Mercurial > repos > jbrayet > rsat
diff matrixScan_wrapper.xml @ 20:fb38cedce83e draft
Uploaded
| author | jbrayet |
|---|---|
| date | Tue, 22 Sep 2015 08:00:43 -0400 |
| parents | |
| children | 5e11231fb0ff |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/matrixScan_wrapper.xml Tue Sep 22 08:00:43 2015 -0400 @@ -0,0 +1,268 @@ +<!--Matrix Scan - developed by Jocelyn Brayet <jocelyn.brayet@curie.fr> +Copyright (C) 2015 Institut Curie + +This program is free software: you can redistribute it and/or modify +it under the terms of the GNU General Public License as published by +the Free Software Foundation, either version 3 of the License, or +(at your option) any later version. + +This program is distributed in the hope that it will be useful, +but WITHOUT ANY WARRANTY; without even the implied warranty of +MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +GNU General Public License for more details. + +You should have received a copy of the GNU General Public License +along with this program. If not, see <http://www.gnu.org/licenses/>.--> +<tool id="rsat_matrix_scan" name="RSAT Matrix Scan" version="1.0"> + <description>Scan a DNA sequence with a profile matrix</description> + <requirements> + <requirement type="package" version="2.7">python</requirement> + </requirements> + <command interpreter="python"> + matrixScan_wrapper.py -sequence $sequenceFile -matrix $matrixFile -outGalaxy $txtFile -matrix_format $matrix_format -n_treatment $n_treatment -markov $markov + #if $background_method_condition.background_method == "bgfile": + -organism $background_method_condition.serverChoice.organism + -server $background_method_condition.serverChoice.server + -background $background_method_condition.background + #else: + -server $background_method_condition.organism + #end if + #if $scanning_options_condition.scanning_options == "yes": + -origin $scanning_options_condition.origin + -return $scanning_options_condition.return + -uth $scanning_options_condition.pval + #end if + </command> + <inputs> + <param name="sequenceFile" type="data" format="fasta" label="Sequences File (FASTA file)" /> + <param name="matrix_format" type="select" label="Matrix format" help="" > + <option value="tab" selected="true">tab</option> + <option value="cb" >cb</option> + <option value="transfac" >transfac</option> + <option value="jaspar" >jaspar</option> + <option value="consensus" >consensus</option> + <option value="gibbs" >gibbs</option> + <option value="meme" >meme</option> + <option value="assembly" >assembly</option> + </param> + <param name="matrixFile" type="data" format="txt" label="Matrix (or matrices) (TXT file)" /> + <param name="n_treatment" type="select" label="Treatment of N characters" help="" > + <option value="score" selected="true">N-containing regions are skipped</option> + <option value="skip" >N-containing regions are scored</option> + </param> + <param name="markov" type="select" label="Markov order" help="" > + <option value="0" >0</option> + <option value="1" selected="true">1</option> + <option value="2">2</option> + </param> + <conditional name="background_method_condition" > + <param name="background_method" type="select" label="Background model estimation method" help="" > + <option value="bginput" selected="true">Estimate residue probabilities from input sequences</option> + <option value="bgfile">Organism-specific</option> + </param> + <when value="bginput"/> + <param name="server" type="select" label="RSAT server (if Time out error, change server)" > + <option value="fr_ens" selected="true">RSAT Protists</option> + <option value="fr_mrs" >RSAT Fungis</option> + <option value="fr_ro" >RSAT Metazoa</option> + <option value="fr_mrs_2" >RSAT Teaching</option> + <option value="es" >RSAT Plants</option> + <option value="mx" >RSAT Prokaryotes</option> + </param> + <when value="bgfile"> + <conditional name="serverChoice"> + <param name="server" type="select" label="RSAT server (if Time out error, change server)" > + <option value="fr_ens" selected="true">RSAT Protists</option> + <option value="fr_mrs" >RSAT Fungis</option> + <option value="fr_ro" >RSAT Metazoa</option> + <option value="fr_mrs_2" >RSAT Teaching</option> + <option value="es" >RSAT Plants</option> + <option value="mx" >RSAT Prokaryotes</option> + </param> + <when value="fr_ens"> + <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team"> + <options from_file="RSAT_organisms_fr_ens.loc"> + <column name="name" index="0" /> + <column name="value" index="0" /> + </options> + </param> + </when> + <when value="fr_mrs"> + <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team"> + <options from_file="RSAT_organisms_fr_mrs.loc"> + <column name="name" index="0" /> + <column name="value" index="0" /> + </options> + </param> + </when> + <when value="fr_mrs_2"> + <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team"> + <options from_file="RSAT_organisms_fr_mrs_2.loc"> + <column name="name" index="0" /> + <column name="value" index="0" /> + </options> + </param> + </when> + <when value="fr_ro"> + <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team"> + <options from_file="RSAT_organisms_fr_ro.loc"> + <column name="name" index="0" /> + <column name="value" index="0" /> + </options> + </param> + </when> + <when value="mx"> + <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team"> + <options from_file="RSAT_organisms_mx.loc"> + <column name="name" index="0" /> + <column name="value" index="0" /> + </options> + </param> + </when> + <when value="es"> + <param name="organism" type="select" label="Select an organism" help="If your organism of interest is not listed, contact the RSAT team"> + <options from_file="RSAT_organisms_es.loc"> + <column name="name" index="0" /> + <column name="value" index="0" /> + </options> + </param> + </when> + </conditional> + <param name="background" type="select" label="Sequence type" help="" > + <option value="upstream" selected="true">Upstream</option> + <option value="upstream-noorf" >Upstream-noorf</option> + </param> + </when> + </conditional> + <conditional name="scanning_options_condition" > + <param name="scanning_options" type="select" label="Scanning options" help="" > + <option value="no" selected="true">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"/> + <when value="yes"> + <param name="origin" type="select" label="Sequence Origin"> + <option value="start" selected="true">start</option> + <option value="center" >center</option> + <option value="end" >end</option> + </param> + <param name="return" type="select" label="Return" help="" > + <option value="limits" selected="true">sites only</option> + <option value="limits,pval" >sites + pval</option> + </param> + <param name="pval" type="float" value="0.0001" min="0" max="1" label="Threshold (if return is 'sites only', the threshold is set on the weight score and if return is 'sites + pval', the threshold is set on the pval)"/> + </when> + </conditional> + </inputs> + <outputs> + <data format="txt" name="txtFile" label="RSAT output - matrixScan results" /> + </outputs> + + <help> + +**What it does** + +.. class:: infomark + +Scan a DNA sequence with a profile matrix. + +------ + +*Example with transfac matrix and fasta file*:: + + AC m1 + XX + ID m1 + XX + DE m1 m1; from JASPAR + P0 A C G T + 1 4 16 0 0 + 2 19 0 1 0 + 3 0 20 0 0 + 4 0 0 20 0 + 5 0 0 0 20 + 6 0 0 20 0 + XX + CC program: jaspar + CC matrix.nb: 1 + CC min.prior: 0.25 + CC alphabet.size: 4 + CC max.bits: 2 + CC total.information: 6.56407409450406 + CC information.per.column: 1.09401234908401 + CC max.possible.info.per.col: 1.38629436111989 + CC consensus.strict: CACGTG + CC consensus.strict.rc: CACGTG + CC consensus.IUPAC: CACGTG + CC consensus.IUPAC.rc: CACGTG + CC consensus.regexp: CACGTG + CC consensus.regexp.rc: CACGTG + CC residues.content.crude.freq: a:0.1917|c:0.3000|g:0.3417|t:0.1667 + CC G+C.content.crude.freq: 0.641666666666667 + CC residues.content.corrected.freq: a:0.1944|c:0.2976|g:0.3373|t:0.1706 + CC G+C.content.corrected.freq: 0.634920634920635 + XX + // + + >mm9_chr3_121848111_121848740_+ + tggggtgggttccaggacagccaggactgtcacacaaagaaaccttgtctcaaaaaaaca + aaaCAAAAAACAAAACAAAACCAAGCAAGCAAGCAAACATGGGCTTAAATctggatacag + tggcctttatttctagttccagtgactgggagactgaaacaagagagtcacttgagtaca + ggagtgcaaggctagcttgagcaatatagtaagactatctcaaaaTGTGAATTtagatca + acagaattgacatcaagaaaaatactgatatcactcaaagcaatctacagattcaacaca + atctccatcaacatgacaatgacttccatcaGCATGACAATGACTCCATCAACATGCCAA + TGGGCCCCATCAACATAACAATGACCCCTATCATCATGACAATGATCCCCATCAACATGA + CAATGACCTCCATCAACATGACAATTACTCCTGTCAACATGCCAATtgttggggttcaga + agtcaccctgcaaaccacaagaacactaatctcagtcaagcagggatggtttactgaacg + tatatccaaagactgagtgaccaagggaacagctcagactctagagctgaaagctagctg + tgcgctggacatttctcggggccaactta + >mm9_chr14_86795691_86796311_+ + CTCAAGGAGGATCCAGAAGTTGGCAGTTTCTGAGGCGAGTCCCATATTCCTCCCCTAAGG + GGTCAGGATTTTTCAGGTCTGGGCTCTTCTTGTTCTTTTGACAGCGACATTAATAATTGT + ACCAGCTCTCCCCTGGCAGGGCCGCACCACAGAGTAAAGCCTGGAGTAGGAGCTGTGCCC + AGCGCAATAATACCAGTTAAATAAGTACGTTCATTACCTCCCAACAGTCAAGGAGTTTAA + AATCCGTCAATTCACCCCACATGAGGGAGATTATGTGATTTACATGTTAAAGTGCCCCTG + TGGTTTGATTTGCATAGCAAAGACTTTGGGGGCACAGAAACAAAGCATCCGCATGCATGA + CAAGAGGACTATTAGCATAGAGAGAGCAGGTTTTCCGACAGCCCAGCCTGGCAAACAATG + CTGCACCTTCGCTGCTCGCTGGAGTTTATAGGATTTGACAGTTTCTCATCTGAGGGAGGA + GAAGGTTAGGGAGTTGGGGTGGAATGAGGTTCGCTAGATTGGCTGTCTGCCTTAAGCACA + ATAATTTGTCTTTCTCTGAAGACCTCCCCTCCTCTTATCACCTTTATCGTTTCTTTCTGA + TGTTCATTCAAAGACGTCTT + +------ + +*Results with threshold (sites + pval) 0.0001*:: + + #seq_id ft_type ft_name strand start end sequence weight Pval ln_Pval sig + mm9_chr3_121848111_121848740_+ limit START_END D 1 629 . 0 0 0 0 + mm9_chr14_86795691_86796311_+ limit START_END D 1 620 . 0 0 0 0 + mm9_chr15_84452311_84453000_+ limit START_END D 1 689 . 0 0 0 0 + mm9_chr1_134118761_134119120_+ limit START_END D 1 359 . 0 0 0 0 + mm9_chr17_35640731_35641360_+ limit START_END D 1 629 . 0 0 0 0 + mm9_chr18_66052791_66053190_+ limit START_END D 1 399 . 0 0 0 0 + mm9_chr6_125165051_125165561_+ limit START_END D 1 510 . 0 0 0 0 + mm9_chr16_35588051_35588520_+ limit START_END D 1 469 . 0 0 0 0 + mm9_chr2_51927461_51927981_+ limit START_END D 1 520 . 0 0 0 0 + mm9_chr2_51927461_51927981_+ site m1 D 106 111 CACGTG 9.1 7.2e-05 -9.545 4.145 + mm9_chr2_51927461_51927981_+ site m1 R 106 111 CACGTG 9.1 7.2e-05 -9.545 4.145 + mm9_chr3_18523921_18524271_+ limit START_END D 1 350 . 0 0 0 0 + mm9_chr17_29324151_29324630_+ limit START_END D 1 479 . 0 0 0 0 + mm9_chr5_111009921_111010390_+ limit START_END D 1 469 . 0 0 0 0 + mm9_chr14_37727831_37728360_+ limit START_END D 1 529 . 0 0 0 0 + mm9_chr11_77707171_77707751_+ limit START_END D 1 580 . 0 0 0 0 + mm9_chr14_50067391_50067801_+ limit START_END D 1 410 . 0 0 0 0 + + </help> + <citations> + <citation type="bibtex">@article{Medina-Rivera22042015, + author = {Medina-Rivera, Alejandra and Defrance, Matthieu and Sand, Olivier and Herrmann, Carl and Castro-Mondragon, Jaime A. and Delerce, Jeremy and Jaeger, Sébastien and Blanchet, Christophe and Vincens, Pierre and Caron, Christophe and Staines, Daniel M. and Contreras-Moreira, Bruno and Artufel, Marie and Charbonnier-Khamvongsa, Lucie and Hernandez, Céline and Thieffry, Denis and Thomas-Chollier, Morgane and van Helden, Jacques}, + title = {RSAT 2015: Regulatory Sequence Analysis Tools}, + year = {2015}, + doi = {10.1093/nar/gkv362}, + URL = {http://nar.oxfordjournals.org/content/early/2015/04/21/nar.gkv362.abstract}, + eprint = {http://nar.oxfordjournals.org/content/early/2015/04/21/nar.gkv362.full.pdf+html}, + journal = {Nucleic Acids Research} + }</citation> + </citations> +</tool> +