Mercurial > repos > jbrayet > rsat

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/peakMotifs_wrapper.xml	Tue Sep 22 05:14:36 2015 -0400
@@ -0,0 +1,239 @@
+<!--Peak Motifs - developed by Jocelyn Brayet <jocelyn.brayet@curie.fr>
+Copyright (C) 2015  Institut Curie
+
+This program is free software: you can redistribute it and/or modify
+it under the terms of the GNU General Public License as published by
+the Free Software Foundation, either version 3 of the License, or
+(at your option) any later version.
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+GNU General Public License for more details.
+
+You should have received a copy of the GNU General Public License
+along with this program.  If not, see <http://www.gnu.org/licenses/>.-->
+<tool id="rsat_peak_motifs" name="RSAT Peak Motifs" version="1.0">
+  <description>Create Logo images from peaks</description>
+  <command interpreter="python">
+    peakMotifs_wrapper.py -test $fastaFile -outGalaxy $htmlFile
+    #if $control_conditional.controle_file == "yes":
+      -control $control_conditional.controlFastaFile
+    #end if
+    -server $serverChoice.server
+    -motif_db $serverChoice.database
+    #if $advanced_parameters.adv_param == "show":
+      #if $advanced_parameters.restrict.restrictPeaks == "yes":
+        -top_peaks $advanced_parameters.restrict.top_peaks
+        -max_seq_length $advanced_parameters.restrict.max_seq_length
+      #end if
+      #if $advanced_parameters.motif.motifDiscovery == "yes":
+        #if $advanced_parameters.motif.algorithms.value:
+          -disco $advanced_parameters.motif.algorithms
+        #end if
+        -max_motif_number $advanced_parameters.motif.max_motif_number
+        #if $advanced_parameters.motif.oligo_lengths.oligomer_lengths == "yes":
+          -min_length $advanced_parameters.motif.oligo_lengths.min_length
+          -max_length $advanced_parameters.motif.oligo_lengths.max_length
+        #end if
+      #end if
+      #if $advanced_parameters.bedFile.resultBedFile == "yes":
+        -source galaxy
+        -outGalaxy2 $bedFile
+      #end if
+    #end if
+  </command>
+  <inputs>
+    <param name="fastaFile" type="data" format="fasta" label="Peak sequences (FASTA file)" />
+    <conditional name="control_conditional" >
+      <param name="controle_file" type="select" label="Control file" help="" >
+        <option value="no" selected="true">No</option>
+        <option value="yes">Yes</option>
+      </param>
+      <when value="no" />
+      <when value="yes">
+        <param name="controlFastaFile" type="data" format="fasta" label="Control peak sequences (FASTA file)" />
+      </when>
+    </conditional>
+    <conditional name="serverChoice">
+       <param name="server" type="select" label="RSAT server (if Time out error, change server)" >
+         <option value="fr_ens" selected="true">RSAT Protists</option>
+         <option value="fr_mrs" >RSAT Fungis</option>
+         <option value="fr_ro" >RSAT Metazoa</option>
+         <option value="fr_mrs_2" >RSAT Teaching</option>
+         <option value="es" >RSAT Plants</option>
+         <option value="mx" >RSAT Prokaryotes</option>
+       </param>
+       <when value="fr_ens">
+         <param name="database" type="select" label="Select a motif database" help="If your motif database of interest is not listed, contact the RSAT team">
+           <options from_file="RSAT_motif_databases_fr_ens.loc">
+             <column name="name" index="0" />
+             <column name="value" index="0" />
+           </options>
+         </param>
+       </when>
+       <when value="fr_mrs">
+         <param name="database" type="select" label="Select an motif database" help="If your motif database of interest is not listed, contact the RSAT team">
+           <options from_file="RSAT_motif_databases_fr_mrs.loc">
+             <column name="name" index="0" />
+             <column name="value" index="0" />
+           </options>
+         </param>
+       </when>
+       <when value="fr_mrs_2">
+         <param name="database" type="select" label="Select an motif database" help="If your motif database of interest is not listed, contact the RSAT team">
+           <options from_file="RSAT_motif_databases_fr_mrs_2.loc">
+             <column name="name" index="0" />
+             <column name="value" index="0" />
+           </options>
+         </param>
+       </when>
+       <when value="fr_ro">
+         <param name="database" type="select" label="Select an motif database" help="If your motif database of interest is not listed, contact the RSAT team">
+           <options from_file="RSAT_motif_databases_fr_ro.loc">
+             <column name="name" index="0" />
+             <column name="value" index="0" />
+          </options>
+        </param>
+       </when>
+       <when value="mx">
+         <param name="database" type="select" label="Select an motif database" help="If your motif database of interest is not listed, contact the RSAT team">
+           <options from_file="RSAT_motif_databases_mx.loc">
+             <column name="name" index="0" />
+             <column name="value" index="0" />
+           </options>
+         </param>
+       </when>
+       <when value="es">
+         <param name="database" type="select" label="Select an motif database" help="If your motif database of interest is not listed, contact the RSAT team">
+           <options from_file="RSAT_motif_databases_es.loc">
+             <column name="name" index="0" />
+             <column name="value" index="0" />
+           </options>
+         </param>
+       </when>
+    </conditional>
+    <conditional name="advanced_parameters" >
+      <param name="adv_param" type="select" label="Advanced Parameters" help="" >
+        <option value="hide" selected="true">Hide</option>
+        <option value="show">Show</option>
+      </param>
+      <when value="hide" />
+      <when value="show">
+        <conditional name="restrict" >
+          <param name="restrictPeaks" type="select" label="Reduce peak sequences" help="" >
+            <option value="no" selected="true">No</option>
+            <option value="yes">Yes</option>
+          </param>
+          <when value="no" />
+          <when value="yes">
+            <param name="top_peaks" type="integer" value="50" label="Number of top sequences to retain"/>
+            <param name="max_seq_length" type="integer" value="500" label="Cut peak sequences (+/- x bp on each side of peak centers)"/>
+          </when>
+        </conditional>
+        <conditional name="motif" >
+          <param name="motifDiscovery" type="select" label="Change motif discovery parameters" help="" >
+            <option value="no" selected="true">No</option>
+            <option value="yes">Yes</option>
+          </param>
+          <when value="no" />
+          <when value="yes">
+            <param name="algorithms" type="select" display="checkboxes" multiple="True" label="Algorithm(s) to use">
+              <option value="oligos" selected="True">Discover over-represented words : oligo-analysis</option>
+              <option value="positions" selected="True">Discover words with a positional bias : position-analysis</option>
+              <option value="local_words">Discover words with local over-representation : local-word-analysis</option>
+              <option value="dyads">Discover over-represented spaced word pairs : dyad-analysis</option>
+              <option value="merged_words">Merge all word lengths for assembly into matrix</option>
+              <validator type="no_options" message="You must select at least one algorithm." />
+            </param>
+            <param name="max_motif_number" type="integer" value="3" label="Number of motifs per algorithm"/>
+            <conditional name="oligo_lengths" >
+              <param name="oligomer_lengths" type="select" label="Change oligomer lengths (oligo-analysis, position-analysis and local-word-analysis)" help="" >
+                <option value="no" selected="true">No</option>
+                <option value="yes">Yes</option>
+              </param>
+              <when value="no" />
+              <when value="yes">
+                <param name="min_length" type="integer" value="6" label="Minimal oligomer length"/>
+                <param name="max_length" type="integer" value="8" label="Maximal oligomer length"/>
+              </when>
+            </conditional>
+          </when>
+        </conditional>
+        <conditional name="bedFile" >
+          <param name="resultBedFile" type="select" label="Generate predicted binding sites (BED file)" help="" >
+            <option value="no" selected="true">No</option>
+            <option value="yes">Yes</option>
+          </param>
+        </conditional>
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <data format="html" name="htmlFile" label="HMTL RSAT output - PeakMotifs results" />
+    <data format="bed" name="bedFile" label="BED RSAT output - PeakMotifs results" >
+      <filter>((advanced_parameters['adv_param'] == 'show') and (advanced_parameters['bedFile']['resultBedFile'] == 'yes'))</filter>
+    </data>
+  </outputs>
+  <help>
+
+**What it does**
+
+.. class:: infomark
+
+This tool is a pipeline for discovering motifs in massive ChIP-seq peak sequences.
+
+------
+
+*Example with FASTA file (1000 sequences)*::
+
+ >mm9_chr3_121848111_121848740_+
+ tggggtgggttccaggacagccaggactgtcacacaaagaaaccttgtctcaaaaaaaca
+ aaaCAAAAAACAAAACAAAACCAAGCAAGCAAGCAAACATGGGCTTAAATctggatacag
+ tggcctttatttctagttccagtgactgggagactgaaacaagagagtcacttgagtaca
+ ggagtgcaaggctagcttgagcaatatagtaagactatctcaaaaTGTGAATTtagatca
+ acagaattgacatcaagaaaaatactgatatcactcaaagcaatctacagattcaacaca
+ atctccatcaacatgacaatgacttccatcaGCATGACAATGACTCCATCAACATGCCAA
+ TGGGCCCCATCAACATAACAATGACCCCTATCATCATGACAATGATCCCCATCAACATGA
+ CAATGACCTCCATCAACATGACAATTACTCCTGTCAACATGCCAATtgttggggttcaga
+ agtcaccctgcaaaccacaagaacactaatctcagtcaagcagggatggtttactgaacg
+ tatatccaaagactgagtgaccaagggaacagctcagactctagagctgaaagctagctg
+ tgcgctggacatttctcggggccaactta
+ >mm9_chr14_86795691_86796311_+
+ CTCAAGGAGGATCCAGAAGTTGGCAGTTTCTGAGGCGAGTCCCATATTCCTCCCCTAAGG
+ GGTCAGGATTTTTCAGGTCTGGGCTCTTCTTGTTCTTTTGACAGCGACATTAATAATTGT
+ ACCAGCTCTCCCCTGGCAGGGCCGCACCACAGAGTAAAGCCTGGAGTAGGAGCTGTGCCC
+ AGCGCAATAATACCAGTTAAATAAGTACGTTCATTACCTCCCAACAGTCAAGGAGTTTAA
+ AATCCGTCAATTCACCCCACATGAGGGAGATTATGTGATTTACATGTTAAAGTGCCCCTG
+ TGGTTTGATTTGCATAGCAAAGACTTTGGGGGCACAGAAACAAAGCATCCGCATGCATGA
+ CAAGAGGACTATTAGCATAGAGAGAGCAGGTTTTCCGACAGCCCAGCCTGGCAAACAATG
+ CTGCACCTTCGCTGCTCGCTGGAGTTTATAGGATTTGACAGTTTCTCATCTGAGGGAGGA
+ GAAGGTTAGGGAGTTGGGGTGGAATGAGGTTCGCTAGATTGGCTGTCTGCCTTAAGCACA
+ ATAATTTGTCTTTCTCTGAAGACCTCCCCTCCTCTTATCACCTTTATCGTTTCTTTCTGA
+ TGTTCATTCAAAGACGTCTT
+
+------
+
+*Partial results :*
+
+.. image:: ${static_path}/images/result_peak_motifs_1.png
+  :height: 350
+  :width: 600
+
+.. image:: ${static_path}/images/result_peak_motifs_2.png
+  :height: 250
+  :width: 600
+
+  </help>
+  <citations>
+    <citation type="bibtex">@article{Medina-Rivera22042015,
+      author = {Medina-Rivera, Alejandra and Defrance, Matthieu and Sand, Olivier and Herrmann, Carl and Castro-Mondragon, Jaime A. and Delerce, Jeremy and Jaeger, Sébastien and Blanchet, Christophe and Vincens, Pierre and Caron, Christophe and Staines, Daniel M. and Contreras-Moreira, Bruno and Artufel, Marie and Charbonnier-Khamvongsa, Lucie and Hernandez, Céline and Thieffry, Denis and Thomas-Chollier, Morgane and van Helden, Jacques},
+      title = {RSAT 2015: Regulatory Sequence Analysis Tools},
+      year = {2015},
+      doi = {10.1093/nar/gkv362},
+      URL = {http://nar.oxfordjournals.org/content/early/2015/04/21/nar.gkv362.abstract},
+      eprint = {http://nar.oxfordjournals.org/content/early/2015/04/21/nar.gkv362.full.pdf+html},
+      journal = {Nucleic Acids Research}
+      }</citation>
+  </citations>
+</tool>