Mercurial > repos > jbrayet > rsat

view matrixScan_wrapper.xml @ 52:a1d369ead6d7 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author jbrayet
date Tue, 29 Sep 2015 08:25:39 -0400
parents 5e11231fb0ff
children
line wrap: on
line source

<!--Matrix Scan - developed by Jocelyn Brayet <jocelyn.brayet@curie.fr>
Copyright (C) 2015  Institut Curie

This program is free software: you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation, either version 3 of the License, or
(at your option) any later version.

This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
GNU General Public License for more details.

You should have received a copy of the GNU General Public License
along with this program.  If not, see <http://www.gnu.org/licenses/>.-->
<tool id="rsat_matrix_scan" name="RSAT Matrix Scan" version="1.0">
  <description>Scan a DNA sequence with a profile matrix</description>
  <requirements>
    <requirement type="package" version="0.6">python_suds</requirement>
  </requirements>
  <command interpreter="python">
    matrixScan_wrapper.py -sequence $sequenceFile -matrix $matrixFile -outGalaxy $txtFile -matrix_format $matrix_format -n_treatment $n_treatment -markov $markov
    #if $background_method_condition.background_method == "bgfile":
      -organism $background_method_condition.serverChoice.organism
      -server $background_method_condition.serverChoice.server
      -background $background_method_condition.background
    #else:
      -server $background_method_condition.organism
    #end if
    #if $scanning_options_condition.scanning_options == "yes":
      -origin $scanning_options_condition.origin
      -return $scanning_options_condition.return
      -uth $scanning_options_condition.pval
    #end if
  </command>
  <inputs>
    <param name="sequenceFile" type="data" format="fasta" label="Sequences File (FASTA file)" />
    <param name="matrix_format" type="select" label="Matrix format" help="" >
      <option value="tab" selected="true">tab</option>
      <option value="cb" >cb</option>
      <option value="transfac" >transfac</option>
      <option value="jaspar" >jaspar</option>
      <option value="consensus" >consensus</option>
      <option value="gibbs" >gibbs</option>
      <option value="meme" >meme</option>
      <option value="assembly" >assembly</option>
    </param>    
    <param name="matrixFile" type="data" format="txt" label="Matrix (or matrices) (TXT file)" />
    <param name="n_treatment" type="select" label="Treatment of N characters" help="" >
      <option value="score" selected="true">N-containing regions are skipped</option>
      <option value="skip" >N-containing regions are scored</option>
    </param>
    <param name="markov" type="select" label="Markov order" help="" >
      <option value="0" >0</option>
      <option value="1" selected="true">1</option>
      <option value="2">2</option>
    </param>
    <conditional name="background_method_condition" >
      <param name="background_method" type="select" label="Background model estimation method" help="" >
        <option value="bginput" selected="true">Estimate residue probabilities from input sequences</option>
        <option value="bgfile">Organism-specific</option>
      </param>
      <when value="bginput"/>
        <param name="server" type="select" label="RSAT server (if Time out error, change server)" >
          <option value="fr_ens" selected="true">RSAT Protists</option>
          <option value="fr_mrs" >RSAT Fungis</option>
          <option value="fr_ro" >RSAT Metazoa</option>
          <option value="fr_mrs_2" >RSAT Teaching</option>
          <option value="es" >RSAT Plants</option>
          <option value="mx" >RSAT Prokaryotes</option>
        </param>
      <when value="bgfile">
        <conditional name="serverChoice">
          <param name="server" type="select" label="RSAT server (if Time out error, change server)" >
            <option value="fr_ens" selected="true">RSAT Protists</option>
            <option value="fr_mrs" >RSAT Fungis</option>
            <option value="fr_ro" >RSAT Metazoa</option>
            <option value="fr_mrs_2" >RSAT Teaching</option>
            <option value="es" >RSAT Plants</option>
            <option value="mx" >RSAT Prokaryotes</option>
          </param>
          <when value="fr_ens">
            <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team">
              <options from_file="RSAT_organisms_fr_ens.loc">
                <column name="name" index="0" />
                <column name="value" index="0" />
              </options>
            </param>
          </when>
          <when value="fr_mrs">
            <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team">
              <options from_file="RSAT_organisms_fr_mrs.loc">
                <column name="name" index="0" />
                <column name="value" index="0" />
              </options>
            </param>
          </when>
          <when value="fr_mrs_2">
            <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team">
              <options from_file="RSAT_organisms_fr_mrs_2.loc">
                <column name="name" index="0" />
                <column name="value" index="0" />
              </options>
            </param>
          </when>
          <when value="fr_ro">
            <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team">
              <options from_file="RSAT_organisms_fr_ro.loc">
                <column name="name" index="0" />
                <column name="value" index="0" />
              </options>
            </param>
          </when>
          <when value="mx">
            <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team">
              <options from_file="RSAT_organisms_mx.loc">
                <column name="name" index="0" />
                <column name="value" index="0" />
              </options>
            </param>
          </when>
          <when value="es">
            <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team">
              <options from_file="RSAT_organisms_es.loc">
                <column name="name" index="0" />
                <column name="value" index="0" />
              </options>
            </param>
          </when>
        </conditional>
        <param name="background" type="select" label="Sequence type" help="" >
          <option value="upstream" selected="true">Upstream</option>
          <option value="upstream-noorf" >Upstream-noorf</option>
        </param>
      </when>
    </conditional>
    <conditional name="scanning_options_condition" >
      <param name="scanning_options" type="select" label="Scanning options" help="" >
        <option value="no" selected="true">No</option>
        <option value="yes">Yes</option>
      </param>
      <when value="no"/>
      <when value="yes">
        <param name="origin" type="select" label="Sequence Origin">
          <option value="start" selected="true">start</option>
          <option value="center" >center</option>
          <option value="end" >end</option>
        </param>
        <param name="return" type="select" label="Return" help="" >
          <option value="limits" selected="true">sites only</option>
          <option value="limits,pval" >sites + pval</option>
        </param>
        <param name="pval" type="float" value="0.0001" min="0" max="1" label="Threshold (if return is 'sites only', the threshold is set on the weight score and if return is 'sites + pval', the threshold is set on the pval)"/>
      </when>
    </conditional>
  </inputs>
  <outputs>
    <data format="txt" name="txtFile" label="RSAT output - matrixScan results" />
  </outputs>

  <help>

**What it does**

.. class:: infomark

Scan a DNA sequence with a profile matrix.

------

*Example with transfac matrix and fasta file*::

 AC  m1
 XX
 ID  m1
 XX
 DE  m1 m1; from JASPAR
 P0       A     C     G     T
 1        4    16     0     0
 2       19     0     1     0
 3        0    20     0     0
 4        0     0    20     0
 5        0     0     0    20
 6        0     0    20     0
 XX
 CC  program: jaspar
 CC  matrix.nb: 1
 CC  min.prior: 0.25
 CC  alphabet.size: 4
 CC  max.bits: 2
 CC  total.information: 6.56407409450406
 CC  information.per.column: 1.09401234908401
 CC  max.possible.info.per.col: 1.38629436111989
 CC  consensus.strict: CACGTG
 CC  consensus.strict.rc: CACGTG
 CC  consensus.IUPAC: CACGTG
 CC  consensus.IUPAC.rc: CACGTG
 CC  consensus.regexp: CACGTG
 CC  consensus.regexp.rc: CACGTG
 CC  residues.content.crude.freq: a:0.1917|c:0.3000|g:0.3417|t:0.1667
 CC  G+C.content.crude.freq: 0.641666666666667
 CC  residues.content.corrected.freq: a:0.1944|c:0.2976|g:0.3373|t:0.1706
 CC  G+C.content.corrected.freq: 0.634920634920635
 XX
 //
 
 >mm9_chr3_121848111_121848740_+
 tggggtgggttccaggacagccaggactgtcacacaaagaaaccttgtctcaaaaaaaca
 aaaCAAAAAACAAAACAAAACCAAGCAAGCAAGCAAACATGGGCTTAAATctggatacag
 tggcctttatttctagttccagtgactgggagactgaaacaagagagtcacttgagtaca
 ggagtgcaaggctagcttgagcaatatagtaagactatctcaaaaTGTGAATTtagatca
 acagaattgacatcaagaaaaatactgatatcactcaaagcaatctacagattcaacaca
 atctccatcaacatgacaatgacttccatcaGCATGACAATGACTCCATCAACATGCCAA
 TGGGCCCCATCAACATAACAATGACCCCTATCATCATGACAATGATCCCCATCAACATGA
 CAATGACCTCCATCAACATGACAATTACTCCTGTCAACATGCCAATtgttggggttcaga
 agtcaccctgcaaaccacaagaacactaatctcagtcaagcagggatggtttactgaacg
 tatatccaaagactgagtgaccaagggaacagctcagactctagagctgaaagctagctg
 tgcgctggacatttctcggggccaactta
 >mm9_chr14_86795691_86796311_+
 CTCAAGGAGGATCCAGAAGTTGGCAGTTTCTGAGGCGAGTCCCATATTCCTCCCCTAAGG
 GGTCAGGATTTTTCAGGTCTGGGCTCTTCTTGTTCTTTTGACAGCGACATTAATAATTGT
 ACCAGCTCTCCCCTGGCAGGGCCGCACCACAGAGTAAAGCCTGGAGTAGGAGCTGTGCCC
 AGCGCAATAATACCAGTTAAATAAGTACGTTCATTACCTCCCAACAGTCAAGGAGTTTAA
 AATCCGTCAATTCACCCCACATGAGGGAGATTATGTGATTTACATGTTAAAGTGCCCCTG
 TGGTTTGATTTGCATAGCAAAGACTTTGGGGGCACAGAAACAAAGCATCCGCATGCATGA
 CAAGAGGACTATTAGCATAGAGAGAGCAGGTTTTCCGACAGCCCAGCCTGGCAAACAATG
 CTGCACCTTCGCTGCTCGCTGGAGTTTATAGGATTTGACAGTTTCTCATCTGAGGGAGGA
 GAAGGTTAGGGAGTTGGGGTGGAATGAGGTTCGCTAGATTGGCTGTCTGCCTTAAGCACA
 ATAATTTGTCTTTCTCTGAAGACCTCCCCTCCTCTTATCACCTTTATCGTTTCTTTCTGA
 TGTTCATTCAAAGACGTCTT

------

*Results with threshold (sites + pval) 0.0001*::

 #seq_id	ft_type	ft_name	strand	start	end	sequence	weight	Pval	ln_Pval	sig
 mm9_chr3_121848111_121848740_+	limit	START_END	D	1	629	.	0	0	0	0
 mm9_chr14_86795691_86796311_+	limit	START_END	D	1	620	.	0	0	0	0
 mm9_chr15_84452311_84453000_+	limit	START_END	D	1	689	.	0	0	0	0
 mm9_chr1_134118761_134119120_+	limit	START_END	D	1	359	.	0	0	0	0
 mm9_chr17_35640731_35641360_+	limit	START_END	D	1	629	.	0	0	0	0
 mm9_chr18_66052791_66053190_+	limit	START_END	D	1	399	.	0	0	0	0
 mm9_chr6_125165051_125165561_+	limit	START_END	D	1	510	.	0	0	0	0
 mm9_chr16_35588051_35588520_+	limit	START_END	D	1	469	.	0	0	0	0
 mm9_chr2_51927461_51927981_+	limit	START_END	D	1	520	.	0	0	0	0
 mm9_chr2_51927461_51927981_+	site	m1	D	106	111	CACGTG	9.1	7.2e-05	-9.545	4.145
 mm9_chr2_51927461_51927981_+	site	m1	R	106	111	CACGTG	9.1	7.2e-05	-9.545	4.145
 mm9_chr3_18523921_18524271_+	limit	START_END	D	1	350	.	0	0	0	0
 mm9_chr17_29324151_29324630_+	limit	START_END	D	1	479	.	0	0	0	0
 mm9_chr5_111009921_111010390_+	limit	START_END	D	1	469	.	0	0	0	0
 mm9_chr14_37727831_37728360_+	limit	START_END	D	1	529	.	0	0	0	0
 mm9_chr11_77707171_77707751_+	limit	START_END	D	1	580	.	0	0	0	0
 mm9_chr14_50067391_50067801_+	limit	START_END	D	1	410	.	0	0	0	0

  </help>
  <citations>
    <citation type="bibtex">@article{Medina-Rivera22042015,
      author = {Medina-Rivera, Alejandra and Defrance, Matthieu and Sand, Olivier and Herrmann, Carl and Castro-Mondragon, Jaime A. and Delerce, Jeremy and Jaeger, Sébastien and Blanchet, Christophe and Vincens, Pierre and Caron, Christophe and Staines, Daniel M. and Contreras-Moreira, Bruno and Artufel, Marie and Charbonnier-Khamvongsa, Lucie and Hernandez, Céline and Thieffry, Denis and Thomas-Chollier, Morgane and van Helden, Jacques}, 
      title = {RSAT 2015: Regulatory Sequence Analysis Tools},
      year = {2015},
      doi = {10.1093/nar/gkv362}, 
      URL = {http://nar.oxfordjournals.org/content/early/2015/04/21/nar.gkv362.abstract}, 
      eprint = {http://nar.oxfordjournals.org/content/early/2015/04/21/nar.gkv362.full.pdf+html}, 
      journal = {Nucleic Acids Research} 
      }</citation>
  </citations>
</tool>