Mercurial > repos > iuc > seqtk

changeset 22:f2a792351212 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/seqtk commit 75d5141110314addc160504e0a1f9cd66443de66
author iuc
date Wed, 16 Oct 2024 09:08:17 +0000
parents ac22e16bfecd
children
files macros.xml seqtk_comp.xml seqtk_cutN.xml seqtk_dropse.xml seqtk_fqchk.xml seqtk_hety.xml seqtk_listhet.xml seqtk_mergefa.xml seqtk_mergepe.xml seqtk_mutfa.xml seqtk_randbase.xml seqtk_sample.xml seqtk_seq.xml seqtk_subseq.xml seqtk_telo.xml seqtk_trimfq.xml test-data/seqtk_seq_A.fasta test-data/seqtk_seq_A.fasta.gz test-data/seqtk_telo.fa test-data/seqtk_telo.fa.gz test-data/seqtk_telo.out test-data/seqtk_telogz.out
diffstat 22 files changed, 314 insertions(+), 66 deletions(-) [+]
line wrap: on
line diff
--- a/macros.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/macros.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -12,7 +12,8 @@
             <xref type="bio.tools">seqtk</xref>
         </xrefs>
     </xml>
-    <token name="@TOOL_VERSION@">1.3</token>
+    <token name="@TOOL_VERSION@">1.4</token>
+    <token name="@VERSION_SUFFIX@">0</token>
     <token name="@AWK_VERSION@">4.2.1</token>
     <xml name="stdio">
         <stdio>
@@ -41,6 +42,17 @@
     ]]></token>
     <xml name="citation">
         <citations>
+            <citation type="bibtex">
+                @misc{seqtk,
+                  author = {Heng Li},
+                  year = {2023},
+                  title = {seqtk},
+                  publisher = {GitHub},
+                  journal = {GitHub repository},
+                  howpublished{\url{https://github.com/lh3/seqtk}},
+                }
+            </citation>
         </citations>
     </xml>
+
 </macros>
--- a/seqtk_comp.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_comp.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_comp" name="seqtk_comp" version="@TOOL_VERSION@.1">
+<tool id="seqtk_comp" name="seqtk_comp" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>get the nucleotide composition of FASTA/Q</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements">
         <requirement type="package" version="@AWK_VERSION@">gawk</requirement>
     </expand>
@@ -22,7 +22,7 @@
         <param name="in_bed" type="data" format="bed" optional="true" label="BED file"/>
     </inputs>
     <outputs>
-        <data name="default" format="tabular" label="Nucleotide composition of $in_file.name"/>
+        <data name="default" format="tabular" label="${tool.name} on ${on_string}: Nucleotide composition"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_cutN.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_cutN.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,9 @@
-<?xml version="1.0"?>
-<tool id="seqtk_cutN" name="seqtk_cutN" version="@TOOL_VERSION@.1">
+<tool id="seqtk_cutN" name="seqtk_cutN" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>cut sequence at long N</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -22,7 +21,11 @@
         <param argument="-g" type="boolean" truevalue="-g" falsevalue="" checked="false" label="Print gaps only, no sequence" />
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="$in_file.name split on N runs longer than $n"/>
+       <data name="default" format_source="in_file" label="${tool.name} on ${on_string}: split on N runs longer than $n">
+            <change_format>
+                <when input="g" value="-g" format="bed" />
+            </change_format>
+        </data>
     </outputs>
     <tests>
         <test>
--- a/seqtk_dropse.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_dropse.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_dropse" name="seqtk_dropse" version="@TOOL_VERSION@.1">
+<tool id="seqtk_dropse" name="seqtk_dropse" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>drop unpaired from interleaved Paired End FASTA/Q</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -16,7 +16,7 @@
         <expand macro="in_faq"/>
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="Only paired-end reads from $in_file.name"/>
+        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}: only paired-end reads"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_fqchk.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_fqchk.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_fqchk" name="seqtk_fqchk" version="@TOOL_VERSION@.1">
+<tool id="seqtk_fqchk" name="seqtk_fqchk" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>fastq QC (base/quality summary)</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements">
         <requirement type="package" version="@AWK_VERSION@">gawk</requirement>
     </expand>
@@ -20,7 +20,7 @@
         <param argument="-q" type="integer" value="20" label="Quality values" help="Use 0 to get the distribution of all quality values"/>
     </inputs>
     <outputs>
-        <data name="default" format="tabular" label="Quality information for $in_file.name"/>
+        <data name="default" format="tabular" label="${tool.name} on ${on_string}: Quality information"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_hety.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_hety.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_hety" name="seqtk_hety" version="@TOOL_VERSION@.1">
+<tool id="seqtk_hety" name="seqtk_hety" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>regional heterozygosity</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements">
         <requirement type="package" version="@AWK_VERSION@">gawk</requirement>
     </expand>
@@ -24,7 +24,7 @@
         <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Treat lowercases as masked" />
     </inputs>
     <outputs>
-        <data name="default" format="tabular" label="Heterozygous regions in $in_file.name"/>
+        <data name="default" format="tabular" label="${tool.name} on ${on_string}: Heterozygous regions"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_listhet.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_listhet.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_listhet" name="seqtk_listhet" version="@TOOL_VERSION@.1">
+<tool id="seqtk_listhet" name="seqtk_listhet" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>extract the position of each het</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements">
         <requirement type="package" version="@AWK_VERSION@">gawk</requirement>
     </expand>
@@ -18,7 +18,7 @@
         <expand macro="in_faq"/>
     </inputs>
     <outputs>
-        <data name="default" format="tabular" label="Positions of heterozygous bases in $in_file.name"/>
+        <data name="default" format="tabular" label="${tool.name} on ${on_string}: Positions of heterozygous bases"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_mergefa.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_mergefa.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_mergefa" name="seqtk_mergefa" version="@TOOL_VERSION@.1">
-    <description>merge two FASTA/Q files</description>
-    <expand macro="bio_tools"/>
+<tool id="seqtk_mergefa" name="seqtk_mergefa" version="@TOOL_VERSION@+galaxy1" profile="22.05">
+    <description>Merge two FASTA/Q files into a FASTA file output</description>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -18,17 +18,28 @@
 '$in_fa2'
 #echo "| pigz -p ${GALAXY_SLOTS:-1} --no-name --no-time" if $in_fa1.is_of_type('fasta.gz', 'fastq.gz') else "" # > '$default'
     ]]></command>
+    <configfiles>
+        <configfile filename="outputs.json">
+#set $ext = None
+#if $in_fa1.is_of_type('fasta.gz', 'fastq.gz')
+    #set $ext = "fasta.gz"
+#else
+    #set $ext = "fasta"
+#end if
+{"default": {"ext": "$ext"}}
+        </configfile>
+    </configfiles>
     <inputs>
         <param name="in_fa1" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #1"/>
         <param name="in_fa2" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #2"/>
-        <param argument="-q" type="integer" value="0" label="Quality threshold"/>
+        <param argument="-q" type="integer" value="0" label="Quality threshold (for FASTQ)"/>
         <param argument="-i" type="boolean" truevalue="-i" falsevalue="" checked="false" label="Take intersection" />
-        <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Convert to lowercase when one of the input base is N" />
+        <param argument="-m" type="boolean" truevalue="-m" falsevalue="" checked="false" label="Pick least ambiguous, mask conflicts and uncertainties" help="Tries to pick the least ambiguous symbol from the two inputs, but masks contradictory bases in the inputs as x in the merged result and converts the merged base to lowercase where one of the input bases is an N." />
         <param argument="-r" type="boolean" truevalue="-r" falsevalue="" checked="false" label="Pick a random allele from het" />
         <param argument="-h" type="boolean" truevalue="-h" falsevalue="" checked="false" label="Suppress hets in the input" />
     </inputs>
-    <outputs>
-        <data name="default" format_source="in_fa1" label="Merger of $in_fa1.name and $in_fa2.name"/>
+    <outputs provided_metadata_file="outputs.json">
+        <data name="default" format="auto" label="${tool.name} on ${on_string}" />
     </outputs>
     <tests>
         <test>
@@ -52,24 +63,27 @@
     <help><![CDATA[
 **What it does**
 
-Merges two fasta files, using ambiguity codes
+This tool merges two FASTA or FASTQ files into a single FASTA file using IUPAC ambiguity codes where appropriate. 
+When differences occur between the sequences, ambiguity codes are used to represent possible variations. 
 
-::
+Example::
 
-    # seq1.fa
-    >test0
-    ACTGACTGAAA
+  >seq1
+  ACTGACTGAAA
+
+  >seq2
+  ACTGAMTGCGN
 
-    # seq2.fa
-    >test0
-    ACTGAMTGCGN
+will result in::
+
+  >seq1
+  ACTGAMTGMRN
 
-In the following the `-m` option has been set to highlight seqtk-mergefa's features.
+If the `-m` option is in use, however, the tool will pick the least ambiguous base if there is no contradiction between the symbols in the inputs. Conflicts are indicated by using x in the merged sequence and the picked base is converted to lowercase if the less specific symbol is an N to express uncertainty.
+With this logic the input sequences above will result in the merge result::
 
-::
-
-    >test0
-    ACTGACTGxxa
+  >seq1
+  ACTGACTGxxa
 
 @ATTRIBUTION@
     ]]></help>
--- a/seqtk_mergepe.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_mergepe.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_mergepe" name="seqtk_mergepe" version="@TOOL_VERSION@.1">
+<tool id="seqtk_mergepe" name="seqtk_mergepe" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>interleave two unpaired FASTA/Q files for a paired-end file</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -18,7 +18,7 @@
         <param name="in_fq2" type="data" format="fasta,fastq,fasta.gz,fastq.gz" label="Input FASTA/Q file #2"/>
     </inputs>
     <outputs>
-        <data name="default" format_source="in_fq1" label="$in_fq1.name and $in_fq2.name as interleaved paired-end"/>
+        <data name="default" format_source="in_fq1" label="${tool.name} on ${on_string}: interleaved paired-end"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_mutfa.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_mutfa.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_mutfa" name="seqtk_mutfa" version="@TOOL_VERSION@.1">
+<tool id="seqtk_mutfa" name="seqtk_mutfa" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>point mutate FASTA at specified positions</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -18,7 +18,7 @@
         <param name="in_snp" type="data" format="tabular" label="Input SNP file"/>
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="Mutated $in_file.name"/>
+        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}: Mutated"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_randbase.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_randbase.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_randbase" name="seqtk_randbase" version="@TOOL_VERSION@.1">
+<tool id="seqtk_randbase" name="seqtk_randbase" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>choose a random base from hets</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -16,7 +16,7 @@
         <expand macro="in_faq"/>
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="Unambiguous $in_file.name"/>
+        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}: Unambiguous"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_sample.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_sample.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_sample" name="seqtk_sample" version="@TOOL_VERSION@.2">
+<tool id="seqtk_sample" name="seqtk_sample" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>random subsample of fasta or fastq sequences</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -24,7 +24,7 @@
         </section>
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="Subsample of reads from $in_file.name"/>
+        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}: Subsample of reads"/>
     </outputs>
     <tests>
         <test>
--- a/seqtk_seq.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_seq.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_seq" name="seqtk_seq" version="@TOOL_VERSION@.3">
+<tool id="seqtk_seq" name="seqtk_seq" version="@TOOL_VERSION@+galaxy1" profile="22.05">
     <description>common transformation of FASTA/Q</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -34,13 +34,25 @@
 '$in_file'
 @CONDITIONAL_GZIP_OUT@
     ]]></command>
+    <configfiles>
+        <configfile filename="outputs.json">
+#if $A and $in_file.is_of_type('fasta.gz', 'fastq.gz')
+    #set $ext = "fasta.gz"
+#elif $A
+    #set $ext = "fasta"
+#else
+    #set $ext = $in_file.ext
+#end if
+{"default": {"ext": "$ext"}}
+        </configfile>
+    </configfiles>
     <inputs>
         <expand macro="in_faq"/>
         <param argument="-q" type="integer" value="0" label="Mask bases with quality lower than INT" />
         <param argument="-X" type="integer" value="255" label="Mask bases with quality higher than INT" />
-        <param argument="-n" type="text" value="0" label="Masked bases converted to CHAR; 0 for lowercase" />
+        <param argument="-n" type="text" value="" label="Masked bases converted to CHAR; leave empty for lowercase masking" />
         <param argument="-l" type="integer" value="0" label="Number of residues per line; 0 for 2^32-1" />
-        <param argument="-Q" type="integer" value="33" label="Quality shift: ASCII-INT gives base quality" />
+        <param argument="-Q" type="integer" value="33" label="Quality shift: ASCII-INT gives base quality" help="Only applied during comparison to quality thresholds for masking" />
         <param argument="-s" type="integer" value="11" label="Random seed" help="Effective with -f" />
         <param argument="-f" type="float" value="1" label="Sample fraction of sequences" />
         <param argument="-M" type="data" format="bed,txt" optional="true" label="Mask regions in BED or name list file" />
@@ -53,26 +65,37 @@
         <param name="x1" argument="-1" type="boolean" truevalue="-1" falsevalue="" checked="false" label="Output the 2n-1 reads only" />
         <param name="x2" argument="-2" type="boolean" truevalue="-2" falsevalue="" checked="false" label="Output the 2n reads only" />
     </inputs>
-    <outputs>
-        <data name="default" format_source="in_file" />
+    <outputs provided_metadata_file="outputs.json">
+        <data name="default" format="auto" label="${tool.name} on ${on_string}" />
     </outputs>
+
     <tests>
         <!-- This is a sorry excuse for a test for a tool which does way more
              than it should, but upstream decided to put a TON of functionality
              into a single tool rather than using the single responsibility
              principle. -->
-        <test>
+        <test expect_num_outputs="1">
             <param name="in_file" value="seqtk_seq.fa"/>
             <param name="r" value="True"/>
             <param name="n" value=""/>
             <output name="default" file="seqtk_seq_revcom.fa" ftype="fasta"/>
         </test>
-        <test>
+        <test expect_num_outputs="1">
             <param name="in_file" value="seqtk_seq.fa.gz" ftype="fasta.gz"/>
             <param name="r" value="True"/>
             <param name="n" value=""/>
             <output name="default" file="seqtk_seq_revcom.fa.gz" ftype="fasta.gz"/>
         </test>
+        <test expect_num_outputs="1">
+            <param name="in_file" value="seqtk_trimfq.fq" ftype="fastq"/>
+            <param name="A" value="True" />
+            <output name="default" file="seqtk_seq_A.fasta" ftype="fasta"/>
+        </test>
+        <test expect_num_outputs="1">
+            <param name="in_file" value="seqtk_trimfq.fq.gz" ftype="fastq.gz"/>
+            <param name="A" value="True" />
+            <output name="default" file="seqtk_seq_A.fasta.gz" ftype="fasta.gz"/>
+        </test>
     </tests>
     <help><![CDATA[
 **What it does**
--- a/seqtk_subseq.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_subseq.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,11 +1,11 @@
 <?xml version="1.0"?>
-<tool id="seqtk_subseq" name="seqtk_subseq" version="@TOOL_VERSION@.1">
+<tool id="seqtk_subseq" name="seqtk_subseq" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>extract subsequences from FASTA/Q files</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
         <requirement type="package" version="@AWK_VERSION@">gawk</requirement>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -41,7 +41,7 @@
         <param argument="-l" type="integer" value="0" label="Sequence line length" />
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="Selected sequences from $in_file.name">
+        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}: Selected sequences">
             <change_format>
                 <when input="t" value="-t" format="tabular"/>
             </change_format>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/seqtk_telo.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -0,0 +1,61 @@
+<?xml version="1.0"?>
+<tool id="seqtk_telo" name="seqtk_telo" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
+    <description>find telomeres</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="bio_tools"/>
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
+    <command><![CDATA[
+seqtk telo
+-m '$m'
+-p '$p'
+-d '$d'
+-s '$s'
+$P
+'$in_file'
+> '$default'
+    ]]></command>
+    <inputs>
+        <expand macro="in_faq"/>
+        <param argument="-m" type="text" value="CCCTAA" label="Telomere repeat to search for. Default is vertebrate" />
+        <param argument="-p" type="integer" value="1" label="Penalty for a non-repeat" />
+        <param argument="-d" type="integer" value="2000" label="Maximum drop" />
+        <param argument="-s" type="integer" value="300" label="Minimum score" />
+        <param argument="-P" type="boolean" truevalue="-P" falsevalue="" checked="false" label="Print scoring" />
+    </inputs>
+    <outputs>
+        <data name="default" format="bed" label="${tool.name} on ${on_string}: telomers"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="in_file" value="seqtk_telo.fa"/>
+            <output name="default" file="seqtk_telo.out" ftype="bed"/>
+        </test>
+        <test>
+            <param name="in_file" value="seqtk_telo.fa.gz" ftype="fasta.gz"/>
+            <output name="default" file="seqtk_telogz.out" ftype="bed"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+**What it does**
+
+Identifies telomeres using a default vertebrate repeat sequence CCCTAA, or a user supplied one
+
+
+::
+
+     Usage: seqtk telo [options] <in.fq>
+     Options:
+     -m STR     motif [CCCTAA]
+     -p INT     penalty [1]
+     -d INT     max drop [2000]
+     -s INT     min score [300]
+     -P         print scoring
+
+
+@ATTRIBUTION@
+    ]]></help>
+    <expand macro="citation" />
+</tool>
--- a/seqtk_trimfq.xml	Thu Oct 14 09:21:45 2021 +0000
+++ b/seqtk_trimfq.xml	Wed Oct 16 09:08:17 2024 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
-<tool id="seqtk_trimfq" name="seqtk_trimfq" version="@TOOL_VERSION@.1">
+<tool id="seqtk_trimfq" name="seqtk_trimfq" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05">
     <description>trim FASTQ using the Phred algorithm</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <expand macro="stdio"/>
     <command><![CDATA[
@@ -37,7 +37,7 @@
         </conditional>
     </inputs>
     <outputs>
-        <data name="default" format_source="in_file" label="$in_file.name trimmed"/>
+        <data name="default" format_source="in_file" label="${tool.name} on ${on_string}: trimmed"/>
     </outputs>
     <tests>
         <test>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/seqtk_seq_A.fasta	Wed Oct 16 09:08:17 2024 +0000
@@ -0,0 +1,2 @@
+>SEQ_ID1
+GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
Binary file test-data/seqtk_seq_A.fasta.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/seqtk_telo.fa	Wed Oct 16 09:08:17 2024 +0000
@@ -0,0 +1,131 @@
+>test
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+GCACTCGCCGCGAGGGTTGCCGGGACGGGCCCAAGATGGCTGAGCGCCTT
+GGTTCCGCTTCTGCCTGCCGCGCAGAGCCCCATTCATTGCCTTGCTGCTA
+AGTGGCGCCGCGTAGTGCCAGTAGGCTCCAAGTCTTCAGGGTCTGTCCCA
+TCGGGCAGGAAGCCGTCATGGCAACCCTGGAAAAGCTGATGAAGGCTTTC
+GAGTCGCTCAAGTCGTTTCAGCAGCAACAGCAGCAGCAGCCACCGCCGCA
+GGCGCCGCCGCCACCGCCGCCGCCGCCTCCGCCTCAACCCCCTCAGCCGC
+CGCCTCAGGGGCAGCCGCCGCCGCCACCACCGCCGCTGCCAGGTCCGGCA
+GAGGAACCGCTGCACCGACCGTGAGTCCGGGCGCCGCAGCTCCCGCCCGG
+GCCCCGCGCCCCTGGCCTGCGTGCTGGGCATGGCCAACACTGTTCCCTGT
+CCAGAGGGTCGCGGTACCTCCCTGAGGCCAGGCTTTCCCGGCCCGGGCCC
+TCGTCTTGCGGGGTCTCTGGCCTCCCTCAGAGGAGACAGAGCCGGGTCAG
+GCCAGCCAGGGACTCGCTGAGGGGCGTCACGACTCCAGTGCCTTCGCCGT
+TCCCAGTTTGCGAAGTTAGGGAACGAACTTGTTTCTCTCTTCTGGAGAAA
+CTGGGGCGGTGGCGCACATGACTGTTGTGAAGAGAACTTGGAGAGGCAGA
+GATCTCTAGGGTTACCTCCTCATCAGGCCTAAGAGCTGGGAGTGCAGGAC
+AGCGTGAGAGATGTGCGGGTAGTGGATGACATAATGCTTTTAGGAGGTCT
+CGGCGGGAGTGCTGAGGGCGGGGGAGTGTGAACGCATCCAATGGGATATT
+CTTTTTCCAAGTGACACTTGAAGCAGCCTGTGACTCGAGGCACTTCGTAC
+TCTCCTGGCGTTTCATTTAGTTTGTGGTGTAGTGTAGTTAAACCAGGTTT
+TAAGCATAGCCAGAGAGGTGTGCTTCTGTGTGTCTGCAGGCAGTTGGATG
+AGTTGTATTTGTCAAGTACATGGTGAGTTACTTAGGTGTGATTATTAATA
+AAAAACTATATGTGTGCATATATATGAAAGAGTCGACTTATACTTAACTG
+CCTATCGATTTTTTGTTCTATATAAAACGGATACATTGGTGGTGCTCAGT
+TTTCACCGGGGAATGAATTTTACTAGTGTTGCAGACAGGCTTGTTTTAGA
+ACATAGGCCACTCTGACTCTGACTTTGTGCCAGTAAAAGTTCCTGTTTAG
+TTCTTTGCTGACATCTTATAGATCTTTGGAAGCTAGCTGCTTGTGACTGG
+AGAGAATATTGAAACAGAAGAGAGACCATGAGTCACAGTGCTCTAAGAGA
+AAAGAGACGCTCAAAACATTTCCTGGAAATCCATGCTGAGTGTTGAGCCC
+TGTGCTCTCTTGCAGCTCAGTCCTTTCTCTCAACTCTGGGCATTTTATTT
+CTAATCTGGATTTGTATAATTAATAAGGAGAACTTTTGGGAACAACCTAC
+TAAAGAATGTCATCATTAAAACTCACTTAGAAAATAAGTGTTCTGGTGAT
+ATCATTGAGCTATGTTCCCAGTCCTGAGAGTTTGTTTTTTTTTTTTTTTT
+TAAATAAAGATTTGGGGAGAAAAGGTGGCTTACTTGATAGAACAAAATAT
+AGGAATAAAATTTCCTTCTATAAGGTGAAAAGTGTGAATAGAAAACTTCT
+TATCCTCTAGATAAGTAGTTTCTTTTTGCTTTTGAGAGTCTCACTATGTA
+ACTCTTGACCTGAACTCAGAGAGATCCATCCTCCTGCCTCTGCCTCCTCT
+CTCTGGGATTAAAGGCATGTGGCACCATGCTGGGCTGTCCAAGTATGCCA
+CAGACCCTCTAGGTCCCTGGTCTTCGAGGAACGGGATTTCTTAGGCAGAT
+GGGTAAGGAGTCGGATGAAAATGACAATCAGCCACACACAAGAGAGGTGT
+TGAATCTGAATGTAATGTTCTGGTTGAGCTTCAGACTTATATAACAACGA
+ATTATCAGAGGATACAAATCACAAAAAGACAAGATACACTGAAATTCACC
+AGTTACAGCAGAAAGGAATTTGCAGGGACTAATTAAATGTTTACATTAGG
+GATAACAAGCCCTGCCTAGGATCAGCCTAATGCCAGGCAAGAATTTCACA
+CTTTAAGGTTAAAAGCATCAGGGGGTTGTTAACTCTTGACAGGCCTTAAG
+AGTAATGTGCTATCACTGAGCTCTAAATTCTTAGGTCTAGTAAAACTTAT
+CCTGTCTGGAGAGTTCCCCCTTATCAGGGTAGTATATCAACTTATACTTG
+ACATGGAATGAAGCCTGTAGTAAAACATTTCTATCTCAGTGAGACTTTTA
+GTCTCTATCTGTAAACAGCTGAGTAAAATGGCAAGTGCTTAATTGTTTAC
+TGAATGGGTTAAGCTCCTTGCTGCTATCTGGAATCTAAGAACACTGGGGA
+AAGGCTTTAGCTATGTTAGAATACAATATTAAAAGGCATTTACTATAAGG
+TGATGCTTAATAGAGTGCACGTGAATCTATACACTAGATTAATGTGGTGG
+AAATTTGAATATAATGGGTTAGGGAAAGAGATGCCATAACTCTGGGAGGA
+AAATTTCCCTGGACTCTTATCCTCGTGAAACAGCTTCCAGGCTTTTCGCC
+TGACAAACCGATCCAAACTGGAGAGTTGGCTTTCGCCAGAATATCCAGGA
+GGAGAGTCCTAGAAATTCATTTCTCATGAGCAGCTTTTTGGCATTTTTGC
+CTCACAAGCTGACTCCACCAGAGTACCCTGACACAAGTATTGTCTAGTTA
+TTTTGATTATTACCATGACTCTGCCTCTGGGTGAGAGGAATTGTGGAAGT
+TTACATATTCCCCATATCTTCTATAAACCTCTGTGTGTGTGTGTGTGTGT
+GTGTGTGTGTGTGTGTGTGTGTGTATGAGGGAGAGAGAGGGAGAGAGAGA
+GAGGGAGGGAGGAAGAGAGAGAGAGAGATTGTTCTGTGCCTGCTTCGAAC
+ACAAATTAGTTTGCAAAAGTAATTCATTAACATGATACAGTCCCAAAGAT
+AAAAATGGTTAAATAATGAAAACATCTCCCTCCCCATTTTCCTAACTTTG
+TACCCAGGAGCAAGCTCTGTTACACTTCATTTGTCCTTCCAGATAAAATT
+TGGGCATATGTTAGGACAGAATTTTAAATTATTTACAAACAAAAGTATTT
+TGGAACAAAAGCTTTTAAAAGCTTTTATTTTAATAAAATAACTTGTTACT
+ACACTGTATATAACTAACTAACATTTTCCAAAATTAGCTCCATTAGCATC
+TATCTCATATTTCTATGTACTTTGCTGTTGAAAAACCAAGTGTTCATTAA
+TAATAAGTAACAAACTCACTGCTTGGAAGCTTTGATTTTTGGCATTTTGT
+CCACTTGACTCAGTTAAAAGTCCTTTTTTTCGAAATGAGAACAGCCAAAA
+CAGTTTTAGAATGAGTCTGTTCTGCTTTTGTGACTCTCATTGTGTTCTGT
+AGAACCAGTGTCACAGCCATATGTGGGCCTCTGTTGAAGTAGCTGAGAAC
+TTGTTCTCTGCTCTGCTAGCTGCTGTCGATCTGATAGGCCTTGAACAGTT
+GACATTCACCCTTAATAGTCCTCATTAGTCTTCCTGAGCATAGTCATTCA
+TTTATCAATATTTGCTGATCATCTCCTATGTGCCTAGCATTGTTCTAGTT
+GCAGGTTTTAGCAGGGAACAAAGTCATGTCTCATGAAGCTAAAATTCTTG
+GGAGAGACATAGACAGTAAGCAGAATAGTTTGTTCATAGTGAGTGATGAG
+GCGCATGCAGTAAAGTAGGGAAGGGGATTAGGAAATGCCAGGGCTTGACA
+TGTTTTAGACAGGGTGTTTAAATAATATCTGCTTAGTTGAAGGCTTATTT
+TTGAATAAATATCTGAAGAGTCAGAAATCTACCAGGAGGGTGTATGGAAG
+AGGAGTATTCCTGCAAGGGGAAGTTGTCAAAGGCTTTCCTGTGTGGGGAT
+TAGTGATGTCATGTTTTTGCTGGATGAAATGAGTGACGGTAAGAGTTGTA
+GTGGGGGTGAAGCAAAGGGTTGAGGGAGGCTTCATTGGTGTTATCAGTTA
+CTGCATTTATCTCCAAATAGAGAACGTAGCAATGAAAGCTACAGAGAACG
+GGAAAGGTGAGGATTTATTCTAAGACAAAATAAGTGTAGGAAGTTTAACA
+ATTAGATCAGGAGCACAGACTCCAAGTCTAAGTCTTCATTCTTGCACATT
+TTTTAAAAATTTTGTTATGTGTTCTGGATACTATTTCCTTATGAGATATA
+AGTTTAAAAGCCTTTCTGTGGATTGCCTTGCCTTTGTTGTTGTTGTTTGT
+TTTGTTTTGTTTTGTTGAGACAGGTCTCTCTATGTAGCCTTGACTGTCCT
+GAAAATCACTCTGTAGACCAGGCTGGCCTGGAACTCAGAGATCTGCCTGC
+TTCTGCTTTTCAAGTGCTGATATTAAATGTATGTGCCACCACTGCCAGGC
+TAAGATTGTTCTTTCAATTTCTTTTTTTGTTTTCTTTTGAGATCAAAGTT
+TGCTATGTACTTTTGGCTGGCCTGGTATATTGTGTAGTCTAAGTTGGCTT
+CAAATCTTCATGGCACAGATTCCCAAGTACTGGGACCATAGGTATGGCCC
+ATCACAGTGGGGGGTTGGGGGGGCCAGTACATCTATCTCTTGAATGGTGT
+GGAGTGTATATATGTGTTAGGGGTTTGCAGAGGCCAAAAGAATATTGAGT
+GTCTTCCTCTATTGCTCGCCACTTCTCTGAATAAACCTAAAGTTACCAAT
+GGATTTCTAGTAAGCTGACTGACCAGCAAATATTGGGGATCTGTCTGTCC
+CTGTTCACCATAGTGAGGTTACAGACGTGAATAACCACACCCAGTTTTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
+CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
Binary file test-data/seqtk_telo.fa.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/seqtk_telo.out	Wed Oct 16 09:08:17 2024 +0000
@@ -0,0 +1,1 @@
+test	0	1056	7012
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/seqtk_telogz.out	Wed Oct 16 09:08:17 2024 +0000
@@ -0,0 +1,1 @@
+test	0	1056	7012