Mercurial > repos > iuc > hmmer_hmmsearch
changeset 2:7494adc40d89 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
| author | iuc |
|---|---|
| date | Sat, 25 Jun 2016 15:03:08 -0400 |
| parents | 8379c148c499 |
| children | ae9e0b95f0c3 |
| files | macros.xml test-data/MADE1.hmm test-data/MADE1.out test-data/MADE1.out.domtblout test-data/MADE1.out.pfamtblout test-data/globins.domtblout test-data/globins.pfamtblout test-data/globins.tblout test-data/globins4.hmm2 test-data/jackhmmer.domtblout test-data/jackhmmer.tblout test-data/nhmmer.out test-data/phmmer.domtblout test-data/phmmer.pfamtblout test-data/phmmer.tblout test-data/uniprot_globins_match.out tool_dependencies.xml |
| diffstat | 17 files changed, 202 insertions(+), 196 deletions(-) [+] |
line wrap: on
line diff
--- a/macros.xml Mon Oct 19 21:10:24 2015 -0400 +++ b/macros.xml Sat Jun 25 15:03:08 2016 -0400 @@ -2,7 +2,7 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="3.1b1">hmmer</requirement> + <requirement type="package" version="3.1b2">hmmer</requirement> <yield/> </requirements> </xml>
--- a/test-data/MADE1.hmm Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/MADE1.hmm Sat Jun 25 15:03:08 2016 -0400 @@ -1,88 +1,88 @@ -HMMER3/f [3.1 | February 2013] +HMMER3/f [3.1b2 | February 2015] NAME MADE1 ACC DF0000629.2 DESC MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon LENG 80 -MAXL 426 +MAXL 425 ALPH DNA RF yes MM no CONS yes CS no MAP yes -DATE Tue Feb 19 20:33:41 2013 +DATE Sat Jun 25 17:24:24 2016 NSEQ 1997 EFFN 3.911818 CKSUM 3015610723 -STATS LOCAL MSV -8.5786 0.71858 -STATS LOCAL VITERBI -9.3632 0.71858 -STATS LOCAL FORWARD -3.4823 0.71858 +STATS LOCAL MSV -8.5408 0.71858 +STATS LOCAL VITERBI -9.6224 0.71858 +STATS LOCAL FORWARD -3.4150 0.71858 HMM A C G T m->m m->i m->d i->m i->i d->m d->d - COMPO 1.24257 1.59430 1.62906 1.16413 + COMPO 1.24533 1.59094 1.62722 1.16493 1.38629 1.38629 1.38629 1.38629 - 0.03960 3.94183 3.94183 1.46634 0.26236 0.00000 * + 0.21058 4.11281 1.75146 1.46634 0.26236 0.00000 * 1 2.69765 2.44396 2.81521 0.24089 1 t x - - 1.38629 1.38629 1.38629 1.38629 - 0.03960 3.94183 3.94183 1.46634 0.26236 1.09861 0.40547 + 0.03960 3.94183 3.94183 1.46634 0.26236 1.10301 0.40327 2 2.72939 2.37873 2.85832 0.24244 2 t x - - 1.38629 1.38629 1.38629 1.38629 - 0.03725 4.00179 4.00179 1.46634 0.26236 1.09861 0.40547 + 0.03725 4.00179 4.00179 1.46634 0.26236 1.21367 0.35255 3 0.16099 3.16370 2.87328 2.99734 3 a x - - 1.38629 1.38629 1.38629 1.38629 - 0.03604 4.03416 4.03416 1.46634 0.26236 1.09861 0.40547 + 0.03604 4.03416 4.03416 1.46634 0.26236 1.32877 0.30762 4 1.98862 2.42132 0.42649 2.10770 4 g x - - 1.38629 1.38629 1.38629 1.38629 - 0.03539 4.05203 4.05203 1.46634 0.26236 1.09861 0.40547 + 0.03539 4.05203 4.05203 1.46634 0.26236 1.35213 0.29933 5 1.96369 2.69532 0.36534 2.32099 5 g x - - 1.38629 1.38629 1.38629 1.38629 - 0.03764 4.06427 3.92372 1.46634 0.26236 1.09861 0.40547 + 0.03764 4.06427 3.92372 1.46634 0.26236 1.00259 0.45717 6 2.56994 2.11239 2.71946 0.30571 6 t x - - 1.37159 1.41129 1.39124 1.37159 - 0.03806 3.89715 4.07214 1.50442 0.25122 1.00714 0.45454 + 0.03806 3.89715 4.07214 1.50442 0.25122 1.12269 0.39364 7 2.58388 2.10353 2.64646 0.31253 12 t x - - 1.38764 1.38524 1.38764 1.38465 - 0.03494 4.03864 4.09125 1.40070 0.28293 1.09237 0.40860 + 0.03494 4.03864 4.09125 1.40070 0.28293 1.44046 0.27026 8 2.18552 2.70201 0.28821 2.64645 14 g x - - 1.38629 1.38629 1.38629 1.38629 - 0.03628 4.09157 3.96779 1.46634 0.26236 1.09861 0.40547 + 0.03628 4.09157 3.96779 1.46634 0.26236 1.26997 0.32967 9 2.16916 2.82142 0.28427 2.60854 15 g x - - 1.38091 1.39033 1.38365 1.39033 - 0.03566 4.00237 4.08886 1.38021 0.28972 1.01958 0.44745 + 0.03566 4.00237 4.08886 1.38021 0.28972 1.26961 0.32981 10 2.45517 2.15232 2.42886 0.34277 18 t x - - 1.39065 1.39065 1.39065 1.37335 - 0.03536 4.01212 4.09576 1.39554 0.28462 1.09775 0.40589 + 0.03536 4.01212 4.09576 1.39554 0.28462 1.25024 0.33748 11 2.10260 2.95484 0.28160 2.64222 21 g x - - 1.36740 1.40555 1.40555 1.36740 - 0.03843 3.92069 4.02468 1.44733 0.26814 1.09856 0.40549 + 0.03843 3.92069 4.02468 1.44733 0.26814 1.15789 0.37709 12 2.54740 0.30185 2.61355 2.21647 26 c x - - 1.38748 1.38276 1.38748 1.38748 - 0.03457 4.05446 4.09623 1.40847 0.28040 1.05496 0.42803 + 0.03457 4.05446 4.09623 1.40847 0.28040 1.17686 0.36852 13 0.28443 2.72003 2.32214 2.48149 28 a x - - 1.38740 1.38740 1.38298 1.38740 - 0.03441 4.05976 4.10001 1.41198 0.27926 1.09780 0.40587 + 0.03441 4.05976 4.10001 1.41198 0.27926 0.97690 0.47237 14 0.29412 2.55413 2.49679 2.35701 30 a x - - 1.38194 1.39067 1.38194 1.39067 - 0.03505 4.02482 4.10005 1.39522 0.28473 1.09929 0.40512 + 0.03505 4.02482 4.10005 1.39522 0.28473 1.16906 0.37202 15 0.18837 2.99710 2.82270 2.77556 33 a x - - 1.39015 1.39472 1.37503 1.38539 - 0.03725 3.97815 4.02618 1.37955 0.28994 1.10102 0.40426 + 0.03725 3.97815 4.02618 1.37955 0.28994 1.16870 0.37218 16 0.50816 2.05151 2.22111 1.82407 37 a x - - 1.36727 1.38730 1.39683 1.39405 - 0.04830 3.89881 3.61610 1.29026 0.32186 1.05306 0.42905 + 0.04830 3.89881 3.61610 1.29026 0.32186 1.08301 0.41336 17 2.11260 2.73141 0.29747 2.64152 41 g x - - 1.36913 1.40376 1.40376 1.36913 - 0.03705 3.93681 4.08299 1.44872 0.26771 1.07479 0.41759 + 0.03705 3.93681 4.08299 1.44872 0.26771 1.09472 0.40742 18 2.24459 1.90539 2.34054 0.43234 46 t x - - 1.33632 1.42493 1.39937 1.38665 - 0.04427 3.64574 4.06297 1.70501 0.20061 1.21309 0.35279 + 0.04427 3.64574 4.06297 1.70501 0.20061 1.19872 0.35894 19 0.44322 2.17202 2.18055 2.03175 57 a x - - 1.41047 1.41471 1.36338 1.35797 - 0.03970 3.81957 4.07540 1.65588 0.21186 1.22788 0.34660 + 0.03970 3.81957 4.07540 1.65588 0.21186 1.24390 0.34004 20 0.33340 2.42691 2.40824 2.25160 66 a x - - 1.29389 1.44615 1.37917 1.43324 - 0.04223 3.70146 4.09459 1.55158 0.23815 1.05880 0.42598 - 21 2.50563 1.98543 2.69601 0.33746 74 t x - - + 0.04223 3.70146 4.09459 1.55158 0.23815 1.01872 0.44794 + 21 2.50563 1.98543 2.69600 0.33746 74 t x - - 1.39462 1.39462 1.42862 1.32990 0.04184 3.80216 3.98177 1.80466 0.17976 1.00279 0.45705 22 2.54484 1.97505 2.66483 0.33806 84 t x - - @@ -201,64 +201,64 @@ 0.03641 3.98130 4.06929 1.35873 0.29704 1.31330 0.31325 60 0.41612 2.39160 1.97116 2.21075 1037 a x - - 1.03649 1.46430 1.57421 1.57557 - 0.04769 3.52580 4.06641 2.32461 0.10294 0.84329 0.56263 + 0.04787 3.52599 4.05584 2.32461 0.10294 0.84329 0.56263 61 2.66264 2.12302 2.82746 0.28581 1056 t x - - 1.36925 1.39635 1.38930 1.39048 - 0.04097 3.97400 3.84718 1.39433 0.28502 1.12205 0.39395 + 0.04103 3.97406 3.84419 1.39433 0.28502 1.12555 0.39227 62 2.26510 2.13196 2.42551 0.37231 1060 t x - - 1.37965 1.39147 1.39147 1.38264 - 0.04082 3.91610 3.90805 1.24613 0.33914 0.95192 0.48776 + 0.04136 3.91664 3.88204 1.24613 0.33914 0.95630 0.48501 63 0.41244 2.25761 2.16787 2.12907 1062 a x - - 1.34515 1.41203 1.41203 1.37753 - 0.04054 3.77835 4.08203 1.30483 0.31638 1.11819 0.39582 + 0.04086 3.77867 4.06371 1.30483 0.31638 1.13245 0.38897 64 2.51464 0.37905 2.62296 1.82008 1068 c x - - 1.39543 1.38753 1.39233 1.37008 - 0.03854 3.90584 4.03535 1.36573 0.29463 1.13682 0.38689 + 0.03884 3.90614 4.01884 1.36573 0.29463 1.15716 0.37743 65 2.16380 2.11332 2.18714 0.42765 1073 t x - - 1.38764 1.38471 1.38519 1.38764 - 0.03575 4.05376 4.03073 1.40080 0.28289 1.03825 0.43707 + 0.03603 4.05405 4.01529 1.40080 0.28289 1.06383 0.42332 66 2.79349 2.39141 2.87271 0.23478 1075 t x - - 1.37227 1.39101 1.39101 1.39101 - 0.03597 4.01447 4.05827 1.39017 0.28639 1.06429 0.42308 + 0.03884 4.01734 3.90722 1.39017 0.28639 1.09574 0.40690 67 2.82488 2.47749 2.93179 0.21887 1078 t x - - 1.38141 1.39112 1.38915 1.38353 - 0.03661 3.99477 4.04370 1.35958 0.29675 1.13439 0.38804 + 0.03675 3.99492 4.03549 1.35958 0.29675 1.21867 0.35044 68 2.77679 2.30433 2.90694 0.24425 1081 t x - - 1.37593 1.38989 1.45520 1.32825 - 0.04447 3.68736 3.99242 1.76176 0.18843 0.98580 0.46703 + 0.04566 3.68855 3.93098 1.76176 0.18843 1.07133 0.41939 69 2.47698 3.17398 0.19595 2.95437 1093 g x - - 1.38264 1.38264 1.39734 1.38264 - 0.05358 3.96553 3.40487 1.40348 0.28202 1.03112 0.44100 + 0.05482 3.96677 3.36946 1.40348 0.28202 1.13963 0.38557 70 2.84327 0.27906 2.97336 2.00890 1097 c x - - 1.38629 1.38629 1.38629 1.38629 - 0.03412 4.08811 4.08811 1.46634 0.26236 0.69006 0.69625 + 0.03475 4.08873 4.05197 1.46634 0.26236 0.79234 0.60291 71 0.21870 2.83638 2.69251 2.65798 1098 a x - - 1.37446 1.37942 1.39640 1.39509 - 0.03670 3.93983 4.09935 1.41905 0.27700 1.10002 0.40476 + 0.04066 3.94379 3.88865 1.41905 0.27700 1.24551 0.33939 72 2.35233 0.46085 2.23804 1.78715 1103 c x - - 1.38536 1.38781 1.38781 1.38421 - 0.03493 4.03822 4.09272 1.39310 0.28542 1.09638 0.40658 + 0.03885 4.04214 3.88532 1.39310 0.28542 1.30851 0.31501 73 2.57111 0.32543 2.74124 1.98892 1105 c x - - 1.38629 1.38629 1.38629 1.38629 - 0.03381 4.09688 4.09688 1.46634 0.26236 1.09626 0.40664 + 0.03403 4.09710 4.08422 1.46634 0.26236 1.37004 0.29316 74 0.27014 2.61416 2.53262 2.47636 1106 a x - - 1.38629 1.38629 1.38629 1.38629 - 0.03461 4.09267 4.05587 1.46634 0.26236 1.09748 0.40603 + 0.03889 4.09695 3.83874 1.46634 0.26236 1.37489 0.29151 75 0.52873 2.16549 1.91736 1.90409 1107 a x - - 1.38629 1.38629 1.38629 1.38629 - 0.03426 4.08396 4.08396 1.46634 0.26236 1.07423 0.41788 + 0.04237 4.09207 3.69758 1.46634 0.26236 1.41112 0.27954 76 2.33134 0.38082 2.65861 1.90055 1108 c x - - 1.38629 1.38629 1.38629 1.38629 - 0.03466 4.07266 4.07266 1.46634 0.26236 1.09861 0.40547 + 0.04659 4.08459 3.55121 1.46634 0.26236 1.54765 0.23921 77 2.20588 0.45134 2.35553 1.84373 1109 c x - - 1.38629 1.38629 1.38629 1.38629 - 0.03550 4.04912 4.04912 1.46634 0.26236 1.09861 0.40547 + 0.05904 4.07266 3.21140 1.46634 0.26236 1.68734 0.20458 78 2.69018 2.22054 2.82311 0.26898 1110 t x - - 1.38629 1.38629 1.38629 1.38629 - 0.03711 4.00561 4.00561 1.46634 0.26236 1.09861 0.40547 + 0.08061 4.04912 2.81320 1.46634 0.26236 1.91269 0.15980 79 0.16248 3.15867 2.86159 2.98963 1111 a x - - 1.38629 1.38629 1.38629 1.38629 - 0.04048 3.92018 3.92018 1.46634 0.26236 1.09861 0.40547 + 0.12592 4.00561 2.30158 1.46634 0.26236 2.22059 0.11490 80 0.17484 3.04770 2.86638 2.88183 1112 a x - - 1.38629 1.38629 1.38629 1.38629 0.02045 3.90014 * 1.46634 0.26236 0.00000 *
--- a/test-data/MADE1.out Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/MADE1.out Sat Jun 25 15:03:08 2016 -0400 @@ -1,17 +1,18 @@ # hmmscan :: search sequence(s) against a profile database -# HMMER 3.1b1 (May 2013); http://hmmer.org/ -# Copyright (C) 2013 Howard Hughes Medical Institute. +# HMMER 3.1b2 (February 2015); http://hmmer.org/ +# Copyright (C) 2015 Howard Hughes Medical Institute. # Freely distributed under the GNU General Public License (GPLv3). # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query sequence file: test-data/dna_target.fa -# target HMM database: test-data/MADE1.hmm -# per-seq hits tabular output: t.tbl -# per-dom hits tabular output: t.domtbl -# pfam-style tabular hit output: t.pfamtbl +# query sequence file: /tmp/tmpYWzicI/files/000/dataset_20.dat +# target HMM database: /tmp/tmpYWzicI/files/000/dataset_19.dat +# per-seq hits tabular output: /tmp/tmpYWzicI/files/000/dataset_22.dat +# per-dom hits tabular output: /tmp/tmpYWzicI/files/000/dataset_23.dat +# pfam-style tabular hit output: /tmp/tmpYWzicI/files/000/dataset_24.dat # max ASCII text line length: unlimited # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 # random number seed set to: 4 +# number of worker threads: 1 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: humanchr1/239220001-239550000 [L=330000] @@ -19,51 +20,51 @@ --- full sequence --- --- best 1 domain --- -#dom- E-value score bias E-value score bias exp N Model Description ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- - 7.1e-18 51.5 28.5 2e-12 34.0 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 1e-17 51.0 28.5 2.7e-12 33.7 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Domain annotation for each model (and alignments): >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- - 1 ? -4.3 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 - 2 ? -6.7 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 - 3 ! 27.6 0.7 2e-10 2e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 - 4 ! 34.0 0.7 2e-12 2e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 - 5 ? 2.8 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 + 1 ? -4.2 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 + 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 + 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 + 4 ! 33.7 0.7 2.7e-12 2.7e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 + 5 ? 2.9 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 Alignments for each domain: - == domain 1 score: -4.3 bits; conditional E-value: 1 + == domain 1 score: -4.2 bits; conditional E-value: 1 xxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 30 ttgccattacttttaatggcaaaaa 54 + MADE1 30 ttgccattacttttaatggcaaaaa 54 t g catt ttt aatggcaaa a humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 45789****************9966 PP - == domain 2 score: -6.7 bits; conditional E-value: 1 + == domain 2 score: -6.6 bits; conditional E-value: 1 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 + MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 78999999999999999999999984444444457777777899998876....77777888876 PP - == domain 3 score: 27.6 bits; conditional E-value: 2e-10 + == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF - MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514 79***************************************964443333333333330 PP - == domain 4 score: 34.0 bits; conditional E-value: 2e-12 + == domain 4 score: 33.7 bits; conditional E-value: 2.7e-12 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 + MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 - 56899******************************************963333233345578**************997 PP + 56899******************************************963333233345578**************996 PP - == domain 5 score: 2.8 bits; conditional E-value: 0.011 + == domain 5 score: 2.9 bits; conditional E-value: 0.011 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 + MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 222222222222.3455779************************98765 PP @@ -80,7 +81,7 @@ Passed Fwd filter: 1 (1); expected 0.0 (1e-05) Initial search space (Z): 1 [actual number of targets] Domain search space (domZ): 1 [number of targets reported over threshold] -# CPU time: 0.52u 0.03s 00:00:00.55 Elapsed: 00:00:00.54 -# Mc/sec: 48.89 +# CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16 +# Mc/sec: 165.00 // [ok]
--- a/test-data/MADE1.out.domtblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/MADE1.out.domtblout Sat Jun 25 15:03:08 2016 -0400 @@ -1,18 +1,18 @@ # --- full sequence --- -------------- this domain ------------- hmm coord ali coord env coord # target name accession tlen query name accession qlen E-value score bias # of c-Evalue i-Evalue score bias from to from to from to acc description of target #------------------- ---------- ----- -------------------- ---------- ----- --------- ------ ----- --- --- --------- --------- ------ ----- ----- ----- ----- ----- ----- ----- ---- --------------------- -MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 7.1e-18 51.5 28.5 1 5 1 1 -4.3 0.1 30 54 80044 80068 80030 80073 0.80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon -MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 7.1e-18 51.5 28.5 2 5 1 1 -6.7 3.3 13 71 154012 154072 154011 154076 0.75 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon -MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 7.1e-18 51.5 28.5 3 5 2e-10 2e-10 27.6 0.7 1 44 174456 174514 174456 174577 0.62 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon -MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 7.1e-18 51.5 28.5 4 5 2e-12 2e-12 34.0 0.7 2 80 302388 302466 302387 302466 0.86 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon -MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 7.1e-18 51.5 28.5 5 5 0.011 0.011 2.8 0.7 27 75 304060 304107 304021 304109 0.61 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 1e-17 51.0 28.5 1 5 1 1 -4.2 0.1 30 54 80044 80068 80030 80073 0.80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 1e-17 51.0 28.5 2 5 1 1 -6.6 3.3 13 71 154012 154072 154011 154076 0.75 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 1e-17 51.0 28.5 3 5 2.4e-10 2.4e-10 27.4 0.7 1 44 174456 174514 174456 174577 0.62 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 1e-17 51.0 28.5 4 5 2.7e-12 2.7e-12 33.7 0.7 2 80 302388 302466 302387 302466 0.86 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 80 humanchr1/239220001-239550000 - 330000 1e-17 51.0 28.5 5 5 0.011 0.011 2.9 0.7 27 75 304060 304107 304021 304109 0.61 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon # # Program: hmmscan -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SCAN -# Query file: test-data/dna_target.fa -# Target file: test-data/MADE1.hmm -# Option settings: hmmscan --tblout tblout --domtblout domtblout --pfamtblout pfamtblout test-data/MADE1.hmm test-data/dna_target.fa -# Current dir: /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer -# Date: Tue Feb 10 14:40:35 2015 +# Query file: /tmp/tmpYWzicI/files/000/dataset_2.dat +# Target file: /tmp/tmpYWzicI/files/000/dataset_1.dat +# Option settings: hmmscan --tblout /tmp/tmpYWzicI/files/000/dataset_4.dat --domtblout /tmp/tmpYWzicI/files/000/dataset_5.dat --pfamtblout /tmp/tmpYWzicI/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpYWzicI/files/000/dataset_1.dat /tmp/tmpYWzicI/files/000/dataset_2.dat +# Current dir: /tmp/tmpYWzicI/job_working_directory/000/3 +# Date: Sat Jun 25 19:05:15 2016 # [ok]
--- a/test-data/MADE1.out.pfamtblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/MADE1.out.pfamtblout Sat Jun 25 15:03:08 2016 -0400 @@ -3,25 +3,25 @@ # # name bits E-value n exp bias description # ------------------- ------ --------- --- ----- ----- --------------------- -MADE1 51.5 7.1e-18 5 9.6 28.5 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 51.0 1e-17 5 9.6 28.5 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon # Domain scores # ------------- # # name bits E-value hit bias env-st env-en ali-st ali-en hmm-st hmm-en description # ------------------- ------ --------- ----- ----- ------ ------ ------ ------ ------ ------ --------------------- -MADE1 34.0 2e-12 4 0.7 302387 302466 302388 302466 2 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon -MADE1 27.6 2e-10 3 0.7 174456 174577 174456 174514 1 44 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon -MADE1 2.8 0.011 5 0.7 304021 304109 304060 304107 27 75 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon -MADE1 -4.3 1 1 0.1 80030 80073 80044 80068 30 54 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon -MADE1 -6.7 1 2 3.3 154011 154076 154012 154072 13 71 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 33.7 2.7e-12 4 0.7 302387 302466 302388 302466 2 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 27.4 2.4e-10 3 0.7 174456 174577 174456 174514 1 44 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 2.9 0.011 5 0.7 304021 304109 304060 304107 27 75 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 -4.2 1 1 0.1 80030 80073 80044 80068 30 54 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 -6.6 1 2 3.3 154011 154076 154012 154072 13 71 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon # # Program: hmmscan -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: test-data/dna_target.fa -# Target file: test-data/MADE1.hmm -# Option settings: hmmscan --tblout tblout --domtblout domtblout --pfamtblout pfamtblout test-data/MADE1.hmm test-data/dna_target.fa -# Current dir: /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer -# Date: Tue Feb 10 14:40:35 2015 +# Query file: /tmp/tmpYWzicI/files/000/dataset_2.dat +# Target file: /tmp/tmpYWzicI/files/000/dataset_1.dat +# Option settings: hmmscan --tblout /tmp/tmpYWzicI/files/000/dataset_4.dat --domtblout /tmp/tmpYWzicI/files/000/dataset_5.dat --pfamtblout /tmp/tmpYWzicI/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpYWzicI/files/000/dataset_1.dat /tmp/tmpYWzicI/files/000/dataset_2.dat +# Current dir: /tmp/tmpYWzicI/job_working_directory/000/3 +# Date: Sat Jun 25 19:05:15 2016 # [ok]
--- a/test-data/globins.domtblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/globins.domtblout Sat Jun 25 15:03:08 2016 -0400 @@ -5,11 +5,11 @@ sp|P02024|HBB_GORGO - 147 globins4 - 149 9.2e-69 217.2 0.1 1 1 1e-68 1e-68 217.0 0.1 1 149 2 147 2 147 0.99 Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2 # # Program: hmmsearch -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: test-data/globins4.hmm -# Target file: test-data/uniprot_matches.fasta -# Option settings: hmmsearch --tblout test-data/globins.tblout --domtblout test-data/globins.domtblout --pfamtblout test-data/globins.pfamtblout --notextw -E 10 --domE 10 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 2 test-data/globins4.hmm test-data/uniprot_matches.fasta -# Current dir: /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer -# Date: Mon Feb 9 14:36:36 2015 +# Query file: /tmp/tmpJW6ntL/files/000/dataset_1.dat +# Target file: /tmp/tmpJW6ntL/files/000/dataset_2.dat +# Option settings: hmmsearch --tblout /tmp/tmpJW6ntL/files/000/dataset_4.dat --domtblout /tmp/tmpJW6ntL/files/000/dataset_5.dat --pfamtblout /tmp/tmpJW6ntL/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpJW6ntL/files/000/dataset_1.dat /tmp/tmpJW6ntL/files/000/dataset_2.dat +# Current dir: /tmp/tmpJW6ntL/job_working_directory/000/3 +# Date: Sat Jun 25 19:27:08 2016 # [ok]
--- a/test-data/globins.pfamtblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/globins.pfamtblout Sat Jun 25 15:03:08 2016 -0400 @@ -15,11 +15,11 @@ sp|P02024|HBB_GORGO 217.0 1e-68 1 0.1 2 147 2 147 1 149 Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2 # # Program: hmmsearch -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: test-data/globins4.hmm -# Target file: test-data/uniprot_matches.fasta -# Option settings: hmmsearch --tblout test-data/globins.tblout --domtblout test-data/globins.domtblout --pfamtblout test-data/globins.pfamtblout --notextw -E 10 --domE 10 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 2 test-data/globins4.hmm test-data/uniprot_matches.fasta -# Current dir: /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer -# Date: Mon Feb 9 14:36:36 2015 +# Query file: /tmp/tmpJW6ntL/files/000/dataset_1.dat +# Target file: /tmp/tmpJW6ntL/files/000/dataset_2.dat +# Option settings: hmmsearch --tblout /tmp/tmpJW6ntL/files/000/dataset_4.dat --domtblout /tmp/tmpJW6ntL/files/000/dataset_5.dat --pfamtblout /tmp/tmpJW6ntL/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpJW6ntL/files/000/dataset_1.dat /tmp/tmpJW6ntL/files/000/dataset_2.dat +# Current dir: /tmp/tmpJW6ntL/job_working_directory/000/3 +# Date: Sat Jun 25 19:27:08 2016 # [ok]
--- a/test-data/globins.tblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/globins.tblout Sat Jun 25 15:03:08 2016 -0400 @@ -5,11 +5,11 @@ sp|P02024|HBB_GORGO - globins4 - 9.2e-69 217.2 0.1 1e-68 217.0 0.1 1.0 1 0 0 1 1 1 1 Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2 # # Program: hmmsearch -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: test-data/globins4.hmm -# Target file: test-data/uniprot_matches.fasta -# Option settings: hmmsearch --tblout test-data/globins.tblout --domtblout test-data/globins.domtblout --pfamtblout test-data/globins.pfamtblout --notextw -E 10 --domE 10 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 2 test-data/globins4.hmm test-data/uniprot_matches.fasta -# Current dir: /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer -# Date: Mon Feb 9 14:36:36 2015 +# Query file: /tmp/tmpJW6ntL/files/000/dataset_1.dat +# Target file: /tmp/tmpJW6ntL/files/000/dataset_2.dat +# Option settings: hmmsearch --tblout /tmp/tmpJW6ntL/files/000/dataset_4.dat --domtblout /tmp/tmpJW6ntL/files/000/dataset_5.dat --pfamtblout /tmp/tmpJW6ntL/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpJW6ntL/files/000/dataset_1.dat /tmp/tmpJW6ntL/files/000/dataset_2.dat +# Current dir: /tmp/tmpJW6ntL/job_working_directory/000/3 +# Date: Sat Jun 25 19:27:08 2016 # [ok]
--- a/test-data/globins4.hmm2 Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/globins4.hmm2 Sat Jun 25 15:03:08 2016 -0400 @@ -1,4 +1,4 @@ -HMMER2.0 [converted from 3.1b1] +HMMER2.0 [converted from 3.1b2] NAME globins4 LENG 149 ALPH Amino
--- a/test-data/jackhmmer.domtblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/jackhmmer.domtblout Sat Jun 25 15:03:08 2016 -0400 @@ -93,11 +93,11 @@ MYG_MUSAN - 148 sp|P02024|HBB_GORGO - 143 1e-44 143.3 0.3 1 1 1.1e-44 1.1e-44 143.2 0.3 5 143 2 141 1 141 0.96 - # # Program: jackhmmer -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: /tmp/tmpwsYozTfiles/000/dataset_31.dat -# Target file: /tmp/tmpwsYozTfiles/000/dataset_32.dat -# Option settings: jackhmmer -N 5 --tblout /tmp/tmpwsYozTfiles/000/dataset_34.dat --domtblout /tmp/tmpwsYozTfiles/000/dataset_35.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --fast --hand --symfrac 0.5 --wpb --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 2 /tmp/tmpwsYozTfiles/000/dataset_31.dat /tmp/tmpwsYozTfiles/000/dataset_32.dat -# Current dir: /home/helena/tools-iuc/tools/hmmer3 -# Date: Mon Feb 16 12:23:46 2015 +# Query file: /tmp/tmphb1nFG/files/000/dataset_1.dat +# Target file: /tmp/tmphb1nFG/files/000/dataset_2.dat +# Option settings: jackhmmer -N 5 --tblout /tmp/tmphb1nFG/files/000/dataset_4.dat --domtblout /tmp/tmphb1nFG/files/000/dataset_5.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --fast --hand --symfrac 0.5 --wpb --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmphb1nFG/files/000/dataset_1.dat /tmp/tmphb1nFG/files/000/dataset_2.dat +# Current dir: /tmp/tmphb1nFG/job_working_directory/000/3 +# Date: Sat Jun 25 19:33:04 2016 # [ok]
--- a/test-data/jackhmmer.tblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/jackhmmer.tblout Sat Jun 25 15:03:08 2016 -0400 @@ -93,11 +93,11 @@ MYG_MUSAN - sp|P02024|HBB_GORGO - 1e-44 143.3 0.3 1.1e-44 143.2 0.3 1.0 1 0 0 1 1 1 1 - # # Program: jackhmmer -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: /tmp/tmpwsYozTfiles/000/dataset_31.dat -# Target file: /tmp/tmpwsYozTfiles/000/dataset_32.dat -# Option settings: jackhmmer -N 5 --tblout /tmp/tmpwsYozTfiles/000/dataset_34.dat --domtblout /tmp/tmpwsYozTfiles/000/dataset_35.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --fast --hand --symfrac 0.5 --wpb --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 2 /tmp/tmpwsYozTfiles/000/dataset_31.dat /tmp/tmpwsYozTfiles/000/dataset_32.dat -# Current dir: /home/helena/tools-iuc/tools/hmmer3 -# Date: Mon Feb 16 12:23:46 2015 +# Query file: /tmp/tmphb1nFG/files/000/dataset_1.dat +# Target file: /tmp/tmphb1nFG/files/000/dataset_2.dat +# Option settings: jackhmmer -N 5 --tblout /tmp/tmphb1nFG/files/000/dataset_4.dat --domtblout /tmp/tmphb1nFG/files/000/dataset_5.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --fast --hand --symfrac 0.5 --wpb --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmphb1nFG/files/000/dataset_1.dat /tmp/tmphb1nFG/files/000/dataset_2.dat +# Current dir: /tmp/tmphb1nFG/job_working_directory/000/3 +# Date: Sat Jun 25 19:33:04 2016 # [ok]
--- a/test-data/nhmmer.out Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/nhmmer.out Sat Jun 25 15:03:08 2016 -0400 @@ -1,12 +1,19 @@ # nhmmer :: search a DNA model or alignment against a DNA database -# HMMER 3.1b1 (May 2013); http://hmmer.org/ -# Copyright (C) 2013 Howard Hughes Medical Institute. +# HMMER 3.1b2 (February 2015); http://hmmer.org/ +# Copyright (C) 2015 Howard Hughes Medical Institute. # Freely distributed under the GNU General Public License (GPLv3). # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query file: test-data/MADE1.hmm -# target sequence database: test-data/dna_target.fa +# query file: /tmp/tmpprnvgs/files/000/dataset_1.dat +# target sequence database: /tmp/tmpprnvgs/files/000/dataset_2.dat +# hits tabular output: /tmp/tmpprnvgs/files/000/dataset_4.dat +# hits output in Dfam format: None # max ASCII text line length: unlimited -# number of worker threads: 8 +# SSV filter P threshold: <= 0.02 +# Vit filter P threshold: <= 0.001 +# Fwd filter P threshold: <= 1e-05 +# input query is asserted as: DNA +# random number seed set to: 4 +# number of worker threads: 1 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: MADE1 [M=80] @@ -15,35 +22,35 @@ Scores for complete hits: E-value score bias Sequence start end Description ------- ------ ----- -------- ----- ----- ----------- - 9.6e-11 38.8 7.4 humanchr1/239220001-239550000 302390 302466 - 6.5e-08 29.8 8.3 humanchr1/239220001-239550000 174456 174498 - 1e-07 29.2 6.0 humanchr1/239220001-239550000 302466 302390 - 6.2e-06 23.4 7.0 humanchr1/239220001-239550000 174493 174456 + 1.2e-10 38.6 7.4 humanchr1/239220001-239550000 302390 302466 + 7.8e-08 29.6 8.3 humanchr1/239220001-239550000 174456 174498 + 1.2e-07 28.9 6.0 humanchr1/239220001-239550000 302466 302390 + 7.2e-06 23.3 7.0 humanchr1/239220001-239550000 174493 174456 ------ inclusion threshold ------ 1.4 6.3 7.0 humanchr1/239220001-239550000 304073 304104 Annotation for each hit (and alignments): >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 38.8 7.4 9.6e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 Alignment: - score: 38.8 bits + score: 38.6 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 - 899******************************************955533.443..334.4689************9986 PP + 899******************************************955533.443..334.4689***********99986 PP >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 29.8 8.3 6.5e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 Alignment: - score: 29.8 bits + score: 29.6 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt @@ -51,12 +58,12 @@ 589************************************9975 PP >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 29.2 6.0 1e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.75 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 Alignment: - score: 29.2 bits + score: 28.9 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc @@ -64,21 +71,21 @@ 68999999999999998................5666777776222222222222222268****************************9998 PP >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 23.4 7.0 6.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 Alignment: - score: 23.4 bits + score: 23.3 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 taatg caaaaacc caattacttttgcac aacctaa humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 - 689********************************986 PP + 689********************************985 PP >> humanchr1/239220001-239550000 - score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc - ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 Alignment: @@ -95,12 +102,12 @@ ------------------------------------- Query model(s): 1 (80 nodes) Target sequences: 1 (660000 residues searched) -Residues passing SSV filter: 61658 (0.0934); expected (0.02) -Residues passing bias filter: 45802 (0.0694); expected (0.02) -Residues passing Vit filter: 3544 (0.00537); expected (0.003) -Residues passing Fwd filter: 1934 (0.00293); expected (3e-05) +Residues passing SSV filter: 61794 (0.0936); expected (0.02) +Residues passing bias filter: 46199 (0.07); expected (0.02) +Residues passing Vit filter: 2752 (0.00417); expected (0.001) +Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) Total number of hits: 5 (0.000405) -# CPU time: 0.06u 0.00s 00:00:00.06 Elapsed: 00:00:00.05 -# Mc/sec: 1056.00 +# CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.03 +# Mc/sec: 1760.00 // [ok]
--- a/test-data/phmmer.domtblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/phmmer.domtblout Sat Jun 25 15:03:08 2016 -0400 @@ -92,11 +92,11 @@ sp|P02024|HBB_GORGO - 147 HBB2_TRICR - 145 2.7e-46 144.3 0.0 1 1 1.5e-46 3e-46 144.1 0.0 1 145 2 146 2 146 0.98 Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2 # # Program: phmmer -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: test-data/globins45.fa -# Target file: test-data/uniprot_matches.fasta -# Option settings: phmmer --tblout test-data/phmmer.tblout --domtblout test-data/phmmer.domtblout --pfamtblout test-data/phmmer.pfamtblout --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 2 test-data/globins45.fa test-data/uniprot_matches.fasta -# Current dir: /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer -# Date: Mon Feb 9 15:55:11 2015 +# Query file: /tmp/tmpqKBUss/files/000/dataset_1.dat +# Target file: /tmp/tmpqKBUss/files/000/dataset_2.dat +# Option settings: phmmer --tblout /tmp/tmpqKBUss/files/000/dataset_4.dat --domtblout /tmp/tmpqKBUss/files/000/dataset_5.dat --pfamtblout /tmp/tmpqKBUss/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmpqKBUss/files/000/dataset_1.dat /tmp/tmpqKBUss/files/000/dataset_2.dat +# Current dir: /tmp/tmpqKBUss/job_working_directory/000/3 +# Date: Sat Jun 25 19:48:26 2016 # [ok]
--- a/test-data/phmmer.pfamtblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/phmmer.pfamtblout Sat Jun 25 15:03:08 2016 -0400 @@ -673,11 +673,11 @@ sp|P02024|HBB_GORGO 144.1 3e-46 1 0.0 2 146 2 146 1 145 Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2 # # Program: phmmer -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: test-data/globins45.fa -# Target file: test-data/uniprot_matches.fasta -# Option settings: phmmer --tblout test-data/phmmer.tblout --domtblout test-data/phmmer.domtblout --pfamtblout test-data/phmmer.pfamtblout --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 2 test-data/globins45.fa test-data/uniprot_matches.fasta -# Current dir: /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer -# Date: Mon Feb 9 15:55:11 2015 +# Query file: /tmp/tmpqKBUss/files/000/dataset_1.dat +# Target file: /tmp/tmpqKBUss/files/000/dataset_2.dat +# Option settings: phmmer --tblout /tmp/tmpqKBUss/files/000/dataset_4.dat --domtblout /tmp/tmpqKBUss/files/000/dataset_5.dat --pfamtblout /tmp/tmpqKBUss/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmpqKBUss/files/000/dataset_1.dat /tmp/tmpqKBUss/files/000/dataset_2.dat +# Current dir: /tmp/tmpqKBUss/job_working_directory/000/3 +# Date: Sat Jun 25 19:48:26 2016 # [ok]
--- a/test-data/phmmer.tblout Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/phmmer.tblout Sat Jun 25 15:03:08 2016 -0400 @@ -92,11 +92,11 @@ sp|P02024|HBB_GORGO - HBB2_TRICR - 2.7e-46 144.3 0.0 3e-46 144.1 0.0 1.0 1 0 0 1 1 1 1 Hemoglobin subunit beta OS=Gorilla gorilla gorilla GN=HBB PE=1 SV=2 # # Program: phmmer -# Version: 3.1b1 (May 2013) +# Version: 3.1b2 (February 2015) # Pipeline mode: SEARCH -# Query file: test-data/globins45.fa -# Target file: test-data/uniprot_matches.fasta -# Option settings: phmmer --tblout test-data/phmmer.tblout --domtblout test-data/phmmer.domtblout --pfamtblout test-data/phmmer.pfamtblout --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 2 test-data/globins45.fa test-data/uniprot_matches.fasta -# Current dir: /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer -# Date: Mon Feb 9 15:55:11 2015 +# Query file: /tmp/tmpqKBUss/files/000/dataset_1.dat +# Target file: /tmp/tmpqKBUss/files/000/dataset_2.dat +# Option settings: phmmer --tblout /tmp/tmpqKBUss/files/000/dataset_4.dat --domtblout /tmp/tmpqKBUss/files/000/dataset_5.dat --pfamtblout /tmp/tmpqKBUss/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --EmL 200 --EmN 200 --EvL 200 --EvN 200 --EfL 100 --EfN 200 --Eft 0.04 --seed 4 --cpu 1 /tmp/tmpqKBUss/files/000/dataset_1.dat /tmp/tmpqKBUss/files/000/dataset_2.dat +# Current dir: /tmp/tmpqKBUss/job_working_directory/000/3 +# Date: Sat Jun 25 19:48:26 2016 # [ok]
--- a/test-data/uniprot_globins_match.out Mon Oct 19 21:10:24 2015 -0400 +++ b/test-data/uniprot_globins_match.out Sat Jun 25 15:03:08 2016 -0400 @@ -1,20 +1,18 @@ # hmmsearch :: search profile(s) against a sequence database -# HMMER 3.1b1 (May 2013); http://hmmer.org/ -# Copyright (C) 2013 Howard Hughes Medical Institute. +# HMMER 3.1b2 (February 2015); http://hmmer.org/ +# Copyright (C) 2015 Howard Hughes Medical Institute. # Freely distributed under the GNU General Public License (GPLv3). # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query HMM file: test-data/globins4.hmm -# target sequence database: test-data/uniprot_matches.fasta -# per-seq hits tabular output: test-data/globins.tblout -# per-dom hits tabular output: test-data/globins.domtblout -# pfam-style tabular hit output: test-data/globins.pfamtblout +# query HMM file: /tmp/tmpJW6ntL/files/000/dataset_1.dat +# target sequence database: /tmp/tmpJW6ntL/files/000/dataset_2.dat +# per-seq hits tabular output: /tmp/tmpJW6ntL/files/000/dataset_4.dat +# per-dom hits tabular output: /tmp/tmpJW6ntL/files/000/dataset_5.dat +# pfam-style tabular hit output: /tmp/tmpJW6ntL/files/000/dataset_6.dat # max ASCII text line length: unlimited -# sequence reporting threshold: E-value <= 10 -# domain reporting threshold: E-value <= 10 # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 # random number seed set to: 4 -# number of worker threads: 2 +# number of worker threads: 1 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: globins4 [M=149] @@ -63,7 +61,7 @@ Passed Fwd filter: 2 (1); expected 0.0 (1e-05) Initial search space (Z): 2 [actual number of targets] Domain search space (domZ): 2 [number of targets reported over threshold] -# CPU time: 0.01u 0.00s 00:00:00.01 Elapsed: 00:00:00.00 +# CPU time: 0.00u 0.00s 00:00:00.00 Elapsed: 00:00:00.00 # Mc/sec: inf // [ok]
--- a/tool_dependencies.xml Mon Oct 19 21:10:24 2015 -0400 +++ b/tool_dependencies.xml Sat Jun 25 15:03:08 2016 -0400 @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> - <package name="hmmer" version="3.1b1"> - <repository changeset_revision="6068d6ce40bb" name="package_hmmer_3_1b1" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" /> + <package name="hmmer" version="3.1b2"> + <repository changeset_revision="7adf47fb049c" name="package_hmmer_3_1b2" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" /> </package> </tool_dependency>