 2> $gsnap_stderr > $gsnap_fq + #else + 2> $gsnap_stderr > $gsnap_out + #end if + #end if + + </command> + <inputs> + <!-- Input data --> + <conditional name="seq"> + <param name="format" type="select" label="<H2>Input Sequences</H2>Select the input format" help=""> + <option value="fastq">Fastq</option> + <!-- + <option value="goby">Goby compact-reads</option> + --> + <option value="gsnap_fasta">GNSAP fasta</option> + </param> + <when value="fastq"> + <param name="fastq" type="data" format="fastq" label="Select a fastq dataset" /> + <conditional name="paired"> + <param name="ispaired" type="boolean" truevalue="yes" falsevalue="no" checked="false" label="Use Paired Reads?"/> + <when value="no"/> + <when value="yes"> + <param name="fastq" type="data" format="fastq" label="Select the paired reads reverse dataset" /> + <param name="orientation" type="select" label="Orientation of paired-end reads" help=""> + <option value="FR">fwd-rev, typical Illumina default</option> + <option value="RF">rev-fwd, for circularized inserts</option> + <option value="FF">fwd-fwd, same strand</option> + </param> + <param name="pairmax_dna" type="integer" value="" optional="true" label="Max total genomic length for DNA-Seq paired reads, or other reads without splicing (default 1000)." help="Used if no splice file is provided and novelsplicing is off."/> + <param name="pairmax_rna" type="integer" value="" optional="true" label="Max total genomic length for RNA-Seq paired reads, or other reads that could have a splice (default 200000)." help="Used when novel splicing is specified or a splice file is provided. Should probably match the value for localsplicedist."/> + <param name="pairexpect" type="integer" value="" optional="true" label="Expected paired-end length" + help="Used for calling splices in medial part of paired-end reads (default 200)"/> + <param name="pairdev" type="integer" value="" optional="true" label="Allowable deviation from expected paired-end length" + help="Used for calling splices in medial part of paired-end reads (default 25)"/> + </when> + </conditional> + <param name="barcode_length" type="integer" value="" optional="true" label="Amount of barcode to remove from start of read (default 0)" /> + <param name="fastq_id_start" type="integer" value="" optional="true" label="Starting field of identifier in FASTQ header, whitespace-delimited, starting from 1" /> + <param name="fastq_id_end" type="integer" value="" optional="true" label="Ending field of identifier in FASTQ header, whitespace-delimited, starting from 1" + help="Examples: + <br>@HWUSI-EAS100R:6:73:941:1973#0/1 + <br> . start=1, end=1 (default) => identifier is HWUSI-EAS100R:6:73:941:1973#0/1 + <br>@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 + <br> . start=1, end=1 => identifier is SRR001666.1 + <br> . start=2, end=2 => identifier is 071112_SLXA-EAS1_s_7:5:1:817:345 + <br> . start=1, end=2 => identifier is SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345" + /> + <param name="filter_chastity" type="select" label="Skip reads marked by the Illumina chastity program" + help="String after the accession having a 'Y' after the first colon, like this: + <br>@accession 1:Y:0:CTTGTA + <br>where the 'Y' signifies filtering by chastity. + <br> For 'either', a 'Y' on either end of a paired-end read will be filtered. + <br> For 'both', a 'Y' is required on both ends of a paired-end read (or on the only end of a single-end read)" + > + <option value="off">off - no filtering</option> + <option value="either">either - a 'Y' on either end of a paired-end read</option> + <option value="both">both - a 'Y' is required on both ends of a paired-end read or the only end of a single-end read</option> + </param> + </when> + <!-- + <when value="goby"> + </when> + --> + <when value="gsnap_fasta"> + <param name="gsnap" type="data" format="fasta" label="Select a single-end dataset" help="GSNAP fasta must have the sequence entirely on one line, a second line is interpreted as the paired-end sequence"/> + <param name="circularinput" type="boolean" checked="false" truevalue="--circular-input=true" falsevalue="" label="Circular-end data (paired reads are on same strand)"/> + </when> + + </conditional> + <!-- No longer in options as of version 2011-11-30 + <param name="mapq_unique_score" type="integer" value="" optional="true" label="MAPQ score threshold" + help="For multiple results, consider as a unique result if only one of the results has a MAPQ score equal or greater than this + (if not selected, then reports all multiple results, up to npaths)" /> + --> + + <!-- GMAPDB for alignment --> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="<HR><H2>Align To</H2>Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="gmapdb">Use a gmapdb from your history</option> + </param> + <when value="indexed"> + <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="gmap_indices.loc"> + <column name="uid" index="0" /> + <column name="dbkey" index="1" /> + <column name="name" index="2" /> + <column name="kmers" index="3" /> + <column name="maps" index="4" /> + <column name="snps" index="5" /> + <column name="value" index="6" /> + </options> + </param> + + <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size"> + <options from_file="gmap_indices.loc"> + <column name="name" index="3"/> + <column name="value" index="3"/> + <filter type="param_value" ref="gmapindex" column="6"/> + <filter type="multiple_splitter" column="3" separator=","/> + <filter type="add_value" name="" value=""/> + <filter type="sort_by" column="3"/> + </options> + </param> + + <param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase."> + <option value="">standard</option> + <option value="cmet-stranded">cmet-stranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> + <option value="cmet-nonstranded">cmet-nonstranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> + <option value="atoi-stranded">atoi-stranded for RNA-editing tolerance (A-to-G changes)</option> + <option value="atoi-nonstranded">atoi-nonstranded for RNA-editing tolerance (A-to-G changes)</option> + </param> + + <conditional name="use_splicing"> + <param name="src" type="select" label="<HR>Known Splicesite and Introns" + help="Look for splicing involving known sites or known introns at short or long distances + See README instructions for the distinction between known sites and known introns"> + <option value="none" selected="true">None</option> + <option value="gmapdb">From the GMAP Database</option> + <option value="history">A Map in your history</option> + </param> + <when value="none"/> + <when value="history"> + <param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map" + help="built with GMAP IIT"/> + </when> + <when value="gmapdb"> + <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help=""> + <options from_file="gmap_indices.loc"> + <column name="name" index="4"/> + <column name="value" index="4"/> + <filter type="param_value" ref="gmapindex" column="6"/> + <filter type="multiple_splitter" column="4" separator=","/> + <filter type="add_value" name="" value=""/> + <filter type="sort_by" column="4"/> + </options> + </param> + </when> + </conditional> + + <conditional name="use_snps"> + <param name="src" type="select" label="<HR>Known SNPs" help="for SNP tolerant alignments"> + <option value="none" selected="true">None</option> + <option value="gmapdb">From the GMAP Database</option> + <option value="history">A SNP Index in your history</option> + </param> + <when value="none"/> + <when value="history"> + <param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex" + help="built with GMAP SNP Index"/> + </when> + <when value="gmapdb"> + <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help=""> + <options from_file="gmap_indices.loc"> + <column name="name" index="5"/> + <column name="value" index="5"/> + <filter type="param_value" ref="gmapindex" column="6"/> + <filter type="multiple_splitter" column="5" separator=","/> + <filter type="add_value" name="" value=""/> + <filter type="sort_by" column="5"/> + </options> + </param> + </when> + </conditional> + + </when> + <when value="gmapdb"> + <param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb" + help="A GMAP database built with GMAP Build"/> + <param name="kmer" type="select" data_ref="gmapdb" label="kmer size" help="Defaults to highest available kmer size"> + <options> + <filter type="data_meta" ref="gmapdb" key="kmers" multiple="True" separator=","/> + </options> + </param> + + <param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase."> + <option value="">standard</option> + <option value="cmet-stranded">cmet-stranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> + <option value="cmet-nonstranded">cmet-nonstranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> + <option value="atoi-stranded">atoi-stranded for RNA-editing tolerance (A-to-G changes)</option> + <option value="atoi-nonstranded">atoi-nonstranded for RNA-editing tolerance (A-to-G changes)</option> + </param> + + <conditional name="use_splicing"> + <param name="src" type="select" label="<HR>Known Splicesite and Introns" + help="Look for splicing involving known sites or known introns at short or long distances + See README instructions for the distinction between known sites and known introns"> + <option value="none" selected="true">None</option> + <option value="gmapdb">From the GMAP Database</option> + <option value="history">A Map in your history</option> + </param> + <when value="none"/> + <when value="history"> + <param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map" + help="built with GMAP IIT"/> + <param name="ambig_splice_noclip" type="boolean" checked="false" truevalue="--ambig-splice-noclip" falsevalue="" label="Do not clip at ambiguous splice sites" + help="For ambiguous known splicing at ends of the read, do not clip at the splice site, but extend instead into the intron. + This flag makes sense only if you are trying to eliminate all soft clipping with --trim-mismatch-score=0"/> + </when> + <when value="gmapdb"> + <param name="splicemap" type="select" data_ref="gmapdb" label="Use map for splicing involving known sites or known introns" help=""> + <options> + <filter type="data_meta" ref="gmapdb" key="maps" multiple="True"/> + </options> + </param> + <param name="ambig_splice_noclip" type="boolean" checked="false" truevalue="--ambig-splice-noclip" falsevalue="" label="Do not clip at ambiguous splice sites" + help="For ambiguous known splicing at ends of the read, do not clip at the splice site, but extend instead into the intron. + This flag makes sense only if you are trying to eliminate all soft clipping with --trim-mismatch-score=0"/> + </when> + </conditional> + + <conditional name="use_snps"> + <param name="src" type="select" label="<HR>Known SNPs" help="for SNP tolerant alignments"> + <option value="none" selected="true">None</option> + <option value="gmapdb">From the GMAP Database</option> + <option value="history">A SNP Index in your history</option> + </param> + <when value="none"/> + <when value="history"> + <param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex" + help="built with GMAP SNP Index"/> + </when> + <when value="gmapdb"> + <param name="snpindex" type="select" data_ref="gmapdb" label="Use database containing known SNPs" help=""> + <options> + <filter type="data_meta" ref="gmapdb" key="snps" multiple="True" separator=","/> + </options> + </param> + </when> + </conditional> + + </when> + </conditional> + + <!-- Computation options --> + <conditional name="computation"> + <param name="options" type="select" label="<HR>Computational Settings" help=""> + <option value="default">Use default settings</option> + <option value="advanced">Set Computation Options</option> + </param> + <when value="default"/> + <when value="advanced"> + <param name="max_mismatches" type="float" value="" optional="true" label="Maximum number of mismatches allowed (uses default when negative)" + help="Defaults to the ultrafast level of ((readlength+2)/12 - 2)). + If specified between 0.0 and 1.0, then treated as a fraction + of each read length. Otherwise, treated as an integral number + of mismatches (including indel and splicing penalties) + For RNA-Seq, you may need to increase this value slightly + to align reads extending past the ends of an exon."> + <validator type="in_range" message="The mismatches must >= 0." min="0."/> + </param> + <param name="query_unk_mismatch" type="boolean" checked="false" truevalue="--query-unk-mismatch=1" falsevalue="" label="Count unknown (N) characters in the query as a mismatch"/> + <param name="genome_unk_mismatch" type="boolean" checked="true" truevalue="" falsevalue="--genome-unk-mismatch=0" label="Count unknown (N) characters in the genome as a mismatch"/> + <param name="terminal_threshold" type="integer" value="" optional="true" label="Threshold for searching for a terminal alignment (default 2)" + help="(from one end of the read to the best possible position at the other end). For example, if this value is 2, then if GSNAP finds an exact or + 1-mismatch alignment, it will not try to find a terminal alignment. + Note that this default value may not be low enough if you want to + obtain terminal alignments for very short reads, although such reads + probably don't have enough specificity for terminal alignments anyway." /> + <param name="indel_penalty" type="integer" value="" optional="true" label="Penalty for an indel (default 2)" + help="Counts against mismatches allowed. To find indels, make indel-penalty less than or equal to max-mismatches. A value < 2 can lead to false positives at read ends" /> + <param name="indel_endlength" type="integer" value="" optional="true" label="Minimum length at end required for indel alignments (default 4)" /> + <param name="max_middle_insertions" type="integer" value="" optional="true" label="Maximum number of middle insertions allowed (default 9)" /> + <param name="max_middle_deletions" type="integer" value="" optional="true" label="Maximum number of middle deletions allowed (default 30)" /> + <param name="max_end_insertions" type="integer" value="" optional="true" label="Maximum number of end insertions allowed (default 3)" /> + <param name="max_end_deletions" type="integer" value="" optional="true" label="Maximum number of end deletions allowed (default 6)" /> + <param name="suboptimal_levels" type="integer" value="" optional="true" label="Report suboptimal hits beyond best hit (default 0)" + help="All hits with best score plus suboptimal-levels are reported" /> + <param name="adapter_strip" type="select" label="Method for removing adapters from reads" + help="paired removes adapters from paired-end reads if a concordant or paired alignment cannot be found from the original read"> + <option value="paired" selected="true">paired</option> + <option value="off">off</option> + </param> + <param name="trim_mismatch_score" type="integer" value="" optional="true" label="Score to use for mismatches when trimming at ends (default is -3)" + help="to turn off trimming, specify 0 (Warning: turning trimming off will give false positive mismatches at the ends of reads)"/> + <param name="trim_indel_score" type="integer" value="" optional="true" label="Score to use for indels when trimming at ends (default is -4)" + help="to turn off trimming, specify 0 (Warning: turning trimming off will give false positive indels at the ends of reads)"/> + <param name="use_tally" type="data" format="tally.iit" optional="true" metadata_name="dbkey" label="Select a tally IIT file to resolve concordant multiple results" + help="generated by gsnap_tally and iit_store"/> + + <!-- + tallydir=STRING Directory for tally IIT file to resolve concordant multiple results (default is + location of genome index files specified using -D and -d). Note: can + just give full path name to use-tally instead. + use-tally=STRING Use this tally IIT file to resolve concordant multiple results + runlengthdir=STRING Directory for runlength IIT file to resolve concordant multiple results (default is + location of genome index files specified using -D and -d). Note: can + just give full path name to use-runlength instead. + use-runlength=STRING Use this runlength IIT file to resolve concordant multiple results + --> + + <!-- Options for GMAP alignment within GSNAP --> + <param name="gmap_mode" type="select" multiple="true" optional="true" display="checkboxes" label="Cases to use GMAP for complex alignments containing multiple splices or indels" + help="Default: pairsearch,terminal,improve"> + <option value="pairsearch" selected="true">pairsearch</option> + <option value="terminal" selected="true">terminal</option> + <option value="improve" selected="true">improve</option> + </param> + <param name="trigger_score_for_gmap" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 5)" + help="Try GMAP pairsearch on nearby genomic regions if best score (the total of both ends if paired-end) exceeds this value (default 5)" /> + <param name="max_gmap_pairsearch" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 3)" + help="Perform GMAP pairsearch on nearby genomic regions up to this many candidate ends (default 3)." /> + <param name="max_gmap_terminal" type="integer" value="" optional="true" label="GMAP terminal threshold (default 3)" + help="Perform GMAP terminal on nearby genomic regions up to this many candidate ends (default 3)." /> + <param name="max_gmap_improvement" type="integer" value="" optional="true" label="GMAP improvement threshold (default 3)" + help="Perform GMAP improvement on nearby genomic regions up to this many candidate ends (default 3)." /> + <param name="microexon_spliceprob" type="float" value="" optional="true" label="GMAP microexons threshold (default .90)" + help="Allow microexons only if one of the splice site probabilities is greater than this value." > + <validator type="in_range" message="The microexons probability must be between 0. and 1." min="0." max="1."/> + </param> + </when> + </conditional> + + <conditional name="splicing"> + <param name="options" type="select" label="<HR>Splicing options for RNA-Seq" help=""> + <option value="default">Use default settings</option> + <option value="advanced">Set Splicing Options</option> + </param> + <when value="default"/> + <when value="advanced"> + <!-- Splicing options for RNA-Seq --> + <!-- use-splicing This should be either a select list from the gmapdb maps or a data type using splicesdir and use-splicing --> + <!-- Neither novel splicing (-N) nor known splicing (-s) turned on => assume reads are DNA-Seq (genomic) --> + <param name="novelsplicing" type="boolean" checked="false" truevalue="--novelsplicing=1" falsevalue="" label="Look for novel splicing "/> + <param name="localsplicedist" type="integer" value="" optional="true" label="Definition of local novel splicing event (default 200000)"/> + <param name="local_splice_penalty" type="integer" value="" optional="true" label="Penalty for a local splice (default 0). Counts against mismatches allowed"/> + <param name="distant_splice_penalty" type="integer" value="" optional="true" label="Penalty for a distant splice (default 3). Counts against mismatches allowed" + help="A distant splice is one where the intron length exceeds the value of localsplicedist or is an + inversion, scramble, or translocation between two different chromosomes. Counts against mismatches allowed"/> + <param name="distant_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for distant spliced alignments" + help="(default 16, min is the kmer length)"/> + <param name="shortend_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for short-end spliced alignments" + help="(default 2, but unless known splice sites are provided, GSNAP may still need the end length to be the value of kmer size to find a given splice"/> + <param name="distant_splice_identity" type="float" value="" optional="true" label="Minimum identity at end required for distant spliced alignments (default 0.95)"/> + <param name="antistranded_penalty" type="integer" value="" optional="true" label="Penalty for antistranded splicing when using stranded RNA-Seq protocols" + help="A positive value, such as 1, expects antisense on the first read and sense on the second read. + Default is 0, which treats sense and antisense equally well"/> + </when> + </conditional> + + <!-- Output data --> + <conditional name="output"> + <param name="options" type="select" label="<HR><H2>Output</H2>Output options for RNA-Seq" help=""> + <option value="default">Use default settings</option> + <option value="advanced">Set Output Options</option> + </param> + <when value="default"/> + <when value="advanced"> + <param name="npath" type="integer" value="" optional="true" label="Maximum number of paths to print (default 100)"/> + <param name="quiet_if_excessive" type="boolean" checked="false" truevalue="--quiet-if-excessive" falsevalue="" label="Quiet if Excessive" + help="If more than maximum number of paths are found, then nothing is printed."/> + <param name="show_refdiff" type="boolean" checked="false" truevalue="--show-refdiff" falsevalue="" label="Show SNP-tolerant alignment" + help="For GSNAP output in SNP-tolerant alignment, shows all differences relative to the reference genome as lower case (otherwise, it shows all differences relative to both the reference and alternate genome)"/> + <param name="clip_overlap" type="boolean" checked="false" truevalue="--clip-overlap" falsevalue="" label="Clip Overlap" + help="For paired-end reads whose alignments overlap, clip the overlapping region."/> + </when> + </conditional> + <conditional name="result"> + <param name="format" type="select" label="Select the output format" help=""> + <option value="sam">SAM</option> + <!-- goby should only be an option if the input is in goby format + <option value="goby">Goby</option> + --> + <option value="gsnap">GSNAP default output</option> + </param> + <when value="gsnap"> + </when> + <when value="sam"> + <param name="no_sam_headers" type="boolean" truevalue="--no-sam-headers" falsevalue="" checked="false" label="Do not print headers beginning with '@'"/> + <param name="read_group_id" type="text" value="" optional="true" label="Value to put into read-group id (RG-ID) field"/> + <param name="read_group_name" type="text" value="" optional="true" label="Value to put into read-group name (RG-SM) field"/> + <param name="read_group_library" type="text" value="" optional="true" label="Value to put into read-group library (RG-LB) field"/> + <param name="read_group_platform" type="text" value="" optional="true" label="Value to put into read-group library platform (RG-PL) field"/> + <param name="quality_shift" type="integer" value="" optional="true" label="Shift FASTQ quality scores by this amount in SAM output (default -31)"/> + </when> + <!-- + <when value="goby"> + <param name="goby_output" type="text" value="" label="Basename for Goby output files"/> + <param name="creads_window_start" type="integer" value="" optional="true" label="Compact reads window start (default: 0=start of file)"/> + <param name="creads_window_end" type="integer" value="" optional="true" label="Compact reads window end (default: 0=end of file)"/> + <param name="creads_complement" type="boolean" truevalue="-\-creads-complement" falsevalue="" checked="false" label="Complement read sequences (without reversing)"/> + </when> + --> + </conditional> + <!-- TODO combine fails and split_output --> + + <conditional name="results"> + <param name="split_output" type="select" label="<HR>Split outputs" + help="Separate outputs for: nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, and concordant_mult results"> + <option value="no">no</option> + <option value="yes">yes</option> + </param> + <when value="no"> + <conditional name="fails"> + <param name="choice" type="select" label="How to deal with fails" help=""> + <option value="default">default - include them in results</option> + <option value="nofails">nofails - exclude fails from results</option> + <option value="failsonly">failsonly - only output failing results</option> + </param> + <when value="default"/> + <when value="nofails"/> + <when value="failsonly"> + <param name="fails_as_input" type="boolean" truevalue="--fails-as-input" falsevalue="" checked="false" label="Print completely failed alignments as input FASTA or FASTQ format" + help=""/> + </when> + </conditional> + </when> + <when value="yes"> + <conditional name="fails"> + <param name="choice" type="select" label="How to deal with fails" help=""> + <option value="default">default - include them in results</option> + <option value="nofails">nofails - exclude fails from results</option> + <option value="failsonly">failsonly - only output failing results</option> + </param> + <when value="default"/> + <when value="nofails"/> + <when value="failsonly"/> + </conditional> + <param name="fails_as_input" type="boolean" truevalue="--fails-as-input" falsevalue="" checked="false" label="Print completely failed alignments as input FASTA or FASTQ format" + help=""/> + </when> + </conditional> + + </inputs> + <outputs> + <data format="txt" name="gsnap_stderr" label="${tool.name} on ${on_string}: gsnap.log"/> + + <data format="txt" name="gsnap_out" label="${tool.name} on ${on_string} ${result.format}" > + <filter>(results['split_output'] == 'no' and (results['fails']['choice'] != 'failsonly' or results['fails']['fails_as_input'] == False))</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + + <data format="fastq" name="gsnap_fq" label="${tool.name} on ${on_string} fails.fq" > + <filter>(results['split_output'] == 'no' and results['fails']['choice'] == 'failsonly' and results['fails']['fails_as_input'] == True)</filter> + </data> + + <!-- nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, concordant_mult --> + + <data format="txt" name="unpaired_mult" label="${tool.name} on ${on_string} unpaired_mult.${result.format}" from_work_dir="gsnap_out.unpaired_mult"> + <filter>(results['split_output'] == 'yes')</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="unpaired_uniq" label="${tool.name} on ${on_string} unpaired_uniq.${result.format}" from_work_dir="gsnap_out.unpaired_uniq"> + <filter>(results['split_output'] == 'yes')</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="unpaired_transloc" label="${tool.name} on ${on_string} unpaired_transloc.${result.format}" from_work_dir="gsnap_out.unpaired_transloc"> + <filter>(results['split_output'] == 'yes')</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="halfmapping_mult" label="${tool.name} on ${on_string} halfmapping_mult.${result.format}" from_work_dir="gsnap_out.halfmapping_mult"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="halfmapping_uniq" label="${tool.name} on ${on_string} halfmapping_uniq.${result.format}" from_work_dir="gsnap_out.halfmapping_uniq"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="halfmapping_transloc" label="${tool.name} on ${on_string} halfmapping_transloc.${result.format}" from_work_dir="gsnap_out.halfmapping_transloc"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="paired_mult" label="${tool.name} on ${on_string} paired_mult.${result.format}" from_work_dir="gsnap_out.paired_mult"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="paired_uniq" label="${tool.name} on ${on_string} paired_uniq.${result.format}" from_work_dir="gsnap_out.paired_uniq"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="paired_transloc" label="${tool.name} on ${on_string} paired_transloc.${result.format}" from_work_dir="gsnap_out.paired_transloc"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + + <data format="txt" name="concordant_mult" label="${tool.name} on ${on_string} concordant_mult.${result.format}" from_work_dir="gsnap_out.concordant_mult"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="concordant_uniq" label="${tool.name} on ${on_string} concordant_uniq.${result.format}" from_work_dir="gsnap_out.concordant_uniq"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + <data format="txt" name="concordant_transloc" label="${tool.name} on ${on_string} concordant_transloc.${result.format}" from_work_dir="gsnap_out.concordant_transloc"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + + <data format="txt" name="nomapping" label="${tool.name} on ${on_string} nomapping.${result.format}" from_work_dir="gsnap_out.nomapping"> + <filter>(results['split_output'] == 'yes' and results['fails_as_input'] == False)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="gsnap" format="gsnap"/> + </change_format> + </data> + + <data format="fastq" name="nomapping_fq" label="${tool.name} on ${on_string} nomapping.fq" from_work_dir="gsnap_out.nomapping.fq"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == False)</filter> + </data> + + <data format="fastq" name="nomapping_1_fq" label="${tool.name} on ${on_string} nomapping.1.fq" from_work_dir="gsnap_out.nomapping.1.fq"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + </data> + + <data format="fastq" name="nomapping_2_fq" label="${tool.name} on ${on_string} nomapping.2.fq" from_work_dir="gsnap_out.nomapping.2.fq"> + <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> + </data> + + <!-- Will problay need wrapper code to generate composite datatype for goby alignment + <data format="gobyalignment" name="goby_alignment" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.nomapping"> + <filter>result['format'] == 'goby'</filter> + </data> + --> + + </outputs> + <tests> + </tests> + + <help> + +**What it does** + +GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc. +Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10. + +.. _GSNAP: http://research-pub.gene.com/gmap/ +.. _Publication: http://bioinformatics.oupjournals.org/cgi/content/full/26/7/873 +http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2844994/?tool=pubmed + +------ + +**Know what you are doing** + +.. class:: warningmark + +You will want to read the README_ + +.. _README: http://research-pub.gene.com/gmap/src/README + +------ + +**Input formats** + +Input to GSNAP should be either in FASTQ or FASTA format. + +The FASTQ input may include quality scores, which will then be included in SAM +output, if that output format is selected. + +For FASTA format, you should include one line per read (or end of a +paired-end read). The same FASTA file can have a mixture of +single-end and paired-end reads of varying lengths, if desired. + +Single-end reads: + +Each FASTA entry should contain one short read per line, like this + +>Header information +AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA + +Each short read can have a different length. However, the entire read +needs to be on a single line, and may not wrap around multiple lines. +If it extends to a second line, GSNAP will think that the read is +paired-end. + + +Paired-end reads: + +Each FASTA entry should contain two short reads, one per line, like +this + +>Header information +AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA +GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG + +By default, the program assumes that the second end is in the reverse +complement direction compared with the first end. If they are in the +same direction, you may need to use the --circular-input (or -c) flag. + +( The Galaxy tool: "FASTA Width formatter" can be used to reformat fasta files to have single line sequences. ) + +------ + +**Output formats in GSNAP** + +SAM output format + +Default GSNAP format + See the README_ + + + + + </help> +</tool> +