changeset 72:0ef071bba164 draft

Modify test data to include a negative frame sequence that is split in multiple lines
author Jan Kanis <jan.code@jankanis.nl>
date Wed, 18 Jun 2014 14:22:57 +0200
parents 0c4ac210068b
children 371cd585e459
files test-data/blast xml example4.html test-data/blast xml example4.xml
diffstat 2 files changed, 9 insertions(+), 9 deletions(-) [+]
line wrap: on
line diff
--- a/test-data/blast xml example4.html	Wed Jun 18 14:12:00 2014 +0200
+++ b/test-data/blast xml example4.html	Wed Jun 18 14:22:57 2014 +0200
@@ -1570,9 +1570,9 @@
 
                 <div class=hotspot id=hotspot7-2-1>
                   <p class=range>
-                    <span class=range>Range 1: 1516 to 1589</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=1516&amp;to=1589">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=1516&amp;to=1589">Graphics</a>
+                    <span class=range>Range 1: 1589 to 1516</span>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=1589&amp;to=1516">GenBank</a>
+                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=1589&amp;to=1516">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1584,16 +1584,16 @@
                       <td>0.0</td>
                       <td>64/74(86%)</td>
                       <td>0/74(0%)</td>
-                      <td>Plus/Plus</td>
+                      <td>Plus/Minus</td>
                     </tr>
                   </table>
 
                   <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG  60
                 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | 
-Subject   1516  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC  1575</pre>
+Subject   1589  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC  1530</pre>
                   <pre class=alignmentgraphic>Query       61  TTCGCAGTCCAGAA  74
                 ||||| ||||||||
-Subject   1576  TTCGCCGTCCAGAA  1589</pre>
+Subject   1529  TTCGCCGTCCAGAA  1516</pre>
                 </div>
 
               </div>
--- a/test-data/blast xml example4.xml	Wed Jun 18 14:12:00 2014 +0200
+++ b/test-data/blast xml example4.xml	Wed Jun 18 14:22:57 2014 +0200
@@ -380,10 +380,10 @@
       <Hsp_evalue>3.56369e-15</Hsp_evalue>
       <Hsp_query-from>1</Hsp_query-from>
       <Hsp_query-to>74</Hsp_query-to>
-      <Hsp_hit-from>1516</Hsp_hit-from>
-      <Hsp_hit-to>1589</Hsp_hit-to>
+      <Hsp_hit-from>1589</Hsp_hit-from>
+      <Hsp_hit-to>1516</Hsp_hit-to>
       <Hsp_query-frame>1</Hsp_query-frame>
-      <Hsp_hit-frame>1</Hsp_hit-frame>
+      <Hsp_hit-frame>-1</Hsp_hit-frame>
       <Hsp_identity>64</Hsp_identity>
       <Hsp_positive>64</Hsp_positive>
       <Hsp_gaps>0</Hsp_gaps>